CN111334518A

CN111334518A - Method for detecting Annexin V fluorescent marker of early apoptosis of cells

Info

Publication number: CN111334518A
Application number: CN201811550905.0A
Authority: CN
Inventors: 徐兆超; 苗露; 乔庆龙
Original assignee: Dalian Institute of Chemical Physics of CAS
Current assignee: Dalian Institute of Chemical Physics of CAS
Priority date: 2018-12-18
Filing date: 2018-12-18
Publication date: 2020-06-26

Abstract

The invention provides a method for detecting Annexin V fluorescent marker of early apoptosis of cells, which comprises the following specific steps: (1) constructing pET-22b-SNAP-Annexin V gene fusion plasmid vector; (2) pET-22b-SNAP-Annexin V fusion protein is expressed and purified through pronucleus; (3) the fusion protein is labeled with a fluorescent small molecule and purified. The Annexin V protein is one of the best PS binding receptors discovered at present, and is expressed by high selectivity and high binding force for PS binding, and the fluorescence-labeled Annexin V is one of the most common reagents for detecting early apoptosis at present. The invention creates a new method for fluorescent labeling of Annexin V, which comprises the steps of firstly fusing, expressing and purifying SNAP tag protein and Annexin V protein by a genetic engineering method, then labeling the fusion protein by using a small molecular fluorescent probe connected with a specific substrate BG group of SNAP protein so as to label Annexin V, and detecting apoptotic cells by cell imaging or a flow cytometer. The invention has important significance for the research of the apoptosis process.

Description

Method for detecting Annexin V fluorescent marker of early apoptosis of cells

Technical Field

The invention belongs to the field of biological analysis and detection, and particularly relates to a method for detecting an annexin V fluorescent marker of early apoptosis of cells.

Background

Apoptosis is the programmed death that occurs as a result of the organism's maintenance of homeostasis. Abnormal apoptosis can cause various diseases such as tumor, neurodegeneration and autoimmunity. Based on the characteristics of in situ, real time and high sensitivity, the fluorescence detection of apoptosis can trace the apoptosis process, help to analyze the occurrence mechanism of diseases related to apoptosis abnormality, screen new drugs and establish an effective treatment method. Phosphotidylserine (PS) is located inside the cytoplasmic membrane in normal cells, whereas in the early stages of apoptosis PS flips from the inside of the cytoplasmic membrane to the outside of the cytoplasmic membrane and is an important signal for the onset of apoptosis. Thus, PS is used as a reliable marker for detecting apoptosis, and apoptotic cells can be detected by recognizing PS on the outer membrane of cells. The Annexin V protein is one of the best PS binding receptors discovered at present and is expressed by high selectivity and high binding force for PS binding, and the fluorescence-labeled Annexin V becomes one of the most common reagents for detecting early apoptosis at present.

Annexin V realizes fluorescent labeling mainly through a mode of covalently connecting small-molecule organic fluorescent dye or fusion fluorescent protein. The organic fluorescent dye is coupled with side chain amino on Annexin V protein to realize labeling, but the reaction has no selectivity, and the number of labeled sites on Annexin V and the number of connected fluorescent dye molecules are difficult to control. Studies have shown that labeling with more than two fluorochrome molecules results in inactivation of Annexin V. The realization of the fluorescent single-molecule marking process which does not influence the activity of Annexin V is difficult, so that the commercial Annexin V reagent marked by the efficient fluorescent dye is expensive. The fluorescent protein adopts a genetic coding fusion mode, solves the problems of fixed-point and quantitative marking, but has poor light stability and limited wavelength range, so that the application is limited, and meanwhile, the consideration that the size is too large to influence the activity of Annexin V exists.

The protein label fluorescent labeling method is a commonly used protein fixed-point labeling method at present, and the action process is that firstly, the label protein and the target protein are fused and expressed, and then the fluorescent micromolecules with substrate groups realize labeling through the specific action of the fluorescent micromolecules and the label protein. The SNAP tag protein is a commonly used protein tag, and the SNAP tag protein can react with O⁶Modified benzyl guanines (commonly referred to as BG)Group) is covalently linked through affinity reaction, so that the fluorescent small molecule connected with the BG group can specifically and rapidly react with the SNAP tag protein to further mark the target protein.

Disclosure of Invention

The invention develops a method for detecting Annexin V fluorescent marker of early apoptosis of cells. Firstly, constructing a plasmid vector fused by the SNAP tag protein and Annexin V protein by a genetic engineering method, then carrying out prokaryotic expression and purification, marking the fusion protein by a small molecular fluorescent probe connected with a specific substrate BG group of the SNAP protein and purifying, and detecting apoptotic cells by a flow cytometer. The invention has important significance for the research of the apoptosis process.

The invention relates to a method for detecting Annexin V fluorescent marker of early apoptosis of cells, which comprises the following specific marking methods:

(1) construction of PET-22b-SNAP-Annexin V Gene fusion plasmid vector

(2) Through prokaryotic expression and purification of PET-22b-SNAP-Annexin V fusion protein

(3) Labeling and purifying the fusion protein with fluorescent small molecules

A method for detecting Annexin V fluorescent marker of early apoptosis of cells, pET-22b-SNAP-Annexin V fusion gene plasmid vector construction method is as follows:

(1) designing a primer: designing upstream and downstream primers of an Annexin V target fragment, introducing an Nhe1 enzyme cutting site, and introducing a protective base upstream of the enzyme cutting site, wherein the primers are as follows:

upstream primer 5 'TACTAGCTAGCATGGCACAGG TTCTCAGAGG 3'

Downstream primer 5 'ACTAGCTAGCGTCATCTTCT CCACAGAGCA G3'

(2) PCR amplification of Annexin V target gene

30-50 mu L of PCR reaction system, 3-5 mu L of PCR buffer (10 ×), 3-5 mu L of dNTP (10 ×), 0.5-2 mu L of pCMV-annexin V, 0.5-1 mu L of each upstream primer and downstream primer (20nM), 0.3-0.5 mu L of pfu DNA polymerase and sterile double distilled water till the total volume is 30-50 mu L.

The PCR reaction conditions were as follows: 30sec at 95 ℃; [95 ℃ for 30 sec; 1min at 55-58 ℃; 1-5min at 68-72 ℃; 16-25 cycles; 3min at 68-72 ℃; keeping the temperature at 4 ℃.

And after the PCR is finished, purifying the target fragment by using a PCR purification kit, then carrying out enzyme digestion by using NheI to expose the enzyme digestion site, running 0.8% agarose nucleic acid electrophoresis, cutting the gel and recovering to obtain the Annexin V target gene fragment.

(3) 30-50 mu L of restriction enzyme pET-22b-SNAPf plasmid vector restriction enzyme system, 3-5 mu L of Buffer M (10 ×), 5-15 mu L of pET-22b-SNAPf plasmid, 1.5-3 mu L of Nhe I, sterilizing double distilled water till the total volume is 30-50 mu L, carrying out restriction enzyme overnight at 37 ℃, then running 0.8% agarose nucleic acid electrophoresis, cutting gel and recycling large fragments, (4) connecting Annexin V and pET-22b-SNAPf fragments to obtain the fusion plasmid vector

10-20 mu L of a connection system, wherein the molar ratio of Annexin V recovered by the gel cutting to pET-22b-SNAPf is (6-10):1, 1-2 mu L of connection buffer (10 ×), 0.5-1 mu L of T4 ligase, and 5-10 mu L of connection products are taken to be transferred to E.coli DH5 competence after supplementing sterile double distilled water to the total volume of 10-20 mu L.4 ℃ for connection for 4-8 hours, and single-spot sequencing is selected to determine the connection result, thus obtaining the pET-22b-SNAP-Annexin V fusion plasmid vector.

A method for detecting Annexin V fluorescent label of early apoptosis of cells comprises the following steps of prokaryotic expression and purification of PET-22b-SNAP-Annexin V fusion protein:

the constructed plasmid is transferred into E.coli BL21 competent cells, the cells are paved and cultured overnight at 37 ℃, and single spots are picked up in 10-30mL LB culture medium containing 50-100 mug/mL Amp and cultured overnight at 37 ℃. The next day, the bacterial solution was transferred to 30-2000mL LB medium containing 50-100. mu.g/mL Amp until OD₆₀₀About 0.1, shake culture at 37 ℃, and real-time monitoring of OD₆₀₀Change when OD is₆₀₀When the concentration reaches 0.6-0.8, adding inducer IPTG to the final concentration of 0.5-1mM, culturing at 28-37 ℃ for 3-5h, collecting the thallus, centrifuging at 8000-12000rpm for 5-10 min, and discarding the supernatant. The cells were resuspended in Tris-HCl buffer at pH 8.0 and washed twice by centrifugation. The collected cells were resuspended in 10-30mL of 20mM PBS buffer (pH 7.4), and PMSF, a protease inhibitor, was added to a final concentration of 0.1 mM. The bacterial liquid was sonicated in an ice bath (400W, 10min), followed by centrifugation at 12000-14000rpm for 10-30min in a high-speed centrifuge, and the supernatant was collected. Then using Ni NTA affinity columnPurification was performed by elution with 100-500mM imidazolium. Finally, further purifying by using a sephadex column G-75 to obtain the pure target protein.

A method for detecting Annexin V fluorescent marker of early apoptosis of cells, which comprises the following steps of marking fusion protein by fluorescent micromolecules and purifying: mixing the fluorescent micromolecules and the fusion protein in a PBS solution in a molar ratio of 2-10:1, standing for 0.5-2h at room temperature, and removing the redundant fluorescent micromolecules through a sephadex column G-25. Wherein the fluorescent small molecule is any fluorophore connected with a BG group.

The fluorescent small molecule is SNAP-tag dye, specifically comprises commercial dyes SNAP-Cell505-Star, SNAP-Cell TMR Star and SNAP-Surface Alexa

488, SNAP-Surface549(NEB, 1mM), and the self-developing dye SNAP-DAC, the formula of which is as follows:

a method for detecting the fluorescent marker of Annexin V of early apoptosis of cells, wherein the fluorescent marker of Annexin V is used for detecting the early apoptosis of cells, and the method can detect the early apoptosis of any cell.

The invention has the advantages and beneficial effects that:

the method for labeling the Annexin V protein enables the Annexin V protein to be labeled with a single fluorophore, the fluorophore is far away from the active center of the Annexin V protein, and the activity of the Annexin V protein is not affected.

Drawings

FIG. 1 is a 0.8% agarose gel electrophoresis of the Annexin V target gene described in example 1 after digestion;

FIG. 2 is a 0.8% agarose gel electrophoresis of the pET-22b-SNAPf plasmid vector described in example 2 after digestion;

FIG. 3 is a 0.8% agarose gel electrophoresis of pET-22b-SNAP-Annexin V fusion gene plasmid vector screening described in example 3.

FIG. 4 is an SDS-PAGE electrophoresis of pET-22b-SNAP-Annexin V fusion gene plasmid vectors prepared in example 3 described in example 4 after expression and purification in prokaryotic E.coli cells.

FIG. 5 is a cell image of early apoptosis of Hela cells by the SNAP-DAC fluorescence labeled SNAP-Annexin V fusion protein prepared in example 5 described in example 9.

FIG. 6 shows flow cytometry detection of early apoptosis of Hela cells by SNAP-DAC fluorescently labeled SNAP-Annexin V fusion protein prepared in example 5 described in example 10

Detailed Description

The following examples further illustrate the invention but are not intended to limit the invention thereto.

Example 1

(1) Obtaining an Annexin V target gene:

designing a primer: designing upstream and downstream primers of an Annexin V target fragment, introducing a Nhe1 enzyme cutting site (GCTAGC), introducing protective bases TACTA and ACTA upstream of the enzyme cutting site, and carrying out the following steps of:

upstream primer 5 'TACTAGCTAGCATGGCACAGG TTCTCAGAGG 3'

Downstream primer 5 'ACTAGCTAGCGTCATCTTCT CCACAGAGCA G3'

PCR amplification of the Annexin V target gene is carried out by PCR reaction system 50 μ L, PCR buffer 5 μ L, dNTP 5 μ L, pCMV-Annexin V1 μ L, upstream and downstream primers 20nM each, pfu DNA polymerase 0.5 μ L, and sterile double distilled water 36.5 μ L under conditions of 95 deg.C 30sec, [ 56 deg.C 1 min; 68 deg.C 4min ]; [ 25 cycles ], 68 deg.C 3min, 4 deg.C incubation, running 0.8% agarose nucleic acid electrophoresis after PCR, purifying the target fragment with PCR purification kit, digesting with NheI to expose the digestion site, running 0.8% agarose nucleic acid electrophoresis to obtain FIG. 1, cutting and recovering the Annexin V target gene fragment, and measuring the concentration to be 0.2 μ g/μ L.

The electrophoretogram of the digested Annexin V target gene after PCR is shown in FIG. 1: wherein the first track is DNAmarker, the second track and the third track are bands obtained after enzyme digestion of the Annexin V target gene, and the molecular weight of the Annexin V target gene is about 1000bp and is consistent with a nucleic acid electrophoresis image.

(2) Plasmid vector for cutting pET-22b-SNAPf

The restriction system was 30. mu.L of Buffer M (10 ×) 3. mu.L, 10. mu.L of pET-22b-SNAPf plasmid (0.26. mu.g/. mu.L), 1.5. mu.L of Nhe I, sterilized double distilled water 15.5. mu.L, and restriction at 37 ℃ overnight, followed by running 0.8% agarose gel electrophoresis to obtain FIG. 2, and the large fragment was recovered from the gel at a concentration of about 0.1. mu.g/. mu.L.

The electrophoretogram of the nucleic acid after the digestion of the pET-22b-SNAPf plasmid vector is shown in FIG. 2: wherein the first channel is DNAmarker, the second channel is target fragment after enzyme digestion of pET-22b-SNAPf plasmid vector, the pET-22b-SNAPf plasmid is about 6000bp, and accords with nucleic acid electrophoresis picture

(3) Construction of pET-22b-SNAP-Annexin V fusion gene plasmid vector

Three sets of ligation systems were constructed for ligation of Annexin V and pET-22b-SNAPf fragments, the molar ratios of Annexin V to pET-22b-SNAPf were about 3:1,6:1 and 10:1, respectively, 10. mu.L of the first set of ligation system, 0.5. mu.L of Annexin V (0.2. mu.g/. mu.L) recovered from the above gel cutting, 2. mu.L of pET-22b-SNAPf (0.1. mu.g/. mu.L), 1. mu.L of buffer (10 ×), 0.5. mu.L of T4 ligase, 6. mu.L of sterile double distilled water, 10. mu.L of the second set of ligation system, 1. mu.L of Annexin V (0.2. mu.g/. mu.L) recovered from the above gel cutting, 2. mu.L of pET-22b-SNAPf (0.1. mu.g/. mu.L) 2. mu.L, 2. mu.L of pET-22b-SNAPf (0.1. mu.g/. mu.L), 2. mu.L of pET-22 b-APf (0.g/. mu.L), 2. mu.L) DNA, 1. mu.L of single-PCR products were obtained by single-gel electrophoresis, 1, 10. mu.8. mu.L of PCR products were extracted from three sets of PCR products, 10. mu.8. mu.L of PCR products, 10. mu.8. mu.L of PCR products were ligated and digested.

The agarose nucleic acid electrophoresis picture of pET-22b-SNAP-Annexin V fusion gene plasmid is shown in FIG. 3: lanes 1-4 and 6-9 are electrophoresis bands for extracting plasmid vectors after single-spot picking, lane 5 is DNA marker, and the number of bases in lanes 2 and 4 is obviously more than that of other bands from the figure, which indicates that the ligation is possible to be successful, and the other bands with less bases are probably self-ligated pET-22b-SNAPf vectors. The plasmid in lane 2 and 4 was subsequently sequenced to confirm that it was pET-22b-SNAP-Annexin V fusion plasmid vector.

(4) Prokaryotic expression and purification of pET-22b-SNAP-Annexin V fusion protein process as follows:

the constructed plasmid pET-22b-SNAP-Annexin V is transferred into E.coli BL21 competent cells, the E.coli BL21 competent cells are paved and cultured overnight at 37 ℃, and single spots are picked up in 10mL LB culture medium containing 50 mu g/mL Amp and cultured overnight at 37 ℃. The next day, the bacterial solution was transferred to 300mL LB medium containing 50. mu.g/mL Amp until OD₆₀₀About 0.1, shake culture at 37 ℃, and real-time monitoring of OD₆₀₀Change when OD is₆₀₀When the concentration reached 0.8, the inducer IPTG was added to a final concentration of 1mM, and after culturing at 37 ℃ for 4 hours, the cells were collected, centrifuged at 8000rpm for 10 minutes, and the supernatant was discarded. The cells were resuspended in Tris-HCl buffer at pH 8.0 and washed twice by centrifugation. The collected cells were resuspended in 15mL of 20mM PBS buffer (pH 7.4), and PMSF, a protease inhibitor, was added to a final concentration of 0.1 mM. The cell suspension was sonicated in an ice bath (400W, 10min), followed by centrifugation at 14000rpm for 20min in a high speed centrifuge and the supernatant was collected. Then, the protein was purified by Ni NTA affinity column, and the target protein was eluted with 200mM imidazole salt. Finally, further purifying by using a sephadex column G-75 to obtain the pure target protein with the yield of about 5 mg/L.

The electrophoretogram of the target protein by 15% SDS-PAGE is shown in FIG. 4: wherein the first track is a protein marker; the second is the target protein band eluted with 200mM imidazolium salt through Ni NTA affinity column, containing a small amount of hetero protein; the third is a target protein band obtained by further purifying by using a sephadex column G-75, the theoretical value of the molecular weight of the target protein is 60kDa, and the molecular weight accords with the result of SDS-PAGE electrophoresis.

(5) Fluorescent small molecule marking SNAP-Annexin V fusion protein and purifying

Commercial SNAP-tag dye SNAP-Cell505-Star, SNAP-Cell TMR Star, SNAP-Surface Alexa with BG group

488, SNAP-Surface549(NEB, 1mM), and the self-developing dye SNAP-DAC (1mM) 10. mu.L were added to 1mL of PBS (20mM, pH 7.4) containing SNAP-Annexin V fusion protein (4. mu.M), and the mixture was allowed to stand at room temperature for 1 hour, and then passed through Sephadex column G-25 to remove the excess fluorescent small molecules.

Example 2

Example 5 fluorescent imaging experiment of SNAP-DAC fluorescence-labeled SNAP-Annexin V fusion protein on early apoptotic cells

The SNAP-Annexin V fusion protein fluorescently labeled by the SNAP-DAC is prepared into mother liquor of 2 mu M for standby.

Hela cells (proliferating epidermal carcinoma cells) were plated on a culture dish containing 1mL of DMED high-sugar medium containing 10% fetal bovine serum, cultured at 37 ℃ and 5% carbon dioxide to a cell density of about 40%, replaced with fresh culture medium containing 50. mu.g/mL of an apoptosis inducer NCTD, and cultured for another 12 hours. Then washed 2 times with PBS and added with 2mM CaCl₂And 0.1 mu M SNAP-DAC fluorescence labeled SNAP-Annexin V fusion protein, and detecting under 488nm excitation to obtain the graph 5.

The graph of the fluorescence imaging of the SNAP-Annexin V fusion protein on early apoptotic cells is shown in FIG. 5: 5-a is Hela cell imaging of bright field, 5-b is fluorescence imaging under 488nm excitation, the outer membrane of the cell shows obvious fluorescence image, which proves the effect of SNAP-Annexin V fusion protein labeled by SNAP-DAC fluorescence on apoptosis early cell membrane.

Example 3

Fluorescence imaging experiment of SNAP-Cell505-Star fluorescence labeled SNAP-Annexin V fusion protein prepared in example 5 on early apoptotic cells

Hela cells (proliferating epidermal carcinoma cells) were plated on a culture dish containing 1mL of DMED high-sugar medium containing 10% fetal bovine serum, cultured at 37 ℃ and 5% carbon dioxide to a cell density of about 50%, and the culture medium containing 50. mu.g/mL of the apoptosis inducer NCTD was replaced with fresh one and the culture was continued for 12 hours. Then washed 2 times with PBS and added with 2mM CaCl₂And 0.1. mu.M of SNAP-Cell505-Star fluorescently labeled SNAP-Annexin V fusion protein,fluorescence imaging was performed at 488nm excitation. HeLa Cell imaging similar to FIG. 5 was obtained, demonstrating the effect of SNAP-Cell505-Star fluorescently labeled SNAP-Annexin V fusion protein on early apoptotic cells.

Example 4

Fluorescence imaging experiment of SNAP-Annexin V fusion protein fluorescently labeled by SNAP-Cell TMR Star and SNAP-Surface549 on early apoptotic cells prepared in example 5

Hela cells (proliferating epidermal carcinoma cells) were plated in 2 dishes containing 1mL of DMED high-sugar medium containing 10% fetal bovine serum, cultured at 37 ℃ and 5% carbon dioxide to a cell density of about 40%, and the culture medium containing 100. mu.g/mL of the apoptosis inducer NCTD was replaced with fresh one and cultured for another 6 hours. Washing with PBS for 2 times, adding 2mM CaCl₂And 0.1. mu.M of a fluorescence-labeled SNAP-Annexin V fusion protein (SNAP-Cell TMR Star and SNAP-Surface 549), and fluorescence imaging was performed at 549nm excitation. HeLa Cell imaging similar to FIG. 5 was obtained, demonstrating the effect of SNAP-Cell TMR Star and SNAP-Surface549 fluorescently labeled SNAP-Annexin V fusion protein on early apoptotic cells.

Example 5

Hela cells (proliferating epidermal carcinoma cells) were plated in 2 dishes containing 1mL of DMED high-sugar medium containing 10% fetal bovine serum, cultured at 37 ℃ and 5% carbon dioxide to a cell density of about 50%, and the culture medium containing 50. mu.g/mL of the apoptosis inducer NCTD was replaced with fresh one and the culture was continued for 12 hours. Then washing with PBS for 2 times, adding 2mM CaCl₂And 0.1. mu.M of SNAP-Surface Alexa

The SNAP-Annexin V fusion protein fluorescently labeled by 488 and SNAP-Surface488 is subjected to Hela cell imaging similar to the figure 5 in a fluorescence imaging picture under the excitation of 488nm, and the SNAP-Surface Alexa is proved

488 and SNAP-Surface488 fluorescence labeled SNAP-Annexin V fusion protein on apoptosis early-stage cells.

Example 6

Example 5 flow cytometry detection of early apoptotic cells by SNAP-DAC Fluorescently labeled SNAP-Annexin V fusion protein

Hela cells (proliferating epidermal carcinoma cells) were plated in 6-well plates, each containing 1mL of DMED high-sugar medium containing 10% fetal bovine serum, and cultured at 37 ℃ and 5% carbon dioxide to a cell density of about 40%, wherein wells 1-3 were replaced with fresh culture medium containing 2. mu.L of DMSO, and wells 4-6 were replaced with fresh culture medium containing 50. mu.g/mL of apoptosis inducer NCTD, and the culture was continued for 12 hours. Each well was then washed 2 times with PBS and then separately digested with trypsin, centrifuged at 900rpm for 5min, washed 2 times with PBS and then combined buffer (10mM HEPES, pH 7.4, 150mM NaCl, 2.5mM CaCl)₂) Resuspend cells to a cell count of 1 × 10⁵cells/mL of 1mL solution No. 1-8, No. 1-4 for non-medicated cells, and No. 5-7 for medicated cells. Adding 5 mu L of SNAP-Annexin V fusion protein mother liquor fluorescently labeled with SNAP-DAC to No. 2; no. 3, 5. mu.L of PI dye is added; no. 4, adding 5 mu L of SNAP-DAC fluorescence labeled SNAP-Annexin V fusion protein mother liquor and 5 mu L of PI dye for double dyeing; 5 mu L of SNAP-ANnexin V fusion protein mother liquor which is fluorescently labeled by SNAP-DAC is added; no. 6, 5. mu.L of PI dye was added; no. 7, 5. mu.L of SNAP-DAC fluorescence labeled SNAP-Annexin V fusion protein mother liquor and 5. mu.L of PI dye are added for double staining. Incubation in the dark at room temperature for 15min, washing the cells 2 times with PBS, final resuspension with binding buffer, and flow cytometry detection at 488nm excitation gave FIG. 6.

The cell number of early apoptotic cells detected by SNAP-DAC fluorescence labeled SNAP-Annexin V fusion protein is shown in fig. 6: in FIG. 6, a is a double staining pattern of non-dosed Hela cells plus SNAP-DAC-SNAP-Annexin V and PI, and 97.6% of the cells are in the lower left quadrant, demonstrating that the probe has weak effect on non-apoptotic cells. FIG. 6-b is a double staining pattern of the drug-induced apoptotic Hela cells plus SNAP-DAC-SNAP-Annexin V and PI, with 33.1% early apoptotic cells and 0.5% late apoptotic cells. The result proves that the SNAP-Annexin V fusion protein labeled by the SNAP-DAC fluorescence has an effect on early apoptosis cells and can be used for detecting the apoptosis of the cells by a flow cytometer.

Claims

1. A method for detecting Annexin V fluorescent marker of early apoptosis of cells is characterized in that the specific marking method is as follows:

(1) constructing pET-22b-SNAP-Annexin V gene fusion plasmid vector;

(2) pET-22b-SNAP-Annexin V fusion protein is expressed and purified through pronucleus;

(3) the fusion protein is labeled with a fluorescent small molecule and purified.

2. The method for detecting Annexin V fluorescent marker for early apoptosis according to claim 1, which is characterized in that a pET-22b-SNAP-Annexin V fusion gene plasmid vector is constructed as follows:

the upstream primer 5 'TACTAGCTAGCATGGCACAGG TTCTCAGAGG 3';

the downstream primer 5 'ACTAGCTAGCGTCATCTTCT CCACAGAGCA G3';

(2) PCR amplification of Annexin V target gene

30-50 mu L of PCR reaction system, 3-5 mu L of PCR buffer (10 ×), 3-5 mu L of dNTP (10 ×), 0.5-2 mu L of pCMV-Annexin V, 0.5-1 mu L of each upstream primer and downstream primer (20nM), 0.3-0.5 mu L of pfu DNA polymerase and sterile double distilled water till the total volume is 30-50 mu L;

the PCR reaction conditions were as follows: 30sec at 95 ℃; [95 ℃ for 30 sec; 1min at 55-58 ℃; 1-5min at 68-72 ℃; 16-25 cycles; 3min at 68-72 ℃; keeping the temperature at 4 ℃;

after PCR is finished, a target fragment is purified by using a PCR purification kit, then NheI is used for enzyme digestion to expose enzyme digestion sites, 0.8% agarose nucleic acid electrophoresis is performed, and gel cutting and recovery are performed to obtain an Annexin V target gene fragment;

(3) plasmid vector for cutting pET-22b-SNAPf

30-50 mu L of enzyme digestion system, namely 3-5 mu L of Buffer M (10 ×), 5-15 mu L of pET-22b-SNAPf plasmid, 1.5-3 mu L of Nhe I, supplementing sterile double distilled water to the total volume of 30-50 mu L, carrying out enzyme digestion at 37 ℃ overnight, then carrying out 0.8% agarose nucleic acid electrophoresis, cutting gel and recovering large fragments;

(4) connecting Annexin V and pET-22b-SNAPf fragments to obtain a fusion plasmid vector

10-20 mu L of a connection system, wherein the molar ratio of Annexin V recovered by the gel cutting to pET-22b-SNAPf is 6-10:1, 1-2 mu L of connection buffer (10 ×), 0.5-1 mu L of T4 ligase, sterile double distilled water is supplemented to the total volume of 10-20 mu L, 5-10 mu L of connection products are taken to be transferred to E.coli DH5 competence after 4-8 hours of connection at 4 ℃, and the connection result is determined by single-spot sequencing to obtain the pET-22b-SNAP-Annexin V fusion plasmid vector.

3. The method for detecting Annexin V fluorescent marker for early apoptosis according to claim 1, wherein the pET-22b-SNAP-Annexin V fusion protein is expressed and purified in a prokaryotic mode according to the following steps:

transferring the constructed plasmid into E.coli BL21 competent cells, paving a flat plate, culturing overnight at 37 ℃, selecting a single spot to be cultured in 10-30mL of LB culture medium containing 50-100 mug/mL Amp at 37 ℃ for overnight;

the next day, the bacterial solution was transferred to 30-2000mL LB medium containing 50-100. mu.g/mL Amp until OD₆₀₀About 0.1, shake culture at 37 ℃, and real-time monitoring of OD₆₀₀Change when OD is₆₀₀When the concentration reaches 0.6-0.8, adding an inducer IPTG to the final concentration of 0.5-1mM, culturing at 28-37 ℃ for 3-5h, collecting the thalli, centrifuging at 8000-12000rpm for 5-10 min, and removing the supernatant;

the bacteria were resuspended in Tris-HCl buffer at pH 8.0 and washed twice by centrifugation; the collected cells were resuspended in 10-30mL of 20mM PBS buffer at pH 7.4, and PMSF, a protease inhibitor, was added to a final concentration of 0.1 mM;

carrying out ultrasonic disruption on the bacterial liquid in ice bath (400W for 10min), then centrifuging for 10-30min by using a high-speed centrifuge at 12000-14000rpm, and collecting supernatant; then purifying by Ni NTA affinity column, eluting with 100-500mM imidazolium salt, and further purifying by Sephadex column G-75 to obtain pure target protein.

4. The method of Annexin V fluorescent labeling for detecting early apoptosis according to claim 1, which is characterized in that the fusion protein is labeled by a fluorescent small molecule and purified as follows: and mixing the fluorescent micromolecules and the fusion protein in a PBS solution according to a molar ratio of 2-10:1, standing for 0.5-2h at room temperature, and removing the redundant fluorescent micromolecules through a sephadex column G-25, wherein the fluorescent micromolecules are any fluorophore connected with BG groups.

5. The method of Annexin V fluorescent labeling for detection of early apoptosis according to claim 1 or 4, wherein the fluorescent small molecule is SNAP-tag dye, and specifically comprises: the commercial dyes SNAP-Cell505-Star, SNAP-Cell TMR Star, SNAP-Surface Alexa

6. the method of claim 1 for detecting Annexin V fluorescent marker of early apoptosis, which is characterized in that the Annexin V after fluorescent marker is used for detecting early apoptosis, and the method is used for detecting early apoptosis of any cell.