CN111187857A

CN111187857A - Primer pair, kit and preparation method and application of kit for detecting novel coronavirus through isothermal amplification

Info

Publication number: CN111187857A
Application number: CN202010093050.4A
Authority: CN
Inventors: 李娇; 陈亚球; 田平; 周宇航
Original assignee: Singuway Biotech Inc
Current assignee: Singuway Biotech Inc
Priority date: 2020-02-14
Filing date: 2020-02-14
Publication date: 2020-05-22

Abstract

The invention discloses a primer pair, a kit and a preparation method and application of the kit for detecting a novel coronavirus through isothermal amplification, wherein the kit comprises amplification reaction liquid, enzyme freeze-dried powder and a chip, the amplification reaction liquid comprises primers, the primers are shown as SEQ ID NO.1-8, digoxin or a fluorescent group is marked at the 5' end in a nucleotide sequence shown as SEQ ID NO.2/SEQ ID NO.4/SEQ ID NO.6/SEQ ID NO.8, and an antibody corresponding to the primers is contained on a test strip and is respectively used as respective detection marks. By using the kit, three different sections can be detected at one time, so that repeated detection is avoided; the constant temperature condition can be carried out, so that the instrument detection can be carried out in a laboratory, the suspected object can be subjected to self-detection, and the detection efficiency is improved; the detection time is short; one person can check the test at any time; the extraction efficiency can be effectively monitored by containing the internal standard.

Description

Primer pair, kit and preparation method and application of kit for detecting novel coronavirus through isothermal amplification

Technical Field

The invention relates to the technical field of biology, in particular to a primer pair, a kit and a preparation method and application of the kit for detecting a novel coronavirus through isothermal amplification.

Background

The novel coronavirus is transmitted by respiratory droplets and also can be transmitted by close contact; the population is generally susceptible, the elderly and the patients with basic diseases are easy to develop severe infection, and the children patients are occasionally attacked. However, because the initial symptoms of the novel coronavirus are not obvious, the incubation period is as long as 14 days and other relatively hidden factors, and patients and carriers of the novel coronavirus cannot be found in time, a diagnostic reagent capable of rapidly detecting related cases is developed, so that the novel coronavirus can be timely, rapidly, accurately and effectively detected, and the method is a practical need for epidemic prevention.

Due to the characteristics of the virus, in the novel coronavirus prevention and control, detection is the most basic means for controlling epidemic situation, and suspected symptom persons and closely contacted persons are identified in time, so that the emotion of a patient can be effectively stabilized, and further spread of the epidemic situation is controlled. The most desirable test protocol is to enable follow-up tests, one test on the one hand, to identify infected patients within the first 2-3 hours, to prevent cross-infection and a wider spread of patients with less obvious symptoms.

Because the novel coronavirus is novel, the related research on the antigen and the antibody of the novel coronavirus is still incomplete at present, and the current nucleic acid diagnosis technology is an important detection means for the epidemic situation of the sudden infectious disease, the nucleic acid detection becomes a main means for detecting the pathogen of the novel coronavirus, the current main detection means for dealing with the infection of the novel coronavirus is the nucleic acid detection, and the specific nucleic acid detected twice or the specific nucleic acid detected in two sections is taken as a diagnosis standard according to the national Weijian Commission's technical guide for detecting pneumonia caused by the novel coronavirus and the ' guide for preventing and treating pneumonia caused by the novel coronavirus ' (fourth edition).

The nucleic acid diagnosis technology adopted by all 5 emergency diagnosis products approved by the national drug administration is as follows: 4 of the detection kits adopt a fluorescent PCR technology, and the sequencing detection kit of the Huada gene adopts a gene sequencing technology. The novel coronavirus detection method and the novel coronavirus detection technology are adopted, and the detection method and the novel coronavirus detection technology are not only carried out in a higher-grade laboratory, but also require a higher-grade clinical gene amplification laboratory and personnel protection requirements and are limited by personnel, fields, protection and the like; the number of samples detected in a single laboratory every day is severely limited, and large-scale population screening cannot be completed quickly; in addition, the use time and resource cost of amplification/sequencing instruments and the like limit, one-case detection cannot be realized, detection is carried out at any time, the time cost for confirming diagnosis of a patient is increased, and the control of epidemic situations is not facilitated.

Therefore, the development of a diagnostic reagent capable of rapidly detecting related cases so as to timely, rapidly, accurately and effectively detect the novel coronavirus is a real need for epidemic prevention.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a primer pair, a kit and a preparation method and application of the kit for detecting novel coronavirus through isothermal amplification. The kit is suitable for POCT (point of care testing), a small amount of sporadic cases and disease control testing, has the characteristics of simplicity and rapidness when being used for testing, and is suitable for field testing and follow-up testing.

The technical scheme of the invention is as follows: providing a primer pair for detecting a novel coronavirus through isothermal amplification, wherein the novel coronavirus is 2019-nCoV, the primer pair is shown as SEQ ID NO.1-8, and digoxin or a fluorescent group is marked at the 5' end in a nucleotide sequence shown as SEQ ID NO.2/SEQ ID NO.4/SEQ ID NO.6/SEQ ID NO. 8.

Furthermore, biotin is marked at the 5 'end in the nucleotide sequence shown in SEQ ID NO.1/SEQ ID NO.3/SEQ ID NO.5/SEQ ID NO.7, and FAM, TAMRA, Dig and AMCA are marked at the 5' end in the nucleotide sequence shown in SEQ ID NO.2/SEQ ID NO.4/SEQ ID NO.6/SEQ ID NO.8 in sequence.

The present invention also provides a kit for detecting a novel coronavirus, the kit comprising: the kit comprises an amplification reaction solution, enzyme freeze-dried powder and a chip, wherein the amplification reaction solution contains the primer, the chip comprises a test strip for detecting the novel coronavirus, the test strip contains a plurality of antibodies, and the antibodies are respectively used as corresponding detection marks of the primer.

Further, the antibody contained on the test strip is one or more of anti-FITC, anti-AMCA, anti-rhodamine and anti-digoxin antibody.

The amplification reaction solution further comprises a reaction system, reverse transcriptase and/or endonuclease; the amplification reaction solution and the enzyme freeze-dried powder are respectively contained and are uniformly mixed before use.

The reaction system is an RPA reaction system of TwistDx company, or the formula of the reaction system is as follows: TrisAc buffer at a final concentration of 40mM, KOAc at a final concentration of 140mM, mannose at a final concentration of 7%, trehalose at a final concentration of 6%, dNTPs at a final concentration of 100mM, ATP at a final concentration of 200. mu.M, creatine kinase at a final concentration of 20 ng/. mu.L, creatine phosphate disodium salt at a final concentration of 100 ng/. mu.L, DTT at a final concentration of 20. mu.M, and BSA at a final concentration of 10. mu.g/ml.

The reverse transcriptase is AMV reverse transcriptase or MMLV.

The endonuclease is Hind III and/or Escherichia coli endonuclease III.

The enzyme freeze-dried powder is RPA enzyme freeze-dried powder of TwistDx company, or mixed enzyme with the following concentration is used for freeze-drying: t4UVSX protein with the final concentration of 120 ng/. mu.L, T4UvSY protein with the final concentration of 30 ng/. mu.L, T4gp32 protein with the final concentration of 40 ng/. mu.L, BSU or klenow fragment with the final concentration of 0.1U/. mu.L, and sucrose is used as the freeze-drying framework.

Further, the kit also comprises a negative control and a positive control, wherein the positive control is pseudovirus containing amplified fragments prepared by a armored RNA method, and the negative control is inactivated human cell culture solution or a sequence containing internal standard fragments.

The invention also provides a preparation method of the kit for detecting the novel coronavirus, wherein the kit is the kit, and the preparation method comprises the preparation of an amplification reaction solution and the preparation of a chip.

The preparation of the chip comprises the following steps: the preparation method comprises the steps of preparation of a liquid storage tank, preparation of a test strip, chip assembly, chip detection and chip packaging, wherein the preparation sequence of the liquid storage tank and the preparation sequence of the test strip can be adjusted.

Further, the amplification reaction solution was prepared in a ratio of 0.8. mu.L/5 parts of all primers, 29.5. mu.L/5 parts of the reaction system, and 0.5. mu.L/5 parts of reverse transcriptase and/or endonuclease.

The preparation process of the liquid storage tank comprises the following steps:

1) preparing diluent, adding the prepared diluent into a chip liquid storage tank, and sealing a buffer liquid area;

2) preparing a magnesium acetate solution, adding the prepared magnesium acetate solution into the sample adding area of the liquid storage tank, and naturally drying.

The preparation process of the test strip comprises the following steps:

1) preparing a sample application solution, and carrying out sample application, fixation and sealing on a solid phase carrier of the test strip;

2) activating the latex microspheres and marking a coupling body, immersing the glass fiber membrane into the activated latex microspheres, and drying to obtain a bonding pad;

3) preparing a sample pad, namely preparing a sample pad treatment solution, immersing the other glass fiber film into the sample pad treatment solution, and drying to obtain a sample pad;

4) assembling the test strip, tearing off the adhesive film at the front part of the backlight plate, adhering a combination pad, leading the front section of the combination pad to extend out of the solid phase carrier and contact with the sample pad, tearing off the adhesive film at the rear part of the backlight plate, and adhering absorbent paper;

5) and cutting the test strip.

Wherein, the sequence of the steps 1) to 3) in the preparation process of the test strip can be adjusted.

Further, the diluent in the preparation process of the liquid storage tank comprises NaCl with the final concentration of 0.9%, Tween-20 with the final concentration of 0.1%, trisodium citrate with the final concentration of 20mM and water, and the pH of the diluent is adjusted to be between 12 and 13 by using solid NaOH after the diluent is prepared.

The magnesium acetate solution is prepared from molecular biological-grade magnesium acetate and Tris.

The spotting solution is prepared by diluting each antibody to a concentration of 1 to 50. mu.g/mL with a spotting diluent.

The solid phase carrier is any one of NC membrane, glass sheet and PVDF membrane, and the spotting on the solid phase carrier specifically comprises the following steps: tearing off the film attached to the middle part of the backlight plate, attaching a solid phase carrier, sequentially dispensing the prepared sample solution on the solid phase carrier according to a 2X 2 array by using a sample dispenser, and drying the dispensed solid phase carrier for 30min at 37 ℃.

The activation of the latex microspheres and the marking of the couplet comprise the following steps:

A. uniformly mixing the latex microspheres with a MES buffer solution with the final concentration of 50 mM;

B. adding EDAC with the final concentration of 50mg/ml and NHS with the final concentration of 50mg/ml into the mixed solution of A in sequence, and reacting at room temperature;

C. centrifuging the mixed solution obtained in the step B and removing supernatant;

D. adding MES buffer solution with the final concentration of 50mM into the substance obtained after centrifugation, re-dissolving, centrifuging and removing supernatant;

E. adding MES buffer solution with the final concentration of 50mM into the substance obtained after D centrifugation for redissolving;

F. adding SA into the solution obtained in the step E, incubating at room temperature, centrifuging and removing supernatant;

G. performing dissolving precipitation and centrifugation on the substance obtained after the centrifugation of F for a plurality of times by using PBS, and removing supernatant;

H. adding BSA with the final concentration of 5mg/ml into the centrifuged substance G for blocking, centrifuging and removing the supernatant;

I. the material from H was reconstituted in MES buffer at a final concentration of 50 mM.

The preparation method of the sample pad treatment solution is the same as the preparation method of the amplification reaction solution.

The invention also provides an application of the kit for detecting the novel coronavirus, which is used for detecting the novel coronavirus and comprises the following specific steps:

1) preparing a reaction system in a specific area, and mixing the amplification reaction liquid and the enzyme freeze-dried powder according to a proportion to form the reaction system;

2) extracting nucleic acid in a specific region;

3) transferring the extracted nucleic acid and magnesium acetate solution into a subpackaged reaction system respectively, mixing uniformly, transferring into a chip sample adding hole after instantaneous centrifugation, and covering a sealing strip;

4) amplifying the mixed system obtained in the step 3) for 10-25min at the constant temperature of 30-41 ℃ in a specific area;

5) adding a diluent into the amplification system obtained in the step 4) for dilution, separating nucleic acid double chains, and carrying out chromatography for 8-15 min for color development;

6) interpretation of reaction results: interpretation is performed by a nucleic acid detection device.

Further, the prepared reaction system is subpackaged in the step 1), frozen and stored at the temperature of minus 20 ℃, and used within 2 weeks; if the mixture is placed at 4 ℃, the storage time is not more than 48 hours; if the product is required to be placed for a long time, glycerol-glycine solution is required to be added, and the product can be stored for more than 3 months at the temperature of minus 20 ℃;

in the step 4), the mixed reaction system is placed at the constant temperature of 40 ℃ for 20min for amplification reaction;

the melting mode in the step 5) comprises high-temperature melting or enzymatic melting or alkaline melting, and the chromatographic mode comprises microfluidic or lateral chromatography or diafiltration, and the chromatographic time is 10 min.

By adopting the scheme, the invention has the beneficial effects that;

1. the kit disclosed by the invention can be used for detecting three different sections of a novel coronavirus (2019-nCOV) at one time, meets the relevant requirements of 'pneumonia diagnosis and treatment guidelines for novel coronavirus infection' of the national Weijian Commission, can be used for detecting a plurality of coronavirus loci at one time, and solves the problem that a plurality of detections are needed;

2. the detection condition can be carried out only under the constant temperature condition, the detection result can be realized through color development, the detection can be carried out by a totally-enclosed instrument matched with a closed instrument in a laboratory, the self-detection of a suspected object can be carried out, and the detection efficiency is improved;

3. the detection time is short, and the rapid diagnosis of the patient is facilitated;

4. one person is owned for one inspection, and the inspection is carried out at any time;

5. preventing the generation of primer dimers by applying nucleic acid unzipping technology;

6. the internal standard is contained, so that the extraction efficiency can be effectively monitored;

7. the rapid nucleic acid extraction reagent is used in combination, so that the nucleic acid detection time can be shortened to 30-40 min.

Drawings

FIG. 1 is a schematic diagram of a chip according to the present invention;

FIG. 2 is a flow chart of the preparation of the kit of the present invention;

FIG. 3 is a flow chart of the present invention for detecting a novel coronavirus using the kit.

Detailed Description

The invention is described in detail below with reference to the figures and the specific embodiments. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruker et al, Huang Petang et al) or according to the product instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

The invention provides a primer pair for detecting a novel coronavirus through constant-temperature amplification, wherein the novel coronavirus is specifically 2019-nCoV, a part of sections of an open reading frame 1a/b (ORF1a/b), envelope protein (envelope protein) and nucleocapsid protein (nucleocapside, N) in the 2019-nCoV are directly amplified at one time, and then a human RNase P gene 12 subunit is selected as an internal standard of reaction to design a primer, and the primer is shown as SEQ ID NO.1-8 in a table 1. Further, biotin is labeled at the 5 ' end in the nucleotide sequence of the upstream primer in the primers, and digoxin or a fluorophore is labeled at the 5 ' end in the nucleotide sequence of each downstream primer in the primers, specifically, in the present embodiment, FAM, TAMRA, Dig (digoxin), and AMCA are labeled at the 5 ' end in the nucleotide sequences shown in SEQ ID No.2/SEQ ID No.4/SEQ ID No.6/SEQ ID No.8 in sequence.

Table 1, primer sequence table:

name (R)	Sequence of	Numbering
			ORF1 F：	Bio-AGGTCGAAACGTAYGTTCTCTCTATC	SEQ1
ORF1 R：	FAM-ACTAAGGGAATTTTRGGRTTTGTGTTC	SEQ2
			2019N F：	Bio-aactaatcagacaaggaactgattacaaac	SEQ3
2019N R：	TAMRA-aatatgcttattcagcaaaatgacttgat	SEQ4
			2019E F：	Bio-atagttaatagcgtacttctttttcttgct	SEQ5
2019E R：	Dig-aggaactctagaagaattcagatttttaac	SEQ6
			IC F：	Bio-ttcaaacttatattgaagaagtgactttagtt	SEQ7
IC R：	AMCA-taactaaaagtaaggaatcctatttcaaagac	SEQ8

Referring to fig. 1, the present invention also provides a kit for detecting a novel coronavirus, the kit comprising: the kit comprises amplification reaction liquid, enzyme freeze-dried powder and a chip, wherein the amplification reaction liquid contains the primers, and the chip is provided with corresponding antibodies aiming at haptens marked by the primers on main chromogenic sites of the chip, and the antibodies are respectively used as corresponding detection markers of the primers, such as anti-FITC, anti-AMCA, anti-rhodamine, anti-digoxin antibodies or any other common hapten-antibody combination.

Specifically, in this embodiment, the amplification reaction solution further includes a reaction system, a reverse transcriptase and/or an endonuclease, the amplification reaction solution and the enzyme lyophilized powder are separately contained, and the amplification reaction solution and the enzyme lyophilized powder are uniformly mixed according to a certain ratio before use. The reaction system is an RPA reaction system of TwistDx company, or the formula of the reaction system is as follows: TrisAc buffer at a final concentration of 40mM, KOAc at a final concentration of 140mM, mannose at a final concentration of 7%, trehalose at a final concentration of 6%, dNTPs at a final concentration of 100mM, ATP at a final concentration of 200. mu.M, creatine kinase at a final concentration of 20 ng/. mu.L, creatine phosphate disodium salt at a final concentration of 100 ng/. mu.L, DTT at a final concentration of 20. mu.M, and BSA at a final concentration of 10. mu.g/ml. The reverse transcriptase is AMV reverse transcriptase or MMLV produced by NEB company. The endonuclease is at least one of Hind III and Escherichia coli endonuclease III. The enzyme freeze-dried powder is RPA enzyme freeze-dried powder of TwistDx company, or mixed enzyme with the following concentration is used for freeze-drying: t4UVSX protein with the final concentration of 120 ng/. mu.L, T4UvSY protein with the final concentration of 30 ng/. mu.L, T4gp32 protein with the final concentration of 40 ng/. mu.L, BSU or klenow fragment with the final concentration of 0.1U/. mu.L, and sucrose is used as the freeze-drying framework.

Specifically, in this embodiment, the chip includes a housing, a test strip fixed inside the housing for detecting the novel coronavirus, a diluent, and magnesium acetate, where the diluent is added into a reservoir of the chip and sealed with a tinfoil paper, and the magnesium acetate is added into a sample addition area of the reservoir and air-dried. Specifically, the test strip comprises a backlight plate, a sample pad, a solid phase carrier, a combination pad and absorbent paper. The solid phase carrier carries corresponding antibodies which are respectively used as respective detection markers of the primers, and specifically, in this embodiment, the antibodies contained on the test strip are one or more of anti-FITC, anti-AMCA, anti-rhodamine, and anti-digiflavine antibodies. The solid phase carrier includes but is not limited to any one of NC membrane, glass sheet and PVDF membrane, preferably NC membrane, the antibody is diluted by spotting diluent to prepare spotting solution, and then the spotting solution is crosslinked into the NC membrane. As shown in fig. 1, the test strip is marked with an internal standard site, an ORF1a/b site, an E gene site and an N gene site, and the result is determined as follows: to confirm positive cases in the laboratory, one of the following conditions needs to be satisfied: 1. at least two of the detection results of the 3 sites (ORF1a/b, E and N) in the same sample are positive; 2. the ORF1a/b site was positive in two different specimens from the same patient.

Specifically, in this embodiment, the kit further comprises a negative and positive control, wherein the positive control is a pseudovirus prepared by the armored RNA method and containing the amplified fragment of the primer, and the negative control is inactivated human cell culture solution or any other sequence containing an internal standard fragment.

Referring to fig. 2, the present invention further provides a method for preparing the kit, which specifically includes preparation of amplification reaction solution and preparation of chip.

Wherein, the preparation of the chip comprises the following steps: the preparation method comprises the steps of preparation of a liquid storage tank, preparation of a test strip, chip assembly, chip detection and chip packaging, wherein the preparation sequence of the liquid storage tank and the test strip can be adjusted.

Firstly, preparing an amplification reaction solution:

firstly, taking primer probes in a hundred thousand clean area according to primer probe dilution regulation and diluting the primer probes to 10 nM.

And preparing an amplification reaction solution according to the proportion of 0.8 mu L/5 parts of all primers, 29.5 mu L/5 parts of a reaction system and 0.5 mu L/5 parts of reverse transcriptase and/or endonuclease in a hundred thousand grade clean area according to primer probe dilution specification.

Secondly, preparing the chip:

1 preparation of reservoir

1) A diluent is prepared, wherein the formula of the diluent comprises NaCl with the final concentration of 0.9%, Tween-20 with the final concentration of 0.1%, trisodium citrate with the final concentration of 20mM and water, and the pH of the diluent is adjusted to be between 12 and 13 by using solid NaOH after the diluent is prepared, specifically, the pH is 12.5 in the embodiment.

2) Add 105. mu.L of the above dilution to the reservoir and then seal the buffer area with tinfoil, the heat seal film machine parameters were as follows: the temperature is 150 ℃ and the time is 2 min.

3) Preparing a magnesium acetate solution: preparing a magnesium acetate solution by using molecular biological grade magnesium acetate and Tris, adding the prepared magnesium acetate solution into a sample adding area of a liquid storage tank, and naturally drying.

2 preparation of test paper strip

1) Preparing sample application buffer solution, carrying out sample application, fixing and sealing on a solid phase carrier of a test strip

Each of the above antibodies was diluted to a concentration of 1-50. mu.g/mL using a spotting diluent, which is a common diluent in the art.

And (3) pasting the NC film at the middle position of the backlight plate, and sequentially spotting the sample solution on the film strip by using a spotting instrument. The pointing parameters are as follows: the spotting diameter is 0.1mm, the space between the spotting machines is 18mm, and the spotting amount is 0.1. mu.L. Spotting arrays the following: the spotting liquid is sequentially spotted on an NC membrane according to a 2X 2 array, and the left and right spacing and the up and down spacing of different spots are 0.4mm and 0.8mm respectively.

The prepared test paper should be dried at 37 ℃ for 30 min.

Adding the sealing liquid into the sample application region of the NC membrane strip, and sealing for 10 min; excess blocking solution was washed with PBS.

2) Activation of latex microspheres and labeling of couplets

A. Mixing 2.5mL of latex microspheres with 5mL of MES buffer (final concentration 50mM, pH6.1) uniformly;

B. adding 5ml of EDAC with the final concentration of 50mg/ml and 5ml of NHS with the final concentration of 50mg/ml into the mixed solution of A in sequence, and reacting for 20min at room temperature;

C. centrifuging the mixed solution obtained in the step B at 12000rpm for 2min to remove supernatant;

D. adding 5mL MES buffer solution with final concentration of 50mM into the substance obtained after centrifugation at C for redissolving, and centrifuging at 12000rpm for 2min to remove supernatant;

E. adding 5mL of MES buffer solution with the final concentration of 50mM into the substance obtained after the D centrifugation for redissolving;

F. adding 5 μ g of SA into the solution obtained in E, incubating at room temperature for 3 hours, and centrifuging at 12000rpm for 5min to remove supernatant;

G. performing two times of dissolving and precipitating on the substance obtained after the centrifugation of F by PBS, and centrifuging at 12000rpm for 5min to remove supernatant, wherein 10ml of PBS is used each time;

H. adding 10ml BSA with final concentration of 5mg/ml into the centrifuged material G, blocking for 3min, and centrifuging at 12000rpm for 5min to remove the supernatant;

I. the material from H was reconstituted in 10ml of MES buffer at a final concentration of 50 mM.

3) Preparation of the conjugate pad

Immersing glass fiber membrane of A4 paper size (20.9cm × 29.6cm) in 10mL of activated latex microspheres for 30min, and drying at 37 deg.C for more than 2 h.

4) Preparation of sample pad

A sample pad treatment solution was prepared according to the preparation method of the amplification reaction solution, and a glass fiber film of A4 paper size (20.9 cm. times.29.6 cm) was immersed in 10mL of the sample pad treatment solution for 30min, followed by drying at 37 ℃ for 2 hours or more, wherein the preparation method of the sample pad treatment solution was the same as the preparation method of the amplification reaction solution.

5) Test strip assembly

Tearing off the lower protective film of the backlight plate, and sticking a bonding pad with the thickness of 1cm, wherein 0.5cm penetrates into the NC film area; the rest area is stuck with a 2.0cm sample pad and covered with a combination pad; tearing the upper part of the backlight plate, sticking 1.0cm of absorbent paper, and penetrating into the NC film by 0.2 cm; the rest part is covered with absorbent paper with high water storage capacity (2.0 cm).

6) Slitting

According to the operating specification of the slitter, the design parameters are as follows, the slitting width is 4mm, and the chopping head is 12 mm. And finishing slitting.

3 chip assembly

1) Opening the clamp, adding the gasket, and then adding the clamp on the gasket;

2) placing the marked NC membrane into the clamp, wherein one end of the sample adding pad is inserted into the clamp flow channel;

3) sealing the sample adding port by using a sealing clamping strip;

4) and closing the clamp and sticking the two-dimensional code.

4 chip detection

Combining the sample diluent with other qualified standard components, and detecting an enterprise negative reference product on a suitable instrument, wherein the result accords with the definition of negative; and detecting the sensitivity reference product of the enterprise, and determining that the corresponding site is positive and the product is qualified.

5 packaging of chips

And (4) packaging the qualified chips into an aluminum foil bag containing a drying agent, and sealing and labeling the chips under a non-vacuum condition according to the operation rules of a packaging machine.

Referring to fig. 3, the present invention also provides an application of a kit for detecting a novel coronavirus, wherein the kit for detecting a novel coronavirus comprises the following steps:

1) preparing a reaction system in a reagent preparation area, adding 35 mu L of amplification reaction liquid into the enzyme freeze-dried powder, and subpackaging 7 mu L/tube into eight-connected tubes; subpackaging the prepared reaction system, freezing and storing at-20 ℃, and using within 2 weeks; if the mixture is placed at 4 ℃, the storage time is not more than 48 hours; if the product is stored for a long time, glycerol-glycine solution is added, and the product can be stored at-20 deg.C for more than 3 months.

2) Nucleic acid is extracted in the sample processing region, specifically, in this embodiment, nucleic acid extraction is performed by using a nucleic acid extraction reagent produced by shenzhen myzus microbial technology ltd, 1mL of physiological saline is added to the throat swab specimen, and the extraction dosage is 200 μ L after uniform mixing.

3) Transferring 2 μ L of the extracted nucleic acid and 1 μ L of magnesium acetate solution with final concentration of 140nM into a separately packaged reaction system, mixing, centrifuging instantly, transferring into a sample adding hole of a chip, and covering a sealing strip;

4) in the amplification reaction zone, the chip is transferred to an amplification instrument according to the 'on-chip' condition, the item 2019-nCOV is selected, the information of the patient is input or identified through the network, and the amplification is carried out for 10-25min at the constant temperature of 30-41 ℃, specifically, in the embodiment, the mixed reaction system is placed at the constant temperature of 40 ℃ for 20min of amplification reaction. After amplification, the amplicon with both biotin label and chromogenic label can be identified

5) Diluting the amplification system obtained in step 4) with diluent, separating nucleic acid double strand, and performing chromatography for 8-15 min, specifically, in this example, the time for chromatography is 10 min. A diluent having a nucleic acid melting ability is prepared, and the amplified nucleic acid is added to the diluent to dissociate the double strands of the nucleic acid, and the melting method that can be used includes high temperature melting, enzymatic melting and alkali melting, preferably alkali melting, wherein the pH of the diluent is 12-13, specifically, the pH of the diluent is 12.5 in this embodiment, and the purpose of melting is to specifically identify the amplicon simultaneously containing the double label, thereby preventing the influence of primer dimer or other multimer on the detection result.

The diluted solution is used as a reaction solution to react on a chromatographic protein chip, and the protein chip for chromatography should aim at antibodies of haptens of corresponding labeled primers at main chromogenic sites of the protein chip, such as anti-FITC, anti-AMCA, anti-rhodamine, anti-digoxigenin antibodies, or any other common hapten-antibody combination.

The desired immunochromatographic chip may comprise a conjugate pad containing colloidal gold or other dye labeled with SA and capable of binding to biotin at one end of the amplification product via SA.

For simplicity and safety of the operation process, the chromatography can be realized by any one of microfluidics, lateral chromatography and diafiltration.

6) Interpretation of reaction results: and (3) judging by a nucleic acid detection device, wherein the result is judged as follows: to confirm positive cases in the laboratory, one of the following conditions needs to be satisfied: 1. at least two of the detection results of the 3 sites (ORF1a/b, E and N) in the same sample are positive; 2. the ORF1a/b site was positive in two different specimens from the same patient.

In summary, the beneficial effects of the invention include;

The present invention is not limited to the above preferred embodiments, and any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Shenzhen Shuxinsi microbial science and technology Limited

<120> primer pair for isothermal amplification detection of novel coronavirus, kit, preparation method of kit and application

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>26

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Ala Gly Gly Thr Cys Gly Ala Ala Ala Cys Gly Thr Ala Tyr Gly Thr

1 5 10 15

Thr Cys Thr Cys Thr Cys Thr Ala Thr Cys

20 25

<210>2

<211>27

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Ala Cys Thr Ala Ala Gly Gly Gly Ala Ala Thr Thr Thr Thr Arg Gly

1 5 10 15

Gly Arg Thr Thr Thr Gly Thr Gly Thr Thr Cys

20 25

<210>3

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

aactaatcagacaaggaactgattacaaac 30

<210>4

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

aatatgcttattcagcaaaatgacttgat 29

<210>5

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atagttaatagcgtacttctttttcttgct 30

<210>6

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

aggaactctagaagaattcagatttttaac 30

<210>7

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttcaaacttatattgaagaagtgactttagtt 32

<210>8

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

taactaaaagtaaggaatcctatttcaaag ac 32

Claims

1. A primer pair for detecting a novel coronavirus through isothermal amplification is specifically 2019-nCoV, and is characterized in that the primer pair is shown as SEQ ID NO.1-8, and digoxin or a fluorescent group is marked at the 5' end in a nucleotide sequence shown as SEQ ID NO.2/SEQ ID NO.4/SEQ ID NO.6/SEQ ID NO. 8.

2. The primer pair according to claim 1, wherein biotin is labeled at the 5 'end of each of the nucleotide sequences shown in SEQ ID No.1/SEQ ID No.3/SEQ ID No.5/SEQ ID No.7, and FAM, TAMRA, Dig and AMCA are labeled at the 5' end of each of the nucleotide sequences shown in SEQ ID No.2/SEQ ID No.4/SEQ ID No.6/SEQ ID No.8 in this order.

3. A kit for detecting a novel coronavirus, said kit comprising: the kit comprises an amplification reaction solution, enzyme freeze-dried powder and a chip, wherein the amplification reaction solution comprises the primer of claim 1 or 2, the chip comprises a test strip for detecting novel coronavirus, the test strip comprises a plurality of antibodies, and the antibodies are respectively used as corresponding detection markers of the primer of claim 1 or 2.

4. The kit of claim 3, wherein the antibodies contained on the strip are one or more of anti-FITC, anti-AMCA, anti-rhodamine, anti-digoxigenin antibodies;

the amplification reaction solution further comprises a reaction system, reverse transcriptase and/or endonuclease; the amplification reaction solution and the enzyme freeze-dried powder are respectively contained and are uniformly mixed before use;

the reaction system is an RPA reaction system of TwistDx company, or the formula of the reaction system is as follows: TrisAc buffer at a final concentration of 40mM, KOAc at a final concentration of 140mM, mannose at a final concentration of 7%, trehalose at a final concentration of 6%, dNTPs at a final concentration of 100mM, ATP at a final concentration of 200. mu.M, creatine kinase at a final concentration of 20 ng/. mu.L, creatine phosphate disodium salt at a final concentration of 100 ng/. mu.L, DTT at a final concentration of 20. mu.M, and BSA at a final concentration of 10. mu.g/ml;

the reverse transcriptase is AMV reverse transcriptase or MMLV;

the endonuclease is HindIII and/or Escherichia coli endonuclease III;

the enzyme freeze-dried powder is RPA enzyme freeze-dried powder of TwistDx company, or mixed enzyme with the following concentration is used for freeze-drying: t4UVSX protein with the final concentration of 120 ng/. mu.L, T4UvSY protein with the final concentration of 30 ng/. mu.L, T4gp32 protein with the final concentration of 40 ng/. mu.L, BSU or klenow fragment with the final concentration of 0.1U/. mu.L, and sucrose is used as a freeze-drying framework.

5. The kit of claim 4, further comprising a negative control and a positive control, wherein the positive control is a pseudovirus containing amplified fragments prepared by the armored RNA method, and the negative control is an inactivated human cell culture or a sequence containing internal standard fragments.

6. A method for preparing a kit for detecting novel coronavirus, wherein the kit is the kit of any one of claims 3 to 5, and the preparation method comprises the steps of preparing an amplification reaction solution and preparing a chip;

7. The method for preparing a kit according to claim 6, wherein the amplification reaction solution is prepared in a ratio of 0.8. mu.L/5 persons for all primers, 29.5. mu.L/5 persons for the reaction system, and 0.5. mu.L/5 persons for the reverse transcriptase and/or endonuclease;

2) preparing a magnesium acetate solution, adding the prepared magnesium acetate solution into a sample adding area of a liquid storage tank, and naturally drying;

the preparation process of the test strip comprises the following steps:

5) cutting the test paper strip;

8. The method for preparing the kit according to claim 7, wherein the diluent in the preparation process of the reservoir comprises NaCl with a final concentration of 0.9%, Tween-20 with a final concentration of 0.1%, trisodium citrate with a final concentration of 20mM and water, and the pH of the diluent is adjusted to be between 12 and 13 by solid NaOH after the diluent is prepared;

the magnesium acetate solution is prepared by adopting molecular biology-level magnesium acetate and Tris;

the preparation of the spotting fluid is to dilute each antibody to the concentration of 1-50 mug/mL by using a spotting diluent;

the solid phase carrier is any one of NC membrane, glass sheet and PVDF membrane, and the spotting on the solid phase carrier specifically comprises the following steps: tearing off the film attached to the middle part of the backlight plate, attaching a solid phase carrier, sequentially dispensing the prepared sample solution on the solid phase carrier according to a 2X 2 array by using a sample dispenser, and drying the dispensed solid phase carrier for 30min at 37 ℃;

I. redissolving the material from H in MES buffer at a final concentration of 50 mM;

9. Use of a kit for the detection of a novel coronavirus according to any one of claims 3 to 5, comprising the following specific steps:

2) extracting nucleic acid in a specific region;

10. The use of the kit according to claim 9, wherein the prepared reaction system is dispensed in step 1), frozen at-20 ℃ and used within 2 weeks; if the mixture is placed at 4 ℃, the storage time is not more than 48 hours; if the product is required to be placed for a long time, glycerol-glycine solution is required to be added, and the product can be stored for more than 3 months at the temperature of minus 20 ℃;