CN111394289A

CN111394289A - Genetically engineered bacterium and application thereof, and method for producing prostaglandin E2

Info

Publication number: CN111394289A
Application number: CN201911326101.7A
Authority: CN
Inventors: 王伟; 王康林; 袁哲诚; 金永红; 王颀彤; 贾和平; 胡志浩
Original assignee: Hefei Kangnuo Medicament Development Co ltd
Current assignee: Kaifeng Kangnuo Pharmaceutical Co ltd; Kangnuo Biopharmaceutical Co ltd
Priority date: 2019-12-20
Filing date: 2019-12-20
Publication date: 2020-07-10
Anticipated expiration: 2039-12-20
Also published as: WO2021120566A1; CN111394289B

Abstract

The invention discloses a recombinant escherichia coli, which overexpresses a coding gene of prostaglandin H synthetase and a coding gene of prostaglandin E synthetase. The invention also discloses application of the recombinant escherichia coli in production of prostaglandin E2. The invention also discloses a method for producing prostaglandin E2, which uses arachidonic acid as a substrate to produce prostaglandin E2 by using the recombinant Escherichia coli. The invention constructs an escherichia coli strain capable of expressing prostaglandin H synthetase and prostaglandin E2 synthetase, and the expressed enzyme can be used for directly catalyzing arachidonic acid to be converted into prostaglandin E2.

Description

Genetically engineered bacterium and application thereof, and method for producing prostaglandin E2

Technical Field

The invention relates to the technical field of biology, in particular to a genetically engineered bacterium and application thereof, and a method for producing prostaglandin E2.

Background

Prostaglandin E2 (prostagladin E2, PGE2) is a metabolite of arachidonic acid cyclooxygenase, is an eicosanoid unsaturated fatty acid, is a kind of prostaglandin (prostagladin, PG), and has a molecular formula of C₂₀H₃₂O₅Molecular weight is 352, white crystal, melting point 68-69 deg.C, and water insoluble in organic solvent such as ethyl acetate, acetone, ether methanol and ethanol. PGE2 is an important cell growth and regulatory factor, and its physiological functions are mainly expressed in: dilating blood vessels, increasing organ blood flow, reducing peripheral resistance of blood vessels, and lowering blood pressure; the smooth muscle of the bronchus is relaxed, and the ventilation resistance is reduced; inhibiting gastric acid secretion, and promoting gastrointestinal smooth muscle peristalsis; has immunosuppressive and antiinflammatory effects.

The current main production method of PGE2 is to incubate arachidonic acid in a suspension of the relevant enzyme obtained from sheep seminal vesicles. The process has the disadvantages of inconvenient material acquisition, high cost, complex operation, low conversion rate, more impurities and byproducts and complex subsequent purification.

In addition, it has been reported that PGHS is expressed in Escherichia coli and catalyzes arachidonic acid to form prostaglandin H2, followed by further utilization of SnCl₂The mixed product consisting of prostaglandin F2 α, prostaglandin D2 and prostaglandin E2 is finally obtained by carrying out chemical reduction on the mixed product (Jan Christopher Guder, et al Biotechnol L etters,2014,36: 2193-.

Disclosure of Invention

Based on the technical problems in the background art, the invention provides a genetically engineered bacterium and an application thereof, namely a method for producing prostaglandin E2, wherein an escherichia coli strain capable of expressing prostaglandin H synthetase and prostaglandin E2 synthetase is constructed, and the expressed enzyme can be used for directly catalyzing arachidonic acid to be converted into prostaglandin E2.

The invention provides a recombinant Escherichia coli (Escherichia coli), which overexpresses a coding gene of prostaglandin H synthetase and a coding gene of prostaglandin E synthetase.

Preferably, the nucleotide sequence of the prostaglandin H synthase encoding gene is shown in SEQ ID No. 1.

Preferably, the nucleotide sequence of the prostaglandin E synthetase encoding gene is shown as SEQ ID No.2 or SEQ ID No. 3.

Preferably, the recombinant Escherichia coli (Escherichia coli) B L21 (DE3)/pET28a-PGHS-mPGES1 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No. 19049.

Preferably, the recombinant Escherichia coli (Escherichia coli) B L21 (DE3)/pET28a-PGHS-mPGES2 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No. 19050.

The invention also provides application of the recombinant Escherichia coli (Escherichia coli) in production of prostaglandin E2.

The invention also provides a method for producing prostaglandin E2, which uses arachidonic acid as a substrate to produce prostaglandin E2 by using the recombinant Escherichia coli (Escherichia coli).

Has the advantages that:

the invention constructs an escherichia coli strain capable of expressing prostaglandin H synthetase and prostaglandin E2 synthetase, and the expressed enzyme can be used for directly catalyzing arachidonic acid to be converted into prostaglandin E2. Compared with the traditional prostaglandin E2 preparation method, the preparation method is simple and has high efficiency. Compared with the preparation of prostaglandin by using one enzyme reported in the literature, the invention can directly catalyze arachidonic acid to generate PGE2 by using prostaglandin H synthetase and prostaglandin E2 synthetase simultaneously.

Biological preservation Instructions

The recombinant Escherichia coli (Escherichia coli) B L21 (DE3)/pET28a-PGHS-mPGES1 is classified and named as Escherichia coli (Escherichia coli), and is preserved in CGMCC (China general microbiological culture Collection center) with the address of China, Beijing and the preservation number of CGMCC No.19049 in 28/11 of 2019.

The recombinant Escherichia coli (Escherichia coli) B L21 (DE3)/pET28a-PGHS-mPGES2 is classified and named as Escherichia coli (Escherichia coli), and is preserved in CGMCC (China general microbiological culture Collection center) with the address of China, Beijing and the preservation number of CGMCC No.19050 in 28/11 of 2019.

Drawings

FIG. 1 is a scheme showing the synthesis scheme of prostaglandin E2 from arachidonic acid, where arachidonic acid is arachidonic acid, prostaglandin H2 is prostaglandin H2, prostaglandin E2 is prostaglandin E2, PGHS is prostaglandin H synthase, and PGES is prostaglandin E synthase.

FIG. 2 is a HP L C detection pattern of the reaction solution obtained in example 5.

FIG. 3 is a PCR detection gel of co-expression plasmid pET28a-PGHS-mPGES1 and co-expression plasmid pET28a-PGHS-mPGES2, wherein 1 is co-expression plasmid pET28a-PGHS-mPGES1, 2 is co-expression plasmid pET28a-PGHS-mPGES2, and M is Marker.

Detailed Description

The technical solution of the present invention will be described in detail below with reference to specific examples.

The experimental methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available unless otherwise specified.

The plasmid and strain Escherichia coli TG1 strain (Wuhan vast Ling Biotech Co., Ltd., product No. P1468), Escherichia coli B L21 (DE3) strain (Wuhan vast Ling Biotech Co., Ltd., product No. P1472), and expression vector pET28a (Wuhan vast Ling Biotech Co., Ltd., product No. P0023).

Reagents and instruments: restriction enzymes such as NcoI, BamHI, HindIII and EcoRI (Saimer Feishell technology, China Co., Ltd.), a gel recovery and purification kit (Shanghai Czejust bioengineering Co., Ltd., product No. GK2043-200), a GBclonart seamless cloning kit (Suzhou Shenzhou Gene Co., Ltd., product No. GB2001-48), and JY92-IIN type ultrasonic cell disruptor (Ningbo New technology ultrasonic Equipment Co., Ltd.).

Example 1 prostaglandin H synthetase Gene and prostaglandin E synthetase Gene Synthesis

The inventor carries out codon optimization aiming at an escherichia coli expression system according to the nucleotide sequences of prostaglandin H synthetase, human prostaglandin E synthetase and cynomolgus monkey prostaglandin E synthetase of gracilaria plant gracilaria published by NCBI website (https:// www.ncbi.nlm.nih.gov /), obtains a corresponding optimized nucleotide sequence, and entrusts Suzhou Jinwei Zhi Biotech limited company to carry out gene synthesis; the optimized nucleotide sequences are respectively as follows:

the optimized encoding gene (PGHS encoding gene for short) of the prostaglandin H synthetase of the gracilaria eupatoria has the nucleotide sequence shown as SEQ ID No.1, and the amino acid sequence is as follows:

the nucleotide sequence of the optimized encoding gene of the human prostaglandin E synthetase (abbreviated as mPGES1 encoding gene) is shown as SEQ ID No.2, and the amino acid sequence is as follows:

the nucleotide sequence of the optimized prostaglandin E synthetase encoding gene (mPGES 2 encoding gene for short) of the cynomolgus monkey is shown as SEQ ID No.3, and the amino acid sequence is as follows:

example 2 construction of prostaglandin H synthase PGHS and prostaglandin E synthase PGES expression plasmids

Construction of plasmid pET28a-PGHS 1

1.1 taking the PGHS coding gene synthesized in the embodiment 1 as a template, and utilizing a PGHS-F/PGHS-R primer pair to amplify to obtain a PGHS fragment with the size of 1738 bp;

1.2 taking an expression vector pET28a, and carrying out enzyme digestion by using restriction enzymes NcoI and BamHI to obtain a vector fragment 1; after the vector fragment 1 and the PGHS fragment are subjected to gel recovery and purification by using a gel recovery and purification kit, the vector fragment 1 and the PGHS fragment are subjected to seamless cloning and recombination by using a GBclonart seamless cloning kit, transformed into competent cells of an Escherichia coli TG1 strain, and finally constructed to obtain a plasmid pET28 a-PGHS;

2 Co-expression plasmid pET28a-PGHS-mPGES1, Co-expression plasmid pET28a-PGHS-mPGES2 construction

2.1 taking the mPGES1 coding gene synthesized in example 1 as a template, and utilizing mPGES1-F/mPGES1-R primer pair to carry out amplification to obtain an mPGES1 fragment with the size of 525 bp;

2.2 taking the mPGES2 coding gene synthesized in example 1 as a template, and utilizing mPGES2-F/mPGES2-R primer pair to carry out amplification to obtain an mPGES2 fragment with the size of 960 bp;

2.3 taking plasmid pET28a-PGHS, and carrying out enzyme digestion by using restriction enzymes EcoRI and HindIII to obtain a vector fragment 2; after the gel recovery and purification kit is used for carrying out gel recovery and purification on the vector fragment 2, the mPGES1 fragment and the mPGES2 fragment, a co-expression plasmid pET28a-PGHS-mPGES1 and a co-expression plasmid pET28a-PGHS-mPGES2 are constructed by a seamless cloning technology;

2.4 PCR verification of the co-expression plasmid pET28a-PGHS-mPGES1 and the co-expression plasmid pET28a-PGHS-mPGES2 by using a primer pair pET28a-YZ-F/pET28a-YZ-R, and the result is shown in FIG. 3, FIG. 3 is a PCR detection gel map of the co-expression plasmid pET28 a-PGHS-mPGGES 1 and the co-expression plasmid pET28 a-PGHS-mPGGES 2, wherein 1 is the co-expression plasmid pET28 a-PGHS-mPGGES 1, 2 is the co-expression plasmid pET28 a-PGHS-mPGS 2, and M is Marker; as can be seen from FIG. 3, the PCR of the co-expression plasmid pET28a-PGHS-mPGES1 verified that the size of the band was 2543bp and the size of the band was correct; the PCR of the co-expression plasmid pET28a-PGHS-mPGES2 verifies that the size of the strip is 2967bp and is correct;

2.5 sending the co-expression plasmid pET28a-PGHS-mPGES1 and the co-expression plasmid pET28a-PGHS-mPGES2 to Jinzhi Biotech, Suzhou for sequencing detection, and reserving after sequencing is correct;

TABLE 1 sequences of primer pairs in example 2

EXAMPLE 3 obtaining of recombinant Strain

1 preparation of B L21 (DE3) competent cells:

selecting a ring of Escherichia coli B L21 (DE3) from glycerol tube, streaking and purifying on L B plate, culturing at 37 deg.C for 16h, selecting single colony, inoculating into test tube containing 4m L L B culture medium (tryptone 10 g/L, yeast extract 5 g/L, sodium chloride 10 g/L), culturing at 37 deg.C and 250rpm for 16h, transferring into shake flask containing 50m L L B culture medium according to 2%, and culturing at 37 deg.C to OD L L B₆₀₀0.8, the cells were collected, pre-cooled on ice, centrifuged to remove the supernatant, and then ice-cooled 0.1M CaCl₂The cells were washed twice with the solution and finally 2ml of pre-cooled 0.1M CaCl containing 15% glycerol₂Resuspending the thallus in the solution, subpackaging, and placing on ice to obtain competent cells of Escherichia coli B L21 (DE 3);

2 preparation of recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES 1:

adding 100ng of co-expression plasmid pET28a-PGHS-mPGES1 into 100 mu L Escherichia coli B L21 (DE3) competent cells, placing on ice for a moment, carrying out water bath at 42 ℃ for 2min, rapidly placing on ice for cooling for 3-5min, adding 1ml of L B liquid culture medium, uniformly mixing, then carrying out shaking recovery culture at 37 ℃ and 250rpm for 1h to obtain a culture solution, coating the 100-inch L culture solution on a L B plate containing 50 mu g/ml kanamycin, carrying out culture at 37 ℃ for 16h, and finally obtaining a recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28 a-PGHS-mPGGES 1, wherein the strain is preserved in China general microbiological culture center CGMCC with the preservation number of CGMCC No. 19049;

3 preparation of recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES 2:

the co-expression plasmid pET28a-PGHS-mPGES2 was taken, and the recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES2 which was deposited in CGMCC No.19050, was prepared according to the procedure of 2 steps in example 3.

Example 4 Shake flask preparation of prostaglandin H synthetase and prostaglandin E synthetase

1 culturing recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES 1:

the recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES1 obtained in example 3 was inoculated into L B medium containing 50. mu.g/ml kanamycin, cultured at 250rpm in a shaker at 37 ℃ for 20 hours to obtain an activated strain, inoculated into 50m L L B medium containing 50. mu.g/ml kanamycin at 0.8% inoculum size, grown at 37 ℃ to OD L₆₀₀Adding isopropyl- β -D-thiogalactoside (IPTG) to 0.6-0.8, inducing and culturing at 30 deg.C for 20 hr until the final concentration of IPTG is 0.2mM, centrifuging to collect the thallus, and re-suspending the thallus to 5ml with 50mM phosphate buffer solution of pH8.0 to obtain culture broth;

2 culturing recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES 2:

the recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES2 obtained in example 3 was used to prepare a culture broth by the procedure of example 4;

3 preparation of crude enzyme solution containing prostaglandin H synthase and prostaglandin E synthase:

carrying out ultrasonic crushing on the culture bacteria liquid prepared in the steps 1 and 2 in the embodiment 4 by using a JY92-IIN type ultrasonic cell crusher to obtain two cell-crushing liquids; and respectively centrifuging the two cell-breaking solutions to obtain supernatants to obtain two crude enzyme solutions containing prostaglandin H synthetase and prostaglandin E synthetase, wherein the ultrasonication conditions are as follows: the ultrasonic treatment is circulated in a mode of a gap of 4s after every 2s of ultrasonic treatment, the total ultrasonic treatment time is 10min, the ultrasonic treatment temperature is 0 ℃, and the ultrasonic treatment power is 40%.

EXAMPLE 5 enzymatic preparation of prostaglandin E2

Arachidonic acid (final concentration 1 g/L) was dissolved in 50mM, pH8.0 phosphate buffer (0.2067 g NaH was weighed)₂PO₄·2H₂O and 8.4757g Na₂HPO₄·12H₂Dissolving O in deionized water and fixing the volume to a 500ml volumetric flask), then adding glutathione (GSH for short) with the final concentration of 0.75mg/ml to obtain a substrate solution, then adding the crude enzyme solution containing prostaglandin H synthetase and prostaglandin E synthetase prepared in the example 4 into the substrate solution, wherein the volume ratio of the crude enzyme solution to the substrate solution is 1: 1, stirring and ventilating at 26 ℃ for 4 hours to obtain a reaction solution, detecting the reaction solution by HP L C, and the yield of prostaglandin E2 is 0.85 g/L.

Note that the concentration of the phosphate buffer may be replaced with any value of 50 to 100 mM; the pH value of the phosphate buffer solution can be replaced by any value of pH 7.8-8.1; the reaction temperature of 26 ℃ can be replaced by any value of 25-28 ℃; the reaction time 4h can be replaced by any value from 2 to 6 h.

Example 6HP L C detection of arachidonic acid and prostaglandin E2

The chromatographic conditions of HP L C are that a chromatographic column is Agilent XDB C18(4.6 × 150mM, 5 μm), a ultraviolet detector detects that the wavelength is 210nm, the sample injection amount is 10 μ L, the column temperature is 30 ℃, the initial flow rate is 1.0ml/min, the mobile phase A is acetonitrile, the mobile phase B is ammonium acetate aqueous solution with the pH value of 4.0 and the concentration of 10mM, and the gradient elution is carried out, wherein the volume ratio of the mobile phase A to the mobile phase B is 30: 70 when the elution procedure is 0-0.01min, the volume ratio of the mobile phase A to the mobile phase B is 95: 5 from 30: 70 at constant speed when the time is 0.01-12.00min, the volume ratio of the mobile phase A to the mobile phase B is 95: 5 from 30: 70 when the elution procedure is 12.00-14.00min, the volume ratio of the mobile phase A to the mobile phase B is 95: 5 from 95: 5 when the elution is 12.00-14.00min, the volume ratio of the mobile phase A to the mobile phase B is 30: 70 from 95: 5 when the elution procedure is 14.00-15.00min, the elution procedure is 15.00;

when the flow rate is 12.00-12.01min, the flow rate is gradually changed from 1.0ml/min to 1.2ml/min at constant speed; the flow rate is 1.2ml/min when the time is 12.01-19.00 min.

The specific operation is that 0.8ml of the reaction liquid obtained in the example 5 is put into a 2ml centrifuge tube, 0.8ml of acetonitrile is added, the mixture is centrifuged, the filtrate is filtered by a 0.22 mu m filter membrane, the sample is taken, and a chromatogram is recorded, wherein the typical chromatogram is shown in figure 2, figure 2 is an HP L C detection spectrum of the reaction liquid obtained in the example 5, and the retention time of prostaglandin E2 is 5.24min and the retention time of arachidonic acid is 14.46min as shown in figure 2.

Example 7 Whole-cell catalysis of arachidonic acid to prostaglandin E2

1 Total cell catalyzed production of prostaglandin E2 with recombinant E.coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES 1:

the recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES1 obtained in example 3 was inoculated into liquid L B medium containing 50. mu.g/ml kanamycin, cultured at 250rpm in a shaker at 37 ℃ for 20 hours to obtain an activated strain, inoculated into 400m L L B medium containing 50. mu.g/ml kanamycin at 0.8% inoculum size, grown at 37 ℃ to OD₆₀₀0.6 to 0.8, isopropyl- β -D-thiogalactoside (IPTG) and arachidonic acid were added to a final concentration of 0.1mM for IPTG and 100. mu.M for arachidonic acid, and after further induction culture at 20 ℃ for 20 hours, the mixture was centrifuged at 7000rpm for 30 minutes, the supernatant was collected, the organic phase was extracted with ethyl acetate, and the mixture was rotary evaporated until the ethyl acetate was completely volatilized, and then 1.5ml of acetonitrile was added thereto for sufficient dissolution, followed by filtration through an organic phase filter and detection with HP L C (the chromatographic conditions for HP L C were the same as in example 6), and the purity of prostaglandin E2 was 2.547%.

2 the whole-cell catalytic production of prostaglandin E2 by recombinant Escherichia coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES 2:

the recombinant E.coli (Escherichia coli) strain B L21 (DE3)/pET28a-PGHS-mPGES2 obtained in example 3 was used to prepare prostaglandin E2 with a purity of 1.945% by the procedure of 1 step in example 7.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.

Sequence listing

<110> Hefei Kangno drug development Co., Ltd

<120> a recombinant Escherichia coli, use thereof, and method for producing prostaglandin E2

<130>2019

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>1689

<212>DNA

<213> Artificial sequence ()

<400>1

atggtgttta acaactttcg caatctgatt acccgttgtg gtggtctggg taataccttt 60

agcatgtggc tgcgtgcaaa ctttaaaccg ttttgggcag cactgcaaaa tattccggtt 120

attaaagatg tgctgaacca gttttatctg agcgcactgc tgaaaaaatt catcaaaagc 180

gttccgcgtc tgccgaatca taatctgcgt aatgattttc cgagcctgta taccgtttat 240

gatgaaagcc gtaccaccta tagccgtctg ctgcctcgtc agccggaata taccgaaggt 300

ctgccggatc tggatctggc aagcagttgt tttctgcgtg aaaattttgt tccggaaacc 360

aatcgtaatc tgagcctgct gattggtttt tatgcacagt ggtttagcca ccagtttttt 420

aacaccaatc cggaagatca taccaaagtt aatcagccgg ttggtattaa tctgggtcaa 480

ctgtatggta gcaccgcaga acgtatgaaa agcctgcgta gcggtaaact gggtctgctg 540

aaatcaagcg ttcgtaatgg tctggaattt ccgcctatta ttccgattcc gaaagatgaa 600

agcggtcaga ataaaatccc gattccgggt gatgaaatgt ttgatatccc gtttccgatg 660

gcaaatagca ttccgtgttt tgcagcagtt cacgtgatct tttttcgtcg tcatcagtat 720

gtttgtcgtg aactggcaaa atgggcaagc gcaaatggta aaaccatgag tgatgaagag 780

atgtatcaga aagccaaaat tatcgtggcc attaatgttc tgcgtctgac catgcatgat 840

tatgttgcag aaggcctgca aagcagccat gtgaaaatca aattcgacca taaagtgaaa 900

aaaagcctga tctggaaatt tttcggtccg ggtacatatcatccgagcaa tgcaattcag 960

accgaattta actttctgta tcgctggcat cagtttatcc cggaagaaat taaagttgtg 1020

aaagacctgc cggtgtccaa taatcaggat atgaaagcac tggttccgga catcgataaa 1080

tatgataatg atagcctgac ctttcctgat ccggatagct ggtttggtga agattggaat 1140

gcagttaaat ggctgaccga gaaagaaaat ggcctggaac gtctgatttt tagcgcagca 1200

agccagcgtg caggcaaact gaccctgctg aataccaaca aatggctggt taaaaacgtg 1260

atcaaaccgg gtatgaaaaa atgccgtgaa tatgaactgg ccagctataa tgattatcgc 1320

gaacattttg gttttcgccg tgtcaaaaaa ttcgagcaga ttaccaccga tgcagcaatt 1380

ctggcaaaac tgaaacaggt ttataaagac gttgaccagg tggaatatta tccgggtatc 1440

tttgccgaaa acaaagattt tggtggtgtt catggtccgt ttctggcagc cattggtgtg 1500

ggtatgacct attgtggtat ttttgcaagc cgtctgtttg aaaccgatat ctttaatgaa 1560

aaaaccctga ccagcaaagg tgttgaactg gcgaatgaaa ttaactatat tcgtgatatg 1620

acccgcatgc ataccaatct gggtgaagca aaagttcatt ttaccgtgcc gaaaaataac 1680

ccggtgtaa 1689

<210>2

<211>459

<212>DNA

<213> Artificial sequence ()

<400>2

atgccggcac attcactggt gatgtcatct cccgcgctac ccgcgtttct gctgtgtagt 60

accctgttag tgattaaaat gtatgtggtt gcaattatta ccggtcaggt tcgcttacgc 120

aaaaaagcct ttgccaatcc ggaagatgcc ttacgtcatg gcggtccgca gtattgtcgc 180

tcagatccgg atgttgaacg ctgtctgcgc gcacatcgta atgatatgga aaccatttat 240

ccgtttttat ttttaggctt tgtgtatagc tttctgggtc cgaatccgtt tgttgcatgg 300

atgcattttc tggtgtttct ggttggtcgc gtggcccata ccgtggcata tttaggtaaa 360

ctgcgcgccc cgattcgtag cgtgacctat accttagccc agttaccgtg tgcaagtatg 420

gcattacaaa ttctgtggga agcagcacgt catctgtaa 459

<210>3

<211>876

<212>DNA

<213> Artificial sequence ()

<400>3

atggagcgct cagcagtgca gctctccctg tccagccgcc tgcagctgac cctgtaccag 60

tacaagacgt gtcccttctg cagcaaggtc cgagccttcc tcgacttcca cgccctgccc 120

taccaggtgg tggaggtgaa ccccgtgctc agggctgaga tcaagttctc ctcgtacaga 180

aaggtgccca tcctggtggc ccaggaagga gaaagctcgc aacaactgaa tgactcctct 240

gtcatcatca gcgccctcaa gacctacctg gtgtcggggc agcccctgga agagatcatc 300

acctactacc cagccatgaa ggctgtgaat gaccagggca aggaggtgac cgagttcggc 360

aataaatact ggctcatgct aaacgagaag gaggcccagc aagtgtacag cgggaaggag 420

gccaggacgg aggagatgaa gtggcggcag tgggcagacg actggctggt ccacctgatc 480

tcccccaatg tgtaccgcac acccaccgag gctctggcat cctttgacta cattgtccgc 540

gagggcaagt tcggagccgt ggagggagcc gtggccaagt acatgggtgc agcggccatg 600

tacctcatca gcaagcgact caagagcagg caccgcctcc aggacaacgt gcgcgaggac 660

ctctacgagg ctgccgacaa gtgggtggct gctgtgggca aggaccggcc cttcatgggg 720

ggccagaagc cgaatctcgc tgatttggca gtgtatggcg tgctgcgcgt gatggagggg 780

ttggatgcct tcgatgacct gatgcagcac acgcatatcc agccctggta cctgcgggtg 840

gagagggcca tcaccgaggc ctccccagcg cactga 876

Claims

1. A recombinant Escherichia coli (Escherichia coli) overexpressing a gene encoding prostaglandin H synthase and a gene encoding prostaglandin E synthase.

2. The recombinant Escherichia coli (Escherichia coli) according to claim 1, wherein the nucleotide sequence of the gene encoding prostaglandin H synthase is represented by SEQ ID No. 1.

3. The recombinant Escherichia coli (Escherichia coli) according to claim 1 or 2, wherein the nucleotide sequence of the prostaglandin E synthase encoding gene is represented by SEQ ID No.2 or SEQ ID No. 3.

4. The recombinant Escherichia coli (Escherichia coli) according to any one of claims 1 to 3, wherein the recombinant Escherichia coli (Escherichia coli) B L21 (DE3)/pET28a-PGHS-mPGES1 is deposited in China general microbiological culture Collection center (CGMCC) with the accession number of CGMCC No. 19049.

5. The recombinant Escherichia coli (Escherichia coli) according to any one of claims 1 to 3, wherein the recombinant Escherichia coli (Escherichia coli) B L21 (DE3)/pET28a-PGHS-mPGES2 is deposited in China general microbiological culture Collection center (CGMCC) with the accession number of CGMCC No. 19050.

6. Use of a recombinant E.coli (Escherichia coli) according to any one of claims 1 to 5 for the production of prostaglandin E2.

7. A method for producing prostaglandin E2, characterized in that prostaglandin E2 is produced using the recombinant Escherichia coli (Escherichia coli) according to any one of claims 1 to 5, using arachidonic acid as a substrate.