CN111154767A - Root length regulatory gene LOGL5, corresponding construct and application thereof - Google Patents

Abstract

Isolated polynucleotides and polypeptides, and recombinant DNA constructs and CRISPR-Cas constructs for modulating plant root length, compositions (e.g., plants or seeds) containing these recombinant DNA constructs or modified LOGL5 genes or their regulatory elements, and methods of using these recombinant DNA constructs and CRISPR-Cas constructs. The recombinant DNA construct comprises a LOGL5 gene and a promoter functional in a plant operably linked thereto, the CRISPR-Cas construct targets the LOGL5 gene or a regulatory element thereof, wherein the LOGL5 gene encodes a root length modulating polypeptide.

Description

Root length regulatory gene LOGL5, corresponding construct and application thereof

Technical Field

The technical field relates to plant breeding and genetics, in particular to recombinant DNA constructs and gene editing constructs for modulating plant root length and methods of increasing abiotic stresses such as drought, nitrogen limitation stress or increasing yield.

Background

Biotic and abiotic causes can stress plants, for example, causes of biotic stress include pathogen infection, insect feeding, parasitism of one plant to another, such as mistletoe; abiotic stresses include, for example, excess or deficiency of available water, extreme temperatures, and synthetic chemicals such as herbicides.

Abiotic stress is a major cause of crop reduction worldwide, with major crops producing on average over 50% reduction (Boyer, J.S. (1982) Science 218: 443. sup. 448; Bray, E.A. et al (2000) In biochemistry and Molecular Biology of Plants, edited by Buchannan, B.B. et al, Amer. Soc. plant biol., pp.1158-1249). Plants are anchored to the ground and must be adapted to the surrounding environmental conditions, which leads to enormous plasticity in gene regulation, morphogenesis and metabolism during plant development. Plant adaptation and defense strategies involve the activation of genes encoding important proteins that can adapt or defend a plant against different stress conditions.

Plants are sessile organisms, the roots anchoring the plant in the soil and absorbing nutrients from the soil or growing medium for the plant to grow and to add nutrients, seeds, fruits, etc. The modification of root tissue helps to improve the ability of plants to grow under harsh environmental conditions (including drought, nutrient deprivation), stronger roots being better able to reach or absorb water or nutrients.

Summary of The Invention

The invention comprises the following specific embodiments:

in one embodiment, the invention includes an isolated polynucleotide comprising: (a) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:1 is at least 85%; (b) a polynucleotide whose nucleotide sequence is identical to SEQ id no:2 is at least 85%; (c) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (d) the full-length complement of nucleotide sequence (a), (b) or (c), wherein increasing the expression level of the polynucleotide shortens the root length of the plant. The isolated polynucleotide comprises SEQ ID NO:1 or 2. The polypeptide comprises SEQ ID NO: 3. Further, increasing the expression of the polynucleotide decreases yield under conditions of positive yield flooding, drought stress, and/or nitrogen limitation; decreasing expression of the polynucleotide increases yield under conditions of positive yield flooding, drought stress, and/or nitrogen limitation.

In another aspect, the present invention discloses the use of an isolated polynucleotide in a plant to modulate root phenotype and further improve yield, wherein the isolated polynucleotide comprises (a) a polynucleotide having a nucleotide sequence that is substantially identical to the nucleotide sequence set forth in seq id NO:1 is at least 85%; (b) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:2 is at least 85%; (c) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (d) the full-length complement of nucleotide sequence (a), (b) or (c), the isolated polynucleotide being used to lengthen roots by decreasing expression of the polynucleotide in a plant and to shorten roots by increasing expression of the polynucleotide in a plant.

In another embodiment, the invention discloses a recombinant DNA construct comprising an isolated polynucleotide and at least one heterologous regulatory element operably linked thereto, wherein said polynucleotide comprises (a) a polynucleotide having a nucleotide sequence that is identical to the nucleotide sequence set forth in SEQ ID NO:1 or 2 identity of at least 85%; (b) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (c) the full-length complement of the nucleotide sequence (a) or (b).

In another embodiment, the invention discloses a CRISPR/Cas construct comprising a sgRNA targeting a nucleotide sequence of the LOGL5 gene upstream and/or the LOGL5 gene, wherein the nucleotide sequence of the LOGL5 gene upstream comprises (a) a polynucleic acid whose nucleotide sequence is identical to the nucleotide sequence of SEQ ID NO: 8 is at least 85%; or (b) the full-length complement of the nucleotide sequence (a); the nucleotide sequence of the LOGL5 gene includes: (i) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:1 or 2 identity of at least 85%; (b) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (c) the full-length complement of the nucleotide sequence (a) or (b). The sgRNA includes SEQ ID NO: 14-35, preferably, the sgRNA comprises SEQ ID NO: 14-16.

In another aspect, the present invention discloses a modified plant, plant cell, or seed having altered expression of at least one polynucleotide encoding the polypeptide LOGL5, wherein the plant exhibits altered root length as compared to a control plant grown under the same conditions.

Increasing the expression of the gene LOGL5 shortened the root length of the plants compared to control plants, which did not increase the expression of LOGL 5. Further, the plant comprises a recombinant DNA construct comprising a LOGL5 polynucleotide operably linked to at least one heterologous regulatory element, wherein the LOGL5 polynucleotide comprises (a) a polynucleotide having a nucleotide sequence that is substantially identical to the nucleotide sequence set forth in SEQ ID NO:1 or 2 identity of at least 85%; (b) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (c) the full complement of the nucleotide sequence (a) or (b); increasing expression of the polynucleotide results in shorter roots as compared to a control plant not containing the recombinant DNA construct; or the plant comprises modified regulatory elements to increase the expression of an endogenous polynucleotide comprising (a) a polynucleotide having a nucleotide sequence that is identical to the nucleotide sequence set forth in SEQ ID NO:1 identity of at least 85%; (b) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:2 is at least 85%; (c) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (d) the full-length complement of the nucleotide sequence (a), (b) or (c); the plants show shorter roots and reduced yield compared to control plants.

Reducing expression of the gene of LOGL5 promotes root elongation and further increases yield in plants compared to control plants which do not have reduced expression of LOGL 5. Further, the plant comprises a suppression DNA construct comprising a suppression element and at least one heterologous regulatory element operably linked thereto, the suppression element comprising at least 100bp of the following contiguous sequences: (a) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:1 or 2 identity of at least 85%; (b) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (c) the full-length complement of the nucleotide sequence (a) or (b). Alternatively, the plant comprises a modification of the gene of LOGL5 or a regulatory element thereof, said modification being obtained by (a) introducing or deleting or replacing a DNA fragment, or (b) introducing one or more nucleotide changes into the genomic region comprising the endogenous LOGL5 gene and the regulatory element thereof, wherein the expression level or activity of the endogenous LOGL5 polypeptide is reduced compared to the expression and activity of a wild type LOGL5 polypeptide in a control plant.

In one embodiment, the plant comprises a mutant LOGL5 gene; expression or activity of a LOGL5 polypeptide is reduced in the plant as compared to a control plant, which plant exhibits longer roots.

In another embodiment, the plant comprises a mutant LOGL5 gene; the activity of the LOGL5 polypeptide is reduced or abolished in said plant compared to a control plant, which plant exhibits longer roots.

In another embodiment, the plant comprises a mutant LOGL5 regulatory element; expression of the LOGL5 polypeptide is reduced in the plant as compared to a control plant, which plant exhibits longer roots.

In another aspect, the invention includes any of the disclosed plants selected from rice, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, sugarcane or switchgrass.

In another aspect, the invention provides a rice plant comprising a modified genomic locus wherein expression of an endogenous polynucleotide in the plant is increased or decreased such that roots become longer when expression of the endogenous polynucleotide is decreased and roots become shorter when expression of the endogenous polynucleotide is increased, wherein the amino acid sequence of the polypeptide encoded by the endogenous polynucleotide is identical to the amino acid sequence of SEQ ID NO:3 compared to 3, having at least 90% sequence identity. The modified genomic site comprises a mutation in a regulatory region that reduces expression of the endogenous polynucleotide; the modified genomic site comprises a mutation in a gene that reduces the expression or activity of the endogenous polynucleotide.

In another aspect, the present invention provides a method of modulating root length in a plant comprising altering expression in a rice plant of a polynucleotide encoding a LOGL5 polypeptide, wherein said polynucleotide comprises: (a) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:1 or 2 identity of at least 85%; (b) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3, increasing expression of said polynucleotide in the plant shortens root length, decreases expression of said polynucleotide in the plant increases root length, and further increases yield.

Expression of the polynucleotide is altered by one of the following steps: (a) increasing expression in a plant of a polynucleotide encoding a LOGL5 polypeptide by a recombinant DNA construct comprising a polynucleotide encoding a LOGL5 polypeptide and at least one heterologous regulatory element operably linked thereto, wherein the amino acid sequence of the polypeptide encoded by the polynucleotide is identical to the amino acid sequence of seq i ID NO:3 is at least 90%; (b) increasing or decreasing expression of an endogenous polynucleotide encoding a polypeptide having an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:3 is at least 90%; (c) reducing expression in a plant of a polynucleotide encoding a LOGL5 polypeptide by a recombinant DNA construct comprising a suppression element for down-regulating expression of said endogenous polynucleotide encoding a polypeptide having an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO:3 is at least 90%.

In another aspect, the invention provides a method for increasing the level of expression or activity of a plant endogenous LOGL5 polypeptide as compared to the level of expression or activity of a wild-type LOGL5 polypeptide in a control plant; and the plant exhibits shorter roots as compared to a control plant; the method comprises the following steps: introducing a DNA fragment in the genomic region of the endogenous LOGL5 gene (i) increases expression of LOGL5, or (ii) introduces one or more nucleotide changes, wherein the change is effective to increase the expression level or activity of the endogenous LOGL5 polypeptide.

The present invention provides a method for reducing the level of expression or activity of an endogenous LOGL5 polypeptide in a plant as compared to the level of expression or activity of wild-type LOGL5 in a control plant; and the plant exhibits longer roots as compared to a control plant; the method comprises the following steps: introducing into the genomic region of the endogenous LOGL5 gene and its regulatory elements (i) a DNA fragment, deletion, or substitution of a DNA fragment, or (ii) one or more nucleotide changes, wherein said changes are effective to reduce the level of expression or activity of the endogenous LOGL5 polypeptide.

A method of increasing or decreasing the expression level or activity of an endogenous LOGL5 polypeptide in a plant as compared to the wild-type LOGL5 polypeptide activity of a control plant, wherein said alteration is introduced by a zinc finger nuclease, a transcription activator-like effector nuclease (TALENs), a CRISPR-Cas, a guide Cas endonuclease, a homing endonuclease (meganuceleases), or a CRISPR-Cas ribosomes.

In another aspect, there is provided a method of identifying one or more alleles associated with root length from a population of rice plants, the method comprising the steps of: (a) detecting one or more polymorphisms in (i) a genomic region encoding a polypeptide, or (ii) a regulatory region that controls expression of a polypeptide in a population of rice plants, wherein said polypeptide is selected from the group consisting of SEQ ID NO:3, or an amino acid sequence identical to SEQ ID NO:3 an amino acid sequence having greater than 90% identity, wherein one or more polymorphisms in a genomic region encoding the polypeptide or a regulatory region that regulates expression of the polypeptide is associated with root length; and (b) identifying one or more alleles of one or more root length-associated polymorphisms. Wherein the root length associated allele or alleles can be used as a selectable marker for a rice plant associated with a helper root length; the one or more polymorphisms are located in a coding region of a polynucleotide; the regulatory region is a promoter.

In another aspect, the invention relates to a recombinant DNA construct comprising any of the isolated polynucleotides of the invention operably linked to at least one regulatory sequence; and cells, plants and seeds comprising the recombinant DNA constructs. Such cells include eukaryotic cells, such as yeast, insect or plant cells; or prokaryotic cells, such as bacteria.

Brief description of the drawings and sequence listing

The present invention will be understood more fully from the following detailed description and drawings, and from the sequence listing, which form a part of this application.

FIG. 1 shows the relative expression levels of OsLOGL5 gene in seedlings of different transgenic rice lines (DP0600) determined by real-time PCR analysis. The expression level of the gene in ZH11-TC was set to 1.00, and the number above the expression level bar of each transgenic line indicates the fold change compared with ZH 11-TC. ZH11-TC is ZH11 obtained by tissue culture.

FIG. 2 is a photograph of a seedling cultured in water for 11 days.

FIG. 3 shows the roots of 45-day-old seedlings grown in vermiculite cultured in Hoagland broth.

FIG. 4 is a map of sgRNA distribution in the genome of rice OsLOGL5 gene.

FIG. 5 illustrates the distribution of sgRNA in the genome of rice OsLOGL5 gene.

FIG. 6 illustrates the distribution of two sgRNAs in the genome of rice OsLOGL5 gene.

Fig. 7 is an alignment of the mutation sequences resulting from the introduction of CRISPR-Cas construct DP3035 into plants in rice plants. The mutations were determined by PCR and sequencing. The reference sequence is the unmodified site of the target site and is underlined. The PAM sequence and expected cleavage site are also labeled. Deletions, insertions or substitutions are indicated by "-", "italically underlined nucleotides" or "bold italic nucleotides", respectively. The reference sequence and the target site mutant sequence 1-15 are respectively shown as SEQ ID NO: 42-57.

Figure 8 is an alignment of the mutation sequences resulting from the introduction of the CRISPR-Cas construct DP3036 into plants in rice plants. The mutations were determined by PCR and sequencing. The reference sequence is the unmodified site of the target site and is underlined. The PAM sequence and expected cleavage site are also labeled. Deletions, insertions or substitutions are indicated by "-", "italically underlined nucleotides" or "bold italic nucleotides", respectively. The reference sequence and the target site mutant sequence 1-10 are respectively shown as SEQ ID NO: 58-68.

Figure 9 is an alignment of the mutation sequences resulting from the introduction of the CRISPR-Cas construct DP3043 into plants in rice plants. The mutations were determined by PCR and sequencing. The reference sequence is the unmodified site of the target site and is underlined. The PAM sequence and expected cleavage site are also labeled. Deletions, insertions or substitutions are indicated by "-", "italically underlined nucleotides" or "bold italic nucleotides", respectively. The reference sequence and the target site mutant sequence 1-19 are respectively shown as SEQ ID NO: 69-88.

TABLE 1 SEQ ID NOs of the nucleotide and amino acid sequences of the sequence Listing

The sequence descriptions and associated sequence listing follow the rules set forth in the nucleotide and/or amino acid sequence disclosure in the regulatory patent application as set forth in 37c.f.r. § 1.821-1.825. The sequence listing contains the single letter codes for the nucleotide sequence characters as well as the three letter codes for the amino acids as defined in compliance with the IUPAC-IUBMB standard, which is described in Nucleic acids sres.13: 3021-3030(1985) and in Biochemical J.219(No. 2): 345, 373(1984), both of which are incorporated herein by reference. The symbols and formats used for nucleotide and amino acid sequence data follow the rules set forth in 37c.f.r. § 1.822.

Detailed Description

The disclosure of each reference listed herein is incorporated by reference in its entirety.

As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes a plurality of such plants. The meaning of "a cell" includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.

As described herein:

the term "OsLOGL 5 (protein LONELY GUY-like 5)" relates to a polypeptide encoded by the rice gene locus LOC _ Os03g64070.1 and related allelic variants, which is capable of modulating root length traits and further modulating yield. "LOGL 5 polypeptide" as used herein relates to LOGL5 polypeptides and homologs derived from other plants.

OsLOGL5 polypeptide (SEQ ID NO:3) is an amino acid sequence encoded by the coding sequence (CDS) (SEQ ID NO:2) or nucleic acid sequence (SEQ ID NO:1) of the rice genetic locus LOC _ Os03g64070.1 and related allelic variants thereof. In TIGR (the internet at plant biology msu. edu/index. shtml), the polypeptide is annotated as "unidentified protein PA4923, speculated, expressed" in NCBI as "protein LONELY GUY-like 5".

The monocotyledons in the present invention include plants of the family Gramineae; dicotyledonous plants include plants of the families Brassicaceae, Leguminosae, and Solanaceae.

"plant" includes whole plants, plant organs, plant tissues, seeds, and plant cells, as well as progeny of the same plant. Plant cells include, but are not limited to, cells derived from: seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.

"progeny" includes any subsequent generation of the plant.

"modified plant" includes plants that comprise within their genome a heterologous polynucleotide or a modified gene or promoter. For example, a heterologous polynucleotide can be stably integrated into the genome and inherited over successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. The T0 plant is directly derived from the transformation and regeneration process, and the progeny of the T0 plant is T1 (first progeny), T2 (second progeny), and so on.

"heterologous" with respect to a sequence means a sequence from a foreign species, or if from the same species, a sequence whose composition and/or locus has been significantly altered from its native form by deliberate human intervention.

"transgenic" refers to any cell, cell line, callus, tissue, plant part, or plant whose genome has been altered by the presence of a heterologous nucleic acid (e.g., a recombinant DNA construct), including those initial transgenic events as well as those generated by sexual crosses or apomixis from the initial transgenic events. The term "transgenic" as used herein does not encompass alterations of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

A "control", "control plant" or "control plant cell" provides a reference for determining a phenotypic change in a test plant or plant cell, which may be a progeny of a transgenic plant or plant cell, due to transformation, a genomic change in the test plant or plant cell affecting a gene of interest.

Control plants or control plant cells include, for example: (a) wild type plants or cells of the same genotype and used for genetic alteration to produce the test plant or cell; (b) plants or plant cells of the same genotype as the starting material but transformed into an empty vector (e.g., a vector carrying a marker gene and having no effect on the trait of interest); (c) separating the character of the transgenic plant or plant cell to obtain a non-transgenic progeny plant or plant cell; (d) a plant or plant cell having the same genome as the transgenic plant or plant cell, which has not been exposed to conditions or stimuli that induce gene expression; (e) transgenic plants or plant cells themselves in the absence of expression of a particular gene of interest. Controls may include a variety of individuals representative of one or more of the types described above, e.g., (c) a mixture of neutral post-segregating non-transgenic material is commonly referred to as bulk null.

In the present invention, ZH11-TC, DP0158 and negative refer to control plants. ZH11-TC represents a rice plant obtained by flower 11 in tissue culture, DP0158 represents a rice plant obtained by transformation of an empty vector DP0158, and negative means a negative rice plant with a genome editing function that has undergone a transformation process but has a wild-type gene.

"trait" refers to a physiological, morphological, biochemical or physical characteristic of a plant or a particular plant material or cell.

"phenotype" means a detectable characteristic of a cell or organism.

"drought" refers to a decrease in water available to a plant, particularly a longer period of water deficit or during important growth stages of the plant, which can cause damage to the plant or prevent the growth of the plant (limit the growth of the plant, reduce the yield of kernels).

"drought tolerance" refers to the ability of a plant to survive drought stress without substantial physiological or physical alteration, and/or the ability to recover from rehydration after a period of drought. "

"drought tolerance" of a polypeptide means that overexpression of the polypeptide can improve the drought tolerance of a transgenic plant compared to a reference or control plant.

The "enhanced drought tolerance" of a plant is measured as compared to a reference or control plant, reflects the ability of the plant to survive drought stress, and has less physiological or physical damage, or a faster recovery upon rehydration after drought stress, as compared to the reference or control.

"environmental conditions" refers to the environment in which a plant is growing, such as the presence of available moisture, available nutrients, or insects or diseases.

"Paraquat" (1, 1-dimethyl-4, 4-bipyridine dichloride) is a nonselective pyridine herbicide applied to leaves, and can cause photo-oxidative stress and further cause damage to plants or prevent normal growth of plants.

"Paraquat tolerance" is a trait of a plant that reflects the ability of the plant to survive or grow well after treatment with a paraquat solution as compared to a reference or control plant.

The "increased tolerance to paraquat" of a plant is measured relative to a reference or control plant and reflects the ability of the plant to survive and have less physiological or physical damage than the reference or control plant following treatment with a paraquat solution. In general, tolerance against a relatively low concentration of paraquat solution is used as an index of tolerance to abiotic stress such as drought stress.

"oxidative stress" reflects an imbalance between the production of reactive oxygen species and the ability of biological systems to scavenge reactive oxygen intermediates or repair damage. Disrupting the normal redox state of a cell can result in the toxic effects of producing hydrogen peroxide and free radicals that can damage cellular components including proteins, lipids, and DNA.

"harvest index" refers to the kernel weight divided by the total plant weight.

Increased biomass can be measured, e.g., increased plant height, total leaf area of the plant, fresh weight of the plant, dry weight of the plant, or seed yield of the plant, as compared to a control plant.

There is a particular interest in increasing the size of the blades. Increased leaf biomass can be used to increase the production of botanical drugs or industrial products.

Increased tiller number can increase yield, increased plant leaf area can increase total photosynthesis in the plant, increased photosynthetic capacity can increase yield of specific plant tissues, including leaves, roots, fruits or seeds, and allow plants to grow with low or high light intensity.

Alteration of the biomass of other tissues, such as roots, is beneficial in improving the ability of plants to grow under harsh conditions, including nutrient deprivation, water deprivation, as a large number of roots can better absorb water and nutrients.

"Nitrogen limiting conditions" refers to conditions under which the total amount of available nitrogen (e.g., nitrate, ammonia, or other known nitrogen source) is insufficient to maintain optimal growth and development of a plant, those skilled in the art will know the total amount of available nitrogen to maintain optimal growth and development of a plant, those skilled in the art will know what constitutes a sufficient amount of total available nitrogen, and what constitutes soil, media, and applied fertilizers to provide nitrogen to a plant. The nitrogen limitation depends on a variety of factors including, but not limited to, the particular plant and environmental conditions.

The terms "nitrogen stress tolerance", "low nitrogen tolerance" and "nitrogen deficiency tolerance" are used interchangeably herein and refer to a trait of a plant, i.e., the ability of a plant to survive under nitrogen limiting conditions or low nitrogen conditions.

By "increased nitrogen stress tolerance" of a polypeptide is meant that overexpression of the polypeptide in a transgenic plant increases the nitrogen stress tolerance of the transgenic plant as compared to a reference or control.

A plant ' increased nitrogen stress tolerance ' is measured after comparison to a reference or control, reflecting the plant's ability to survive and/or grow better under nitrogen limiting conditions; the increased number of nitrogen stress tolerant plants compared to a reference or control plant may be any number.

"plant nitrogen stress tolerance" is a plant exhibiting nitrogen stress tolerance. A nitrogen stress tolerant plant may exhibit an increase in at least one agronomic trait under nitrogen limiting conditions as compared to a control plant.

"NUE" is nitrogen utilization efficiency, and specifically refers to the ability of a plant to utilize nitrogen at low or high fertilizer levels. It reflects the ability of the plant to absorb, assimilate and/or utilize other nitrogen.

The Soil Plant Analytical Development (SPAD) value is the SPAD reading determined by the SPAD-502plus chlorophyll apparatus (produced by KONICA MINOLTA). The SPAD value is the relative content of chlorophyll in leaves and is an important index of plant health. Many studies have shown that leaf nitrogen content is positively correlated with SPAD values (Swain D.K. and Sandip S.J. (2010) Journal of Agronoomy 9 (2): 38-44), which can be used as an analytical indicator of the nitrogen status in crops (Cai H. -G.et al. (2010) Acta metasugica silica 16 (4): 866-873).

Response and tolerance of rice to low nitrogen stress is a comprehensive and comprehensive physiological and biochemical process. The tolerance of a plant will be reflected in different ways at different stages of plant development and under different stress conditions. Environmental factors such as light and temperature are key factors affecting the growth of rice, and changes of the environmental factors affect the growth and development of rice. Researches prove that the low-nitrogen treatment of rice plants can observe that the chlorophyll content in leaves is reduced, the tiller number is reduced, or the biomass is reduced. In the experiment, the color of leaves (reflecting chlorophyll content and SPAD value), fresh weight and tiller number of the plant are measured, and the low-nitrogen resistant plant is comprehensively selected according to the three parameters.

"chlorate" refers to a compound containing chlorate anions, a chlorate compound. It is a nitrate analog, which is absorbed by plants through nitrate and the same transport system, and chlorate is reduced to chlorite by nitrate reductase, which is toxic and can cause plant damage, wilting or death. Potassium chlorate was used in the test in the present invention.

"chlorate sensitivity" is a plant trait that reflects damage or even death from chlorate uptake, transport or reduction in plants after treatment with a chlorate solution as compared to control or reference plants.

A plant "increased chlorate sensitivity" is determined relative to a reference or control plant and reflects a higher ability to absorb, transport or assimilate chlorate or nitrate in a chlorate or nitrate solution as compared to the reference or control plant. In general, chlorate sensitivity can be used as an indicator of NUE, the more sensitive a plant is to chlorate, the more efficient the nitrogen utilization.

"chlorate sensitive seedling" refers to a plant with wilting phenotype and no green leaves damaged, and can be considered as a dead plant after treatment with chlorate solution.

"genome" when used in a plant cell encompasses not only chromosomal DNA present in the nucleus of the cell, but organelle DNA present in subcellular components of the cell (e.g., mitochondria, plasmids).

"full-length complementary sequence" refers to the complement of a given nucleotide sequence, the complement and nucleotide sequence containing the same number of nucleotides and being 100% complementary.

"polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-or double-stranded RNA or DNA polymers that optionally contain synthetic, non-natural or altered nucleotide bases.

The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

"recombinant" refers to an artificial combination of two otherwise isolated segments of sequence, for example, by chemical synthesis or by manipulation of the isolated nucleic acid segments using genetic engineering techniques. "recombinant" also includes reference to a cell or vector that has been modified by the introduction of a heterologous nucleic acid, or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those that occur without deliberate human intervention.

"recombinant DNA construct" refers to a combination of nucleic acid fragments that do not normally occur together in nature. Thus, a recombinant DNA vector may comprise regulatory sequences and coding sequences that are not derived from the same source, or regulatory sequences and coding sequences that are derived from the same source but arranged in a manner different than that normally found in nature.

"regulatory sequence" and "regulatory element" are used interchangeably to refer to a nucleotide sequence that is located upstream (5 'non-coding sequence), intermediate, or downstream (3' non-coding sequence) of a coding sequence and that affects the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

"promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment.

A "plant promoter function" is a promoter capable of controlling transcription in a plant cell, whether or not it is derived from a plant cell.

"tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to a promoter that is expressed primarily, but not necessarily exclusively, in a tissue or organ, but may also be expressed in a particular cell.

"developmentally regulated promoter" refers to a promoter whose activity is determined by a developmental event.

"genomic modification" refers to the deliberate and artificial introduction of changes or alterations into a plant genomic nucleotide sequence.

The term "operably linked" refers to nucleic acid fragments joined into a single fragment such that the function of one is regulated by the other. For example, a promoter is operably linked to a nucleic acid fragment when the promoter is capable of regulating transcription of the nucleic acid fragment.

"expression" refers to the production of a functional product. For example, expression of a nucleic acid fragment can refer to transcription of the nucleic acid fragment (e.g., transcription to produce mRNA or functional RNA) and/or translation of the RNA into a precursor or mature protein.

As used herein, "introducing" refers to inserting a nucleotide fragment (e.g., a CRISPR-Cas DNA construct) into a cell, i.e., by "transfection", "transformation", or "transduction", and includes introducing the nucleotide fragment into a eukaryotic or prokaryotic cell, and the nucleotide fragment can integrate into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA) and thereby become an autonomous replicon, or be transiently expressed (e.g., transfection of mRNA).

A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.

"transformation" as used herein refers to both stable and transient transformations.

An "allele" is one of several alternative forms of a gene occupying a given locus on a chromosome. A diploid plant is homozygous at a given locus when the alleles present at that locus on a pair of homologous chromosomes in the plant are identical. A diploid plant is heterozygous at a given locus if the alleles present at that locus on a pair of homologous chromosomes in the plant are different. If the transgene is present on one of a pair of homologous chromosomes in a diploid plant, the plant is hemizygous at that locus.

A "gene" is a nucleotide fragment that expresses a functional molecule, including but not limited to a particular protein, that includes regulatory sequences upstream (5 'non-coding sequences) and downstream (3' non-coding sequences) of a coding sequence. A "native gene" is a naturally occurring gene that possesses its own regulatory sequences.

A "mutant gene" is a gene produced by artificial stem prognosis. The resulting "mutant gene" has a sequence in which at least one nucleotide is added, deleted or substituted as compared with the sequence of a non-mutant gene. "mutant plant" refers to a plant containing a mutant gene.

The "targeted mutation" in the present invention means that a double strand break in DNA of a target sequence is induced by a double strand break inducer to change a specific sequence of an endogenous gene, thereby causing mutation of the endogenous gene.

"genetic modification" refers to an alteration in the genomic nucleotide sequence introduced into a plant by deliberate human activity.

"Nuclear localization Signal" refers to a signal polypeptide that targets a nuclear protein (Raikhel, (1992) Plant Phys.100: 1627-1632).

"CRISPR-associated gene" refers to a nucleotide sequence encoding a polypeptide composition of a clustered short palindromic repeats (CRISPR) -associated system (Cas). The genes are coupled and are related to or adjacent to CRISPR site flanking fragments. The "Cas gene" and "CRISPR-associated gene" are used interchangeably in the present invention. For example, including, but not limited to, Cas3 and Cas9, which encode endonucleases in CRISPR type I and CRISPR type II systems, respectively.

By "Cas endonuclease" is meant a Cas protein encoded by a Cas gene that causes a double strand break in a DNA target sequence. The guide polynucleotide directs Cas endonuclease recognition and selectively causes double strand breaks at specific sites in the cell genome.

"guide rna (grna)" refers to a crrna (crispr rna): a hybrid RNA molecule fused to tracrRNA encoded by a modifiable DNA element. Typically, a gRNA includes one copy of a spacer sequence complementary to a pre-spacer sequence at a particular site in the genome, and a binding domain for binding of a Cas endonuclease and a CRISPR complex.

A "guide-polynucleotide" refers to a polynucleotide sequence that forms a complex with a Cas endonuclease and allows the Cas endonuclease to recognize and select a target site for DNA cleavage. The leader polynucleotide consists of one single molecule or one double molecule.

The term "guide-polynucleotide/Cas endonuclease system" refers to a complex comprising one Cas endonuclease and one leader polynucleotide, which results in a double strand break of the DNA target sequence. Once the guide RNA recognizes the target sequence, the Cas endonuclease can cleave the DNA double strand sequence near the genomic target site and cleave the DNA double strand if the correct pro-spacer adjacent motif (PAM) is positioned approximately at the 3' end of the target sequence.

"genomic target site" refers to one pre-spacer and one pre-spacer sequence adjacent motif (PAM) for site-directed mutagenesis and/or double-strand break located in the host genome.

"Pre-spacer" refers to a short DNA sequence (12-40 nucleotides) that targets mutations and/or double strand breaks. The pre-spacer is based on base complementary pairing of spacer sequences of crRNA or sgRNA, resulting in enzymatic cleavage with a CRISPR system endonuclease.

A "prometalocytic sequence adjacent motif (PAM)" includes a 3-8 nucleotide sequence immediately adjacent to the genomic target site prometalocytic sequence.

CRISPR sites (clustered regularly interspaced short palindromic repeats, also known as SPIDRs-interspersed directed repeats) include the DNA sites described above. A CRISPR site has a short, highly conserved DNA palindromic repeat (typically 24-40 nucleotides, repeated 1-140 times, hence also referred to as a CRISPR-repeat unit). The repeats (typically species-specific) are separated by a variable number of sequences of fixed length (typically 20-58 nucleotides, depending on the CRISPR site) (WO2007/025097, published on 3/1/2017).

Endonucleases are enzymes that cleave the phosphodiester bond of a polynucleotide chain, including restriction endonucleases that cleave DNA without breaking bases at a specific site. The restriction enzymes include type I, type II, type III and type IV endonucleases and sub-types thereof. In both type I and type III systems, the single complex has methylase and restriction activity. Endonucleases also include homing endonucleases (meganucleases or HEases) that bind and cleave specific recognition sites, similar to restriction endonucleases, however the homing endonuclease recognition sites are usually longer, about 18 nucleotides or longer (patent application WO-PCT/US 12/30061, filing date 3/22/2012). Based on conserved sequence motifs, homing endonucleases can be divided into four families, LAGLIDADG, GIY-YIG, H-N-H and His-Cys box families. These motifs participate in the coordination of the metal ion and the hydrolysis process of the phosphodiester bond. The main advantages of homing endonucleases are the recognition of long recognition sites in DNA motifs and the tolerance of sequence polymorphisms.

TAL effector nucleases are novel sequence-specific nucleases that cause double-strand breaks in specific target sequences in the genome of a plant or other organism. TAL effector nucleases are produced by fusing a natural or synthetic transcription activator-like (TAL) effector or functional region thereof to the catalytic domain of an endonuclease, such as a Foki endonuclease. The unique, modular TAL effector DNA binding domain is artificially modified and confers DNA recognition specificity (Milleret al (2011) Nature Biotechnology 29: 143-148). Zinc Finger Nucleases (ZFNs) are artificially synthesized double-strand break inducers, which contain a zinc finger DNA domain and a double-strand break inducing domain. The zinc finger domain confers recognition site specificity and typically comprises 2, 3 or 4 zinc finger structures. For example, there is a C2H2 structure, however other zinc finger structures are also known and can be modified. The zinc finger domain is a programmable polypeptide that specifically binds to a selected polynucleotide recognition sequence. ZFNs constitute a zinc finger domain of DNA-binding proteins linked to a site of a non-specific endonuclease. For example, the nuclease site is from a type l endonuclease such as fokl. Other functions may be incorporated into the zinc finger binding domain, including the transcriptional activation domain, the transcriptional repression domain, and the methylase. In some instances, cleavage activity requires dimerization of the nuclease. Each zinc finger can recognize 3 base pairs of the target DNA. For example, one group containing 3 zinc finger domains can recognize 9 contiguous nucleotide sequences, and two groups containing 3 zinc finger domains can recognize 18 nucleotide sequences when dimerized.

"target site", "target sequence", "target DNA", "target location", "genomic target site", "genomic target sequence" and "genomic target location" are used interchangeably herein, and specifically refer to a stretch of nucleotide sequences in the genome of a plant cell (including chloroplast DNA and mitochondrial DNA), and are capable of inducing double strand breaks in the genome of a plant cell by a Cas endonuclease. The target site may be an endogenous site in the genome of the plant or a heterologous site in the plant, but does not occur naturally in the genome; the target site may be at a different locus than naturally occurring. "endogenous target sequence" and "native target sequence" are used interchangeably herein and refer specifically to a target sequence that is endogenous to or native to a plant genome, or to an endogenous or native site of a target sequence in a plant genome.

"variant target site", "variant target sequence", "modified target site", "modified target sequence" are used interchangeably herein and specifically refer to a target sequence in which at least one of the target sequences is altered as compared to the unaltered target sequence. Such variations include, for example: (1) at least one nucleotide substitution, (2) at least one nucleotide deletion, (3) at least one nucleotide insertion, or (4) a combination comprising (1) - (3) above.

"percent (%) sequence identity" is the percent identity, if necessary, of amino acid residues or nucleotides of a test sequence (query) to the reference sequence (subject) after alignment and gap introduction, which is the percent sequence identity to the greatest degree and without regard to amino acid conservative substitutions belonging to sequence identity. For example, alignments to determine the ratio of sequence identity using published computer software such as BLAST, BLAST-2 are well known to those skilled in the art. Suitable parameters for determining sequence alignments include algorithms to maximize matching with the full sequence to be tested. "percent sequence identity" in the context of the present invention for two sequences is a function of the amount of sequence match identity (e.g., calculation of sequence identity for a test sequence involves taking the number of positions in the two sequences that are the same nucleotide base or amino acid residue to obtain the number of matched positions, and dividing the number of matched positions by the total number of positions in the alignment window and multiplying by 100).

Standard recombinant DNA and molecular cloning techniques for use in the present invention are well known to those skilled in the art and are more fully described in the following references: sambrook, j., Fritsch, e.f. and manitis, t., molecular cloning: a Laboratory Manual; cold Spring harbor laboratory Press: cold spring harbor, 1989 (hereinafter referred to as "Sambrook").

Turning now to the embodiments:

embodiments include isolated polynucleotides and polypeptides, recombinant DNA constructs (including suppression constructs) for modulating root length, compositions (e.g., plants or seeds) comprising these recombinant DNA constructs, and methods of using these recombinant DNA constructs, CRISPR-Cas constructs for modulating root length of plants, compositions containing mutated root length regulatory genes or promoters thereof, and methods of using CRISPR-Cas constructs.

Isolated polynucleotides and polypeptides:

the present invention includes isolated polynucleotides and polypeptides as follows:

an isolated polynucleotide comprising (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:3 has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity when compared; or (ii) the full-length complement of nucleic acid sequence (i), wherein the full-length complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the above isolated polynucleotides may be used in any recombinant DNA construct of the present invention. Increasing expression of the encoded polypeptide results in root shortening and further reduces yield under normal conditions.

An isolated polypeptide having an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO:3, which is a root length modulating polypeptide, LOGL5, and has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity when compared, and increased expression of said encoded polypeptide results in root shortening.

An isolated polynucleotide comprising: (i) a nucleic acid sequence which hybridizes to SEQ ID NO:1 or 2, have at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity when compared; or (ii) the full complement of nucleic acid sequence (i). Any of the above isolated polynucleotides, preferably encoding root length modulating polypeptide LOGL5, whose increased expression results in root shortening, can be used in any recombinant DNA construct of the present invention.

It is to be understood (as will be appreciated by those skilled in the art) that the present invention encompasses more than these specific exemplary sequences. Alterations in nucleic acid fragments that result in the production of chemically equivalent amino acids at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, the codon for alanine, a hydrophobic amino acid, may be replaced by a codon encoding another less hydrophobic residue (e.g., glycine) or a more hydrophobic residue (e.g., valine, leucine, or isoleucine). Similarly, changes that result in the replacement of one negatively charged residue for another (e.g., aspartic acid for glutamic acid) or one positively charged residue for another (e.g., lysine for arginine) are also expected to yield functionally equivalent products. Nucleotide changes that result in changes in the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, such as determining the retention of biological activity of the encoded product.

Recombinant DNA constructs and suppression DNA constructs

In one aspect, the invention includes recombinant DNA constructs and suppression DNA constructs.

In one embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one heterologous regulatory element (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence that hybridizes to SEQ ID NO:3 has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity when compared; or (ii) the full complement of nucleic acid sequence (i).

In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one heterologous regulatory element (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence that hybridizes to SEQ ID NO:1 or 2, have at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity when compared; or (ii) the full complement of nucleic acid sequence (i).

In another embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide encodes a root length regulatory polypeptide. These polypeptides may be derived from, for example, rice (Oryza sativa), wild rice (Oryza australiensis), short-tongue wild rice (Oryza barthii), African rice (Oryza glaberrima), broad leaf rice (Oryza latifolia), Oryza longistaminata (Oryza longistaminata), southern wild rice (Oryza meridionalis), medicinal wild rice (Oryza officinalis), Oryza sativa (Oryza punctata), Oryza sativa (Oryza rufipogon) (red rice), Oryza indica (Oryza nivara), Arabidopsis thaliana (Arabidopsis thaliana), maize (Zea mays), soybean (Glycine max), tobacco bean (Glycine tabacina), Glycine soja (Glycine soja), and Glycine mugwort (Glycine mugwort).

In another aspect, the invention includes suppression DNA constructs.

A suppression DNA construct comprising at least one heterologous regulatory element (such as a promoter functional in plants) operably linked to a suppression element, wherein the suppression element comprises at least 100bp contiguous base pairs (a) (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence that hybridizes to the amino acid sequence of SEQ ID NO:3 is at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, or (ii) the full-length complement of nucleic acid sequence (a) (i); or (b) a region derived from all or part of the sense or antisense strand of a target gene, wherein said target gene encodes the root length regulatory polypeptide LOGL 5; or (c) all or part of (i) a nucleic acid sequence which is at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO 1 or 2, or (ii) a full-length complementary nucleic acid sequence of nucleic acid sequence (c) (i).

CRISPR-Cas construct:

a CRIPSR/Cas construct comprising a polynucleotide encoding a CRISPR/Cas enzyme, a polynucleotide encoding a nuclear localization signal, at least one heterologous regulatory element, and a gRNA operably linked thereto, wherein the gRNA targets a target genomic region comprising an endogenous LOGL5 gene and its regulatory elements.

The gRNA targets a polypeptide comprising SEQ ID NO: 1. 2 or 8 nucleotide sequence.

Typically, the target genomic sequence is analyzed by existing tools to generate candidate sgRNA sequences.

The sgRNA sequence is distributed on a target genomic sequence, the target genomic sequence comprises a promoter, an exon, an intron 5 '-UTR and a 3' -UTR, and the sgRNA sequence is shown in SEQ ID NO: 14-35.

A single sgRNA can be used to construct genome editing constructs, which can direct the localization of the Cas9 enzyme to the target region, generate double strand breaks in the target DNA sequence, initiate non-homologous end joining (NHEJ) repair mechanisms and homology-mediated repair (HDR), typically inducing random insertions, deletions, and substitutions at the target site.

Two sgRNAs can also be used to construct genome editing constructs that can elicit fragment deletions, point mutations (insertion, deletion, and substitution of a small number of bases).

Regulatory elements:

recombinant DNA constructs (including suppression DNA constructs) of the invention comprise at least one regulatory element.

The regulatory element may be a promoter, an enhancer.

Multiple promoters may be used in the recombinant DNA constructs of the invention, and the promoters may be selected according to the desired result, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.

Promoters which cause a gene to be expressed in most cell types in most cases are generally referred to as "constitutive promoters".

The effect of a candidate gene can be assessed when a constitutive promoter drives expression of the candidate gene, but high level, constitutive expression of the candidate gene under the control of a 35S or UBI promoter may have a multiplex effect. The use of tissue-specific and/or stress-specific promoters can eliminate undesirable effects but retain the ability to increase plant drought tolerance. This effect has been observed in Arabidopsis (Kasuga et al (1999) Nature Biotechnol.17: 287-91).

Constitutive promoters suitable for use in plant host cells include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO99/43838 and U.S. Pat. No. 6,072,050; the CaMV35S core promoter (Odell et al, (1985) Nature 313: 810-812); rice actin (McElroy et al, (1990) Plant Cell 2: 163-171); ubiquitin promoters (Christensen et al, (1989) Plant mol.biol.12: 619-632 and Christensen et al, (1992) Plant mol.biol.18: 675-689); pEMU (Last et al, (1991) the or. appl. Genet. 81: 581-588); MAS (Velten et al, (1984) EMBO J.3: 2723-2730); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, those disclosed in U.S. Pat. Nos. 5,608,149, 5,608,144, 5,604,121, 5,569,597, 5,466,785, 5,399,680, 5,268,463, 5,608,142 and 6,177,611.

In selecting a promoter for use in the methods of the invention, it may be desirable to use a tissue-specific promoter or a developmentally regulated promoter.

A tissue-specific promoter or a developmentally regulated promoter is a DNA sequence that regulates the expression of the DNA sequence selectively in plant cells/tissues important for tassel development, seed set, or both, and limits the expression of such DNA sequences to only during tassel development or seed maturation in a plant. Any identifiable promoter that causes the desired temporal and spatial expression can be used in the methods of the invention.

For polynucleotides expressed in developing seed tissue, specific promoters include seed-preferred promoters, particularly the early grain/embryo promoter and the late grain/endosperm promoter, and grain development after pollination can be roughly divided into three basic stages, with a lag phase for grain growth beginning 0 to 10-12 days after pollination, during which grain no longer grows significantly, but during which important events that determine grain viability will occur (e.g., cell establishment number). The linear grain filling period starts 10-12 days after pollination and extends to about 40 days after pollination, during the grain development period, the grain reaches the final quality and produces various storage substances such as starch, protein, oil and the like; the maturation period begins approximately 40 days after pollination to harvest, during which the grain begins to hibernate, dry and prepare for seed dormancy before germination. The term "early grain/embryo promoter" as used herein refers to a promoter that drives gene expression primarily during the lag phase of seed development (i.e., from day 0 to day 12 post-pollination); the 'late seed/endosperm promoter' mainly drives gene expression in seeds from 12 days after pollination to the maturation process; there may be some overlap in the expression windows, and the promoter will be selected based on the ABA-coupled sequence used and the desired phenotype.

Early grain/embryo promoters include Cim1, which is active in specific tissues on day 5 post pollination (WO 00/11177); other early grain/embryo promoters include the seed-preferred promoter end1, which is expressed 7-10 days after pollination, and end2, which is expressed throughout the grain 9-14 days after pollination and in the endosperm and pericarp 10 days after pollination (WO00/12733), which is incorporated herein by reference in its entirety. Other early grain/embryo promoters useful in particular methods of the invention include the seed-preferred promoter ltp2 (U.S. Pat. No. 5,525,716); the maize Zm40 promoter (U.S. patent No. 6,403,862); corn nuc1c (U.S. Pat. No. 6,407,315); the maize ckx1-2 promoter (U.S. patent No. 6,921,815 and U.S. patent application publication No. 2006/0037103); the maize lec1 promoter (U.S. Pat. No. 7,122,658); the maize ESR promoter (U.S. patent No. 7,276,596); the maize ZAP promoter (U.S. patent application publication nos. 20040025206 and 20070136891); the maize promoter eep1 (U.S. patent application publication No. 20070169226); and maize promoter ADF4 (U.S. patent application No. 60/963,878, 8/7/2007).

Promoters useful in certain embodiments of the invention include: RIP2, mLIP15, ZmCOR1, Rab17, CaMV35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV19S, nos, Adh, sucrose synthetase, R-allele, vascular tissue-preferred promoters S2A (Genbank accession EF030816) and S2B (Genbank accession EF030817) and constitutive promoter GOS2 from maize. Other promoters also include root-preferred promoters, such as the maize NAS2 promoter, the maize Cyclo promoter (US 2006/0156439, disclosed in 2006, 7/13), the maize ROOTMET2 promoter (WO05063998, disclosed in 2005, 7/14), the CRlBIO promoter (WO06055487, disclosed in 2006, 5/26), CRWAQ81(WO05035770, disclosed in 2005, 4/21), and the maize ZRP2.47 promoter (NCBI accession No.: U38790; gin No. 1063664).

The recombinant DNA constructs of the present invention may also include other regulatory sequences including, but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In particular embodiments, the recombinant DNA construct further comprises an enhancer or silencer.

Intron sequences may be added to the 5 'untranslated region, the protein coding region, or the 3' untranslated region to increase the amount of mature message that accumulates in the cytoplasm. It has been shown that the inclusion of a spliceable intron in the transcription unit of expression constructs in both plants and animals can enhance gene expression up to 1000-fold at both the mRNA and protein levels. See Buchman and Berg, mol. cellbiol.8: 4395-4405 (1988); callis et al, Genes Dev.1: 1183-1200(1987).

Composition (A):

the compositions of the invention are plants comprising in their genome any of the recombinant DNA constructs or suppression DNA constructs of the invention (e.g., any of the constructs discussed above). Compositions also include progeny of any plant, as well as any seed obtained from a plant or progeny thereof, wherein the progeny or seed comprise in its genome the recombinant DNA construct or suppression DNA construct. Progeny includes successive generations obtained by self-pollination or outcrossing of a plant. Progeny also includes hybrids and inbreds.

A composition of the invention is a plant having a decreased level of expression or activity of an endogenous LOGL5 polypeptide, as compared to the level of expression or activity of a wild-type LOGL5 polypeptide in a control plant; the plants exhibit longer roots compared to control plants; expression and activity of an endogenous LOGL5 polypeptide in the plant is reduced by genomic modifications introduced into the plant. The genomic modifications include: the genomic region in which the endogenous LOGL5 gene and its regulatory elements are located a) by insertion of a DNA fragment or deletion of a DNA fragment or substitution of a DNA fragment, or b) by creating one or more nucleotide changes that are effective in reducing the expression level or activity of the endogenous LOGL5 polypeptide.

One composition of the invention is another plant having a modified gene for LOGL5 or a modified regulatory element of the gene for LOGL 5. Compositions also include any progeny of the plant, and any seed obtained from the plant or progeny thereof, wherein the progeny or seed comprise in their genome the modified LOGL5 gene or regulatory element. The progeny includes successive generations of the plant obtained by self-pollination or outcrossing. Progeny also includes hybrids and inbreds.

In hybrid seed propagated crops, mature transgenic plants can be self-pollinated to produce homozygous inbred plants. The inbred plant produces seed containing the newly introduced recombinant DNA construct. These seeds may be grown to produce plants that will exhibit altered agronomic characteristics, or may be used in breeding programs to produce hybrid seeds that may be grown to produce plants that will exhibit, for example, altered agronomic characteristics. The seed may be a corn seed or a rice seed.

The plant may be a monocotyledonous or dicotyledonous plant, for example a rice, maize or soybean plant, such as a maize hybrid plant or a maize inbred plant. The plant can also be sunflower, sorghum, canola, wheat, alfalfa, cotton, barley millet, sugar cane, or switchgrass.

The recombinant DNA construct or suppression DNA construct may be stably integrated into the genome of the plant. The CRISPR-Cas construct can be stably integrated into the plant genome, and the resulting gene or regulatory element modifications can be stably inherited in plants.

Embodiments include, but are not limited to, the following:

1. a transgenic or genomically modified plant (e.g., rice, maize or soybean plant) comprising in its genome a polynucleotide operably linked to at least one heterologous regulatory element, wherein the polynucleotide encodes a polypeptide having an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:3, has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity when compared, wherein said plant exhibits an altered root length when compared to a control plant not comprising said genomic modification or heterologous regulatory element, wherein increased expression of said polynucleotide shortens a root length of the plant and decreased expression of said polynucleotide lengthens a root of the plant.

2. A transgenic plant (e.g., a rice, maize or soybean plant) comprising in its genome a suppression DNA construct comprising a suppression element operably linked to at least one heterologous regulatory element sequence, said suppression element being derived from a sense or antisense strand of a target gene of interest, said segment having a nucleotide sequence at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% identical in sequence to the sense or antisense strand from which the suppression element is derived, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, wherein said target gene of interest encodes a LOGL5 polypeptide, said plant exhibiting longer roots as compared to a control plant.

3. A transgenic plant (e.g., rice, maize or soybean plant) comprising in its genome a suppression DNA construct comprising at least one heterologous regulatory element operably linked to at least 100bp contiguous base pairs of: (a) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3, having at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, and (b) the full-length complement of nucleic acid sequence (a), wherein the plant exhibits longer roots as compared to a control plant.

4. The plant of embodiments 1-3, wherein the polynucleotide encodes a LOGL5 polypeptide, which LOGL5 polypeptide can be from rice (Oryza sativa), wild rice (Oryza australiensis), short tongue wild rice (Oryza barthii), African rice (Oryza glabrata), broad leaf rice (Oryza latifolia), Oryza elongata (Oryza longissima), southern wild rice (Oryza meridionalis), medicinal wild rice (Oryza officinalis), Oryza sativa (Oryza puncata), Oryza sativa (Oryza punica), Oryza sativa (Oryza sativa), Arabidopsis thaliana (Arabidopsis thaliana), Cicer arieum, Potato (Solanum nigrum), Brassica oleracea (Brassica oleracea), Glycine max (Glycine max).

5.1-4 embodiments of the plant of any progeny, embodiments of 1-4 of the plant of any seed, from embodiments of 1-4 of any of the plant cell and its progeny.

In any of the foregoing embodiments 1-5 or other embodiments disclosed herein, the recombinant DNA construct further comprises at least one heterologous promoter functional in plants as a regulatory element.

One skilled in the art can readily find an appropriate control or reference plant when evaluating or determining an agronomic trait or phenotype of a transgenic plant using the compositions or methods described herein. For example, but not limited to, the following examples:

1. progeny of a transformed plant that is hemizygous for the recombinant DNA construct, the progeny segregating into plants that either comprise or do not comprise the DNA construct: progeny comprising the recombinant DNA construct will typically be measured relative to progeny not comprising the recombinant DNA construct (i.e., progeny not comprising the recombinant DNA construct is a control or reference plant).

2. The recombinant DNA construct is introgressed into an inbred, such as in maize, or introgressed into a variety, such as in soybean: the introgressed line will typically be measured relative to the parent inbred or variety line (i.e., the parent inbred or variety line is the control or reference plant).

3. Two hybrid lines, wherein the first hybrid line is produced from two parental inbred lines and the second hybrid line is produced from the same two parental inbred lines, except that one of the parental inbred lines contains the recombinant DNA construct: the second hybrid line will typically be measured relative to the first hybrid line (i.e., the first hybrid line is a control plant or a reference plant).

4. A plant comprising a recombinant DNA construct: the plant can be evaluated or measured relative to a control plant that does not comprise the recombinant DNA construct but has a comparable genetic background to the plant (e.g., the genetic material has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity as compared to a plant comprising the recombinant DNA construct).

The method comprises the following steps:

methods include, but are not limited to: methods for regulating plant root length, methods for observing and/or assessing plant agronomic characteristics, methods for modifying or altering a host endogenous genomic gene, methods for altering expression or activity of an endogenous polypeptide, and methods for producing seeds.

Methods also include, but are not limited to, the following:

methods of genome modification of a plant or plant cell genome target sequence, methods of selecting a plant, methods of gene editing, and methods of inserting a polynucleotide of interest into a plant genome. These methods require a guide RNA/Cas endonuclease system where the guide RNA guides the Cas endonuclease to recognize and select a specific site in the cellular genome, resulting in a double strand break. The guide RNA/Cas endonuclease system is an effective system for site-directed modification of plant, plant cell or seed genome. The invention also provides a method and composition for modifying a target site in a cell genome or editing a nucleotide sequence in a cell genome using a guide polynucleotide/Cas endonuclease system. Once the genomic target site is determined, the target site may be modified with the polynucleotide of interest using a variety of methods.

In one embodiment, a method of modifying a genomic target site of a plant cell is provided, the method comprising introducing into the plant a guide RNA and a Cas endonuclease, the guide RNA and Cas endonuclease being capable of forming a complex, thereby causing a double strand break at the target site using the Cas endonuclease.

Additionally, there is provided a method of modifying a genomic target site of a plant cell, the method comprising: a) introducing into a plant cell a guide RNA and a Cas endonuclease, said guide RNA and Cas endonuclease being capable of forming a complex, thereby causing a double strand break at said target site using the Cas endonuclease; and b) identifying a plant cell comprising at least one site for modification, said modification comprising one or more nucleotide deletion, insertion or substitution in at least one position at the target site.

The protein may be altered in a variety of ways, including amino acid substitutions, deletions, truncations, and insertions. Such methods are known in the art. For example, changes in the amino acid sequence of a protein are caused by mutations in DNA. For example, methods for mutagenesis and nucleotide sequence changes can be found in Kunkel (1985) proc.natl.acad.sci.usa 82: 488-92; kunkel et al (1987) and other references. Amino acid substitutions do not affect the biological activity of the protein, and are mentioned, for example, in the model described by Dayhoff et al (1978, Atlas of protein Sequence and Structure, Natl Biomed Res Foundation, Washington). Conservative substitutions, such as exchanges with another amino acid having similar properties, may be desirable. Conservative substitutions, insertions and amino acid substitutions are not expected to produce radical changes in the properties of the protein; the effect of any substitution, deletion, insertion or recombination can be assessed by routine screening experiments. Double-strand break-inducing activity screening is known, generally by assessing the overall activity and the specific DNA comprising the target site.

A method of editing a cell genome nucleotide sequence, the method comprising introducing into a cell a guide polynucleotide, a Cas endonuclease and an optional polynucleotide modification template, wherein the guide RNA and the Cas endonuclease are capable of forming a complex such that the Cas endonuclease generates a double strand break at a target site in the genome of the cell; the polynucleotide modification template comprises at least one nucleotide modified nucleotide sequence. The nucleotide sequence of the genome of the cell is selected from: promoter sequence, terminator sequence, regulatory element sequence, splice site, coding sequence, polyubiquitination site, intron site and intron enhanced motif.

A method of editing a cellular genomic promoter sequence, the method comprising introducing into a cell a guide polynucleotide, a polynucleotide modification template, and at least one Cas endonuclease, wherein the guide RNA and Cas endonuclease are capable of forming a complex such that the Cas endonuclease generates a double strand break at a target site in the genome of the cell; the polynucleotide modification template comprises at least one nucleotide modified nucleotide sequence.

Methods of transforming cells comprise transforming cells with any of the isolated polynucleotides of the invention. Cells transformed by this method are also included. In particular embodiments, the cell is a eukaryotic cell, such as a yeast, insect, or plant cell, or a prokaryotic cell, such as a bacterial cell.

A method of producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs of the invention and regenerating a transgenic plant from the transformed plant cell. The invention also relates to transgenic plants produced by the method, and transgenic seeds obtained from the transgenic plants.

A method for isolating a polypeptide of the invention from a cell or cell culture medium, wherein the cell comprises a recombinant DNA construct comprising a polynucleotide of the invention operably linked to at least one control sequence, and wherein the transformed host cell is grown under conditions suitable for expression of the recombinant DNA construct.

A method for altering the expression level of a polypeptide of the invention in a host cell, comprising: (a) transforming a host cell with a recombinant DNA construct of the invention; and (b) growing the transformed cell under conditions suitable for expression of the recombinant DNA construct, wherein expression of the recombinant DNA construct results in an altered content of the polypeptide of the invention in the transformed host cell.

A method of producing a modified plant comprises transforming a plant cell with any of the CRISPR-Cas constructs disclosed herein and regenerating a modified plant from the transformed plant cell, wherein the modified plant and modified seed obtained by the method are useful in other methods of the invention.

A method of producing seed, comprising any of the foregoing methods, further comprising obtaining seed from the progeny plant, wherein the seed comprises in its genome the recombinant DNA construct.

In any of the methods of the preceding or any of the methods disclosed in other embodiments herein, the regenerated plant cell in the introducing step may comprise a callus cell, an embryonic callus cell, a gamete cell, a meristem cell, or an immature embryonic cell. The regenerable plant cells can be derived from inbred corn plants.

In any of the foregoing methods or any of the other embodiments disclosed herein, the regenerating step can comprise: (i) culturing said transformed plant cells on a medium containing an embryo-stimulating hormone until callus tissue develops; (ii) (ii) transferring the transformed plant cells of step (i) to a first medium comprising a tissue-stimulating hormone; and (iii) inoculating the transformed plant cell of step (ii) onto a second medium such that its stem is elongated, its roots are developed, or both.

In any of the foregoing methods or methods of other embodiments of the invention, the step of determining a change in an agronomic trait in the transgenic plant may, if feasible, comprise determining whether the transgenic plant exhibits a change in at least one agronomic trait compared to a control plant not comprising the recombinant DNA construct under variable environmental conditions.

In any of the foregoing methods or any method of other embodiments of the invention, the step of determining a change in an agronomic trait in the progeny plant comprises determining whether the progeny plant exhibits a change in at least one agronomic trait compared to a control plant not comprising the recombinant DNA construct, if possible, under variable environmental conditions.

In any of the foregoing methods or any method of other embodiments of the invention, the plant exhibits a change in at least one agronomic trait under water limiting conditions as compared to a control plant.

In any of the foregoing methods or any of the other embodiments of the invention, there is an alternative to introducing into a regenerable plant a recombinant DNA construct comprising a polynucleotide and at least one regulatory element operably linked thereto, e.g., a regulatory element (such as one or more enhancers, optionally part of a transposon element) can be introduced into a regenerable plant cell, followed by screening for a transgenic event having the regulatory element and an endogenous gene encoding a polypeptide of the present invention operably linked thereto.

The recombinant DNA constructs of the invention may be introduced into plants by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, biolistic bombardment, or Agrobacterium transformation. Techniques for plant transformation and regeneration are described in international patent publication No. WO 2009/006276, which is incorporated by reference in its entirety.

In addition, there are methods for modifying or altering the endogenous genomic DNA of a host, including altering the native DNA sequence of the host or including regulatory elements, coding or non-coding sequences and other precursor transgene sequences. These methods can also be used to target nucleic acid sequences to the genome to engineer target recognition sequences. For example, the transgenic modified cells or plants herein are produced using conventional genetically engineered nucleases such as homing endonucleases that produce modified Plant genomes (e.g., WO 2009/114321; Gao et al (2010) Plant Journal 1: 176-187). Other site-directed engineering is modification of endogenous genes by using the restriction features of zinc finger domain recognition coupled restriction enzymes (e.g., Urnov et al (2010) Nat Rev Genet.11 (9): 636-46; Shukla et al (2009) Nature 459 (7245): 437-41). Transcription activator-like (TAL) effector-DNA modifying enzymes (TALEs or TALENs) can be used for genetically engineering the genome of plants, see for example US20110145940, Cermak et al (2011) Nucleic acids sres.39(12) and Boch et al (2009), Science 326 (5959): 1509-12. Plant genome-directed modification can also use bacterial type II CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated protein) systems, see for example Belhaj et al (2013), Plant Methods 9:39.CRISPR/Cas systems can allow for customizable small non-coding RNA-guided targeted cleavage of genomic DNA.

Those skilled in the art are familiar with methods for the development and regeneration of modified plants. The regenerated plant may be self-pollinated to produce a homozygous modified plant, or the pollen of the regenerated plant may be crossed with an agronomically important plant grown from the seed, or the pollen of an agronomically important plant may be crossed with the regenerated transgenic plant. Those skilled in the art are familiar with methods for transforming plants with a gene encoding a desired polypeptide and for growing regenerated plants. The regenerated plant may be self-pollinated to produce a homozygous transgenic plant, or the pollen of the regenerated plant may be crossed with an agronomically important plant grown from the seed, or the pollen of the agronomically important plant may be crossed with the regenerated transgenic plant. Methods for breeding transgenic plants containing a desired polypeptide as disclosed herein are well known to those skilled in the art.

Stacking of traits

A transgenic plant can comprise a stack of one or more root length modulating polynucleotides disclosed herein with one or more additional polynucleotides, resulting in the production or inhibition of multiple polypeptide sequences. The stacked transgenic plants comprising the polynucleotide sequences can be obtained by either or both traditional breeding methods or by genetic engineering methods. These methods include, but are not limited to, breeding separate lines each comprising a polynucleotide of interest, transforming transgenic plants comprising a gene disclosed herein with a subsequent gene, and co-transforming the gene into a single plant cell. As used herein, the term "stacked" includes having two or more traits present in the same plant (e.g., both traits incorporated into the nuclear genome, one trait incorporated into the nuclear genome and one trait incorporated into the genome of a plastid, or both traits incorporated into the genome of a plastid). In one non-limiting example, a "stacking trait" comprises a stack of molecules whose sequences are physically adjacent to each other. A trait as used herein refers to a phenotype derived from a particular sequence or group of sequences. Co-transformation of genes can be performed using a single transformation vector comprising multiple genes or genes carried separately on multiple vectors. If the sequences are stacked by genetically transforming plants, the polynucleotide sequences of interest can be combined at any time and in any order. A trait may be introduced simultaneously with a polynucleotide of interest provided by any combination of transformation cassettes using a co-transformation protocol. For example, if two sequences are to be introduced, the two sequences may be contained in separate transformation cassettes (trans) or in the same transformation cassette (cis). Expression of the sequences may be driven by the same promoter or different promoters. In some cases, it may be desirable to introduce a transformation cassette that inhibits expression of a polynucleotide of interest. This can be combined with any combination of other suppression cassettes or overexpression cassettes to produce the desired combination of traits in the plant. It is also recognized that polynucleotide sequences can be stacked at a desired genomic position using a site-specific recombination system. See, for example, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855, and WO1999/25853, all of which are incorporated herein by reference.

Examples

Specific implementations herein are further illustrated in the following examples. In these examples, degrees centigrade per metric are used unless otherwise indicated. In these examples, specific implementations are illustrated only. From the above discussion and the specific examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other than the various modifications shown and discussed in this patent, modifications made by those skilled in the art without departing from the subject matter of this invention are intended to be within the scope of the claims of this patent.

Example 1 cloning of OsLOGL5 Gene and construction of vector

According to the preliminary screening result of the rice activated tag mutant library and the sequence information of the gene ID LOC _ Os03g64070.1, the cDNA of OsLOGL5 is cloned by using cDNA of leaf, stem and root tissues of Zhonghua 11 rice as a template by adopting a conventional method and the following primers.

5'-CGTCGGCCGTATATATGATGATGGAG-3'(SEQ ID NO:4)

5'-GGGAATTAATATATGGAAGAAATAATTAGCAGC-3'(SEQ ID NO:5)

The length of the PCR amplification product is 851bp, and the PCR amplification product is recovered by a kit after agarose gel electrophoresis and is connected with a TA cloning vector. After sequencing to verify the sequence and ligation orientation in the construct, the gene was cloned into the binary vector DP0158 (pCAMBIA 1300-DsRed). The nucleotide sequence cloned in the DP0600 construct and the coding sequence of OsLOGL5 are shown as SEQ ID NO:1 and 2, the amino acid sequence of OsLOGL5 is shown as SEQ ID NO:3, respectively.

Example 2 transformation to obtain transgenic Rice lines

Overexpression vectors and empty vectors (DP0158) were transformed into rice No. 11, Zhonghua, using the Agrobacterium-mediated method described by forestry champion and Zhang initiative ((2005) Plant Cell Rep.23: 540-547). The rice of Zhonghua No. 11 is a variety cultivated by the crop research institute of Chinese academy of agricultural sciences, and the first seed is provided by the agricultural biological company of Kautuo, Beijing. Transgenic seedlings of T0 generation obtained from a transformation laboratory are transplanted into a paddy field to obtain T1 seeds, and the T1 and T2 generation seeds are stored in a cold storage at 4 ℃. The overexpression vector contains a marker gene, and the transgenic seeds which emit red fluorescence under green fluorescent lamps in T1 and T2 generation seeds are used for the following character verification tests.

Example 3 Gene expression analysis

The expression level of the gene in the transgenic rice plant is analyzed by adopting standard real-time RT-PCR, the EF1 α gene is used as an internal reference to show that the amplification and sample loading quantity of the transgenic rice and a control plant are similar, and the gene expression quantity is determined by taking the EF1 α mRNA level as a reference.

The level of OsLOGL5 gene expression in DP0600 rice plants was determined using the following primers, the level of gene expression in ZH11-TC rice was set to 1.00, and the OsLOGL5 gene was overexpressed in all tested transgenic lines, with a floating range of gene expression in transgenic rice seedlings between 3-77 times compared to ZH 11-TC. The expression levels in DP0600.09 and DP0600.14 rice seedlings were lower than those of other transgenic rice seedlings.

DP0600-F1：5’-CTCTGCAAGCTCGAGGAATAC-3’(SEQ ID NO：6)

DP0600-R1：5’-GAGTAGATGCTTCCGGCG-3’(SEQ ID NO：7)

Example 4 visible phenotype of OsLOGL5 transgenic Rice seedlings

1. Visible phenotype of OsLOGL5 transgenic rice seedling root under laboratory conditions

OsLOGL5 transgenic rice seeds and ZH11-TC and DP0158 seeds were first sterilized and germinated under normal conditions. The germinated seeds were placed in tubes with holes in the bottom, hydroponically cultured in the laboratory at 30 ℃ for 5 days, then cultured in Hoagland's nutrient solution for 9 days, 20 uniform seedlings were selected, and the root length and number were determined. Root length refers to the length from the base of the seed to the top of the longest root, and the number of roots includes roots greater than 1cm in length.

As shown in Table 1 and FIG. 2, 8 transgenic lines showed significantly shorter roots compared to the ZH11-TC and DP0158 seedlings, and the other two lines showed lower expression levels of the OsLOGL5 gene, showing root lengths similar to the control. As shown in Table 2, the number of roots of the transgenic rice plants was similar to that of seedlings of ZH11-TC, and there were no more seedlings of DP 0158.

In order to investigate the reason why the root length of OsLOGL5 transgenic rice seedlings is shorter than that of ZH11-TC and DP0158 seedlings, the germination of seeds was observed, and OsLOGL5 transgenic seeds normally germinate with ZH11-TC and DP0158 seeds, which eliminated the reason why the root phenotype is affected by seed vigor.

The above results indicate that the expression level of OsLOGL5 gene is inversely related to root length.

TABLE 1 root length of OsLOGL5 transgenic rice plants under laboratory conditions

TABLE 2 root number of OsLOGL5 transgenic rice plants under laboratory conditions

2. Visible phenotype of seedlings of OsLOGL5 transgenic rice planted in greenhouse

In the greenhouse, 10 OsLOGL5 transgenic lines, ZH11-TC and DP0158 seedlings were tested as controls. The germinated seeds were planted in small pots containing vermiculite and hydroponically cultured. When the rice seedlings grow to the 3-leaf stage, the low-nitrogen solution replaces water to provide nutrition for the plants. After 32 days of low nitrogen solution culture, at the construct level, the OsLOGL5 transgenic line showed significantly less mean tillering number, lower mean SPAD value and fresh weight compared to ZH11-TC and DP0158 seedlings; the average tillering number and fresh weight of 8 lines were significantly lower than that of ZH11-TC and DP0158 seedlings. These results indicate that OsLOGL5 transgenic rice has less tiller number and fresh weight at seedling stage.

TABLE 3 Low Nitrogen test of OsLOGL5 transgenic rice plants under greenhouse low nitrogen conditions (ZH11-TC as control)

TABLE 4 Low Nitrogen testing of OsLOGL5 transgenic rice plants under greenhouse low nitrogen conditions (DP0158 as control)

4 OsLOGL5 transgenic rice plants were selected for observing root phenotype in vermiculite, as shown in FIG. 3, DP0600.05 and DP0600.07 rice plants with higher OsLOGL5 gene expression level showed fewer roots, and DP0600.09 and DP0600.14 rice plants with lower OsLOGL5 gene expression level were similar to DP0158 rice plants.

3. Visible phenotype of OsLOGL5 gene transgenic rice plant planted in rice field

10 OsLOGL5 transgenic rice lines were planted in the rice field for seed harvest, the rice plants were normally managed and applied with insecticide and fertilizer, and 8 transgenic lines showed a narrow leaf and few tillers phenotype.

Example 5 OsLOGL5 transgenic Rice plantsPerformance of the greenhouse

Two rice transgenic lines (DP0600.09 and DP0600.14) with a low OsLOGL5 gene expression level and one rice transgenic line (DP0600.07) with a high OsLOGL5 gene expression level were selected and planted in soil in a small pot diameter of about 35cm, and ZH-TC rice plants were used as controls. These rice plants were normally managed, applied with insecticides and fertilizers, and before harvest, SPAD values and tillering numbers were measured. And when the rice plant is mature, measuring the effective spike number, the grain yield, the dry weight of the root and the dry weight of the straw. As shown in Table 5, OsLOGL5 transgenic rice plants showed a SPAD value similar to that of ZH11-TC rice plants; compared with ZH11-TC, DP0600.07 rice plant with higher OsLOGL5 gene expression level showed less tillering number, while the other two transgenic rice lines showed more tillering number. The effective spike number, grain yield, root dry weight and straw dry weight of DP0600.09 and DP0600.14 rice plants are more than those of ZH11-TC rice plants; the effective spike number, grain yield, root dry weight and straw dry weight of DP0600.07 with high OsLOGL5 gene expression level are less than those of ZH11-TC rice plants.

TABLE 5 expression of OsLOGL5 transgenic rice plants

Example 6 field drought test of mature transgenic Rice plants

Drought stress during flowering is a serious problem in agricultural production. Transgenic rice plants were verified under field drought conditions. In a field drought test of mature rice plants, 10 transgenic lines were selected for each gene construct. The seeds of T2 generation are first disinfected, the germinated seeds are planted on the field seedbed, the rice seedlings are transplanted to the field test field in the three-leaf period, four repeats are set, each repeat has 10 seedlings of each transgenic line, and the four repeats are planted in the same field. In the same plot, ZH11-TC and DP0158 planted adjacent to the transgenic lines were used as controls in the statistical analysis.

The rice plants are normally managed, corresponding pesticides and fertilizers are used, watering is stopped in the ear differentiation period, so drought stress is generated in the flowering period, and the drought time depends on weather conditions such as temperature, humidity and the like. During drought, the relative water content of the soil was measured every four days at 10 sites per plot using TDR30(Spectrum Technologies, Inc.).

In the test process, plant phenotypes are observed and recorded, wherein the plant phenotypes mainly comprise heading period, leaf rolling degree, drought sensitivity and drought resistance, and particularly concern the leaf rolling degree of plants in the middle of the noon. At the end of the planting season, approximately 6 representative plants were selected for each line and harvested, and the weight of each rice kernel was weighed and statistically analyzed using a mixed linear model (mixedinear model). When P is less than 0.1, the transgenic plant is considered as a positive strain, and the gene has the function of improving drought resistance.

Field drought verification result of OsLOGL5(DP0600) transgenic rice

10 OsLOGL5 transgenic rice plants were tested in the Hainan field, and ZH11-TC and DP0158 rice plants were planted close together and used as controls. The main stem spike is in the young spike differentiation stage IV-V, and the tillering spike is in the young spike differentiation stage II, and the watering is stopped. During the heading and the maturation process, the volume water content of the soil is reduced from 20 percent to 5 percent. And 49 days after water cut off, the main stem and the ear are in the milk stage, and the rice plant has a leaf rolling phenotype.

Grain yield analysis shows that the yield of single-plant grains of OsLOGL5 transgenic rice is obviously lower than that of ZH11-TC and DP0158 control on the level of a construct; the yield per grain of all 10 OsLOGL5 transgenic lines was significantly lower than that of ZH11-TC and DP0158 control plants (table 6), with relatively high yield per grain of DP0600.05, DP0600.09 and DP0600.14 rice plants.

TABLE 6 analysis of grain yield of OsLOGL5 transgenic rice plants under field drought conditions (first trial)

The same 10 OsLOGL5 transgenic rice lines were again verified in Ningxia field, and watering was stopped from the main shoot to young shoot differentiation stage I. 27 days after water cut, the main stem ear reaches the young ear differentiation VII-VIII stage, the tillering ear reaches the young ear differentiation VI-VII stage, and the rice plant has a leaf rolling phenotype. And after 37 days of water cut, 50 percent of young ears are spilt. During the heading process, the volume water content of the soil is reduced from 45 percent to 15 percent.

Grain yield analysis shows that the yield of single-plant grains of OsLOGL5 transgenic rice is obviously lower than that of ZH11-TC and DP0158 control on the level of a construct; the yield per grain of all 10 OsLOGL5 transgenic lines was significantly lower than that of ZH11-TC and DP0158 control plants (table 7), and as such, the yield per grain of DP0600.05, DP0600.09 and DP0600.14 rice plants was relatively high. These results indicate that OsLOGL5 transgenic rice plants have poor drought tolerance and that the yield of individual grains is reduced after drought stress.

TABLE 7 analysis of grain yield of OsLOGL5 transgenic rice plants under field drought conditions (second trial)

Example 7 laboratory Paraquat test of transgenic Rice plants

Paraquat (1, 1-dimethyl-4, 4-bipyridyl dichloride) is a nonselective pyridine herbicide sprayed on leaves, is a herbicide widely applied in the world, and can control weeds growing in a large number of crops such as corn, rice, soybean and the like. In plant cells, paraquat is mainly targeted to chloroplasts, and generates peroxides and hydrogen peroxide by accepting electrons from photosystem I and then chemically reacting with oxygen, and the peroxides and hydrogen peroxide can cause photooxidative stress. Drought stress often results in the production of Reactive Oxygen Species (ROS) in plants, and sometimes drought tolerance of plants is associated with enhanced reactive oxygen species resistance. Paraquat is a powerful inducer of oxidative stress, and can greatly increase the production of Reactive Oxygen Species (ROS) while inhibiting the regeneration of reductants and compounds required for the activity of the antioxidant system. Abiotic stress increases ROS production, while plant response tolerance to death ranges depending on the strength of the stress and the ROS levels associated therewith. Relatively low levels of paraquat are able to mimic stress-related ROS production and are used as markers for stress tolerance in plant stress biology (Hasaneen m.n.a. (2012) Herbicide-Properties, Synthesis and Control of Weeds book). Therefore, transgenic rice was further verified using paraquat.

Paraquat test method:

10 transgenic lines of rice per vector were selected for paraquat test, and flower 11(ZH11-TC) and the empty vector control DP0158 were used as controls in the tissue culture. T2 seed generation was disinfected and germinated according to conventional methods. Paraquat tests were conducted in a growth chamber at a temperature of 28-30 deg.C and a humidity of 30%. Placing the germinated seeds in a centrifuge tube with a hole at the bottom, and culturing for 5 days by adopting a rice water culture method until the period of one leaf and one heart; then uniform seedlings with a height of about 3.5-4 cm were selected for paraquat testing. The experiment adopts a random block design, and 5 blocks are arranged in the same screening water tank; the block contained all 10 transgenic lines tested, ZH11-TC, and DP 0158; blocks were ranked 16 x 12, one test material per row, so that each transgenic line was 12 lines each in the block, and controls ZH11-TC and DP0158 were 3 lines each in the block; all transgenic lines and controls within the block were randomly arranged. Seedlings were treated with paraquat solution at a final concentration of 0.8 μ M for 7 days with a photoperiod of 10h dark/14 h light, the solution was changed every two days, after treatment and solution change, ensuring that the seedlings first entered the dark phase of the photoperiod. After 7 days of treatment, green seedlings were counted. The green undamaged seedlings are paraquat-resistant seedlings; the seedlings with the leaves and stems being whitened and faded are non-paraquat-resistant seedlings.

The tolerance rate is an index of paraquat test and means the number of seedlings which remain green and show paraquat tolerant phenotype divided by the percentage of the total number of seedlings.

The test data are analyzed at the carrier level (all transgenic seedlings are compared with the control seedlings) and the transgenic line level (different transgenic lines are compared with the control seedlings), the adopted statistical model is ' Y-seg + line ' (seg) + rep + error ', the random effect is ' rep ', and the statistical method is "

PROC GLIMMIX”。

Paraquat verification result of OsLOGL5(DP0600) transgenic rice

In the first experiment, after the paraquat solution is treated for 7 days, 487 strains among 600 OsLOGL5 transgenic seedlings keep green and show a paraquat resistance phenotype; whereas 52 of 180 ZH11-TC seedlings had a paraquat-resistant phenotype; of the 180 DP0158 seedlings, 89 showed a paraquat-resistant phenotype. At the vector level, the tolerance rate of the OsLOGL5 transgenic seedlings tested was significantly higher than that of the ZH11-TC and DP0158 controls.

Further analysis at the transgenic line level showed that the 9 OsLOGL5 transgenic lines had higher rates of paraquat resistance than the ZH11-TC control and the DP0158 control, and that the 8 lines had significantly higher rates of paraquat resistance than the ZH11-TC and DP0158 controls (table 8). These results indicate that OsLOGL5 transgenic rice increased seedling paraquat tolerance at both vector and transgenic line levels and that OsLOGL5 plays a role in increasing transgenic plant paraquat tolerance or antioxidant capacity compared to ZH11-TC and DP0158 rice plants.

TABLE 8 paraquat tolerance test (first test) of OsLOGL5 transgenic rice plants

In the second trial, the same 10 OsLOGL5 transgenic lines were tested, and after 7 days, 501 of 600 OsLOGL5 transgenic seedlings remained green and showed paraquat-tolerant phenotype; 113 of 180 ZH11-TC seedlings had a paraquat-resistant phenotype; of the 180 DP0158 seedlings, 72 showed a paraquat-resistant phenotype. At the vector level, the tolerance rate of the OsLOGL5 transgenic seedlings tested was significantly higher than that of the ZH11-TC and DP0158 controls.

Further analysis at the transgenic line level showed that the paraquat tolerance rate of 7 OsLOGL5 transgenic lines was significantly higher than ZH11-TC control and that 9 lines were significantly higher than DP0158 control (table 9). These results further indicate that OsLOGL5 plays a role in increasing the tolerance or antioxidant capacity of transgenic plants to paraquat.

TABLE 9 paraquat tolerance test (second test) of OsLOGL5 transgenic rice plants

Example 8 field Low Nitrogen utilization test of mature transgenic Rice plants

The field low nitrogen resistance test is carried out in Beijing. Two nitrogen levels were set: n-0 (nitrogen-free fertilizer) and N-1 (normal fertilizer determined by soil nitrogen content). Seed germination and seedling culture were as described in example 4. Germinating seeds are planted in a field seedbed, seedlings are transplanted into a test field in a three-leaf period, the three-leaf period is repeated for 4 times, 10 plants are repeatedly planted in each transgenic line, and 4 plants are repeatedly planted in the same field block. ZH11-TC and DP0158 plants from adjacent transgenic lines in the same field were used as controls and used for statistical analysis.

The rice plant is normally managed, corresponding insecticide is used, phosphate fertilizer and potash fertilizer are applied in N-0 treatment, and normal fertilizer is applied in N-1 treatment.

At the end of the growing season, six representative plants were harvested in between each transgenic line of each row of material. Plant height and grain weight data were statistically analyzed using a mixed linear model of the ASReml software. Positive transgenic lines were selected based on the analysis (P < 0.1).

Results of field NUE verification of OsLOGL5(DP0600) transgenic rice

As shown in table 10, grain yield of OsLOGL5 transgenic rice was 17.30g per plant at the construct level under low nitrogen conditions, significantly lower than ZH11-TC and DP0158 controls; the yield of individual grain was significantly lower for all 12 lines than for the ZH11-TC and DP0158 controls.

As shown in table 11, grain yield of OsLOGL5 transgenic rice was significantly lower than ZH11-TC and DP0158 controls at the construct level under normal nitrogen conditions; the individual grain yields of 7 lines were significantly lower than ZH11-TC and DP0158, with individual grain yields of DP0600.05, DP0600.07 and DP0600.14 rice plants being higher or close to ZH11-TC and DP0158 controls.

TABLE 10 analysis of grain yield of OsLOGL5 transgenic rice under low nitrogen conditions in the field

TABLE 11 analysis of grain yield of OsLOGL5 transgenic rice under normal nitrogen conditions in the field

Example 9 construction of RNAi and CRISPR/Cas9 constructs

To investigate whether reducing the expression level of the OsLOGL5 gene or inactivating the OsLOGL5 polypeptide altered gene function, RNAi and CRISPR/Cas9 constructs were constructed.

Design of sgRNA sequences

Analysis of the target genomic sequence using available tools yields candidate sgRNA sequences, which can also be generated by other web tools including, but not limited to, the websites http:// cbi. hzau. edu. cn/criprpr/and online CRISPR-PLANT.

In the present application, the OsLOGL5 promoter and gene sequences (SEQ ID NO: 8and SEQ ID NO:1) were imported into the website: http:// cbi. hzau. edu. cn/criprpr/, multiple sgRNA sequences were generated, OsLOGL5 promoter and gene sequences including promoter, exon, intron 5 '-UTR and 3' -UTR. 22 sgRNA sequences are selected, the distribution of the sgRNA sequences on the OsLOGL5 promoter and gene sequence is shown in fig. 4, and the sgRNA sequences are shown in the sequence SEQ ID NO: 14-35.

Construction of OsLOGL5 gene CRIPSR-Cas construct

In the CRIPSR-Cas9 construct, the maize Ubi promoter (SEQ ID NO: 9) drives the optimized Cas9 protein coding sequence (SEQ ID NO: 10), the CaMV35S 3' -UTR (SEQ ID NO: 11) increases the expression level of the Cas9 protein, and the rice U6 promoter (SEQ ID NO: 12) drives the expression of gRNAs (gRNA backbone, SEQ ID NO: 13).

A single sgRNA can be used to construct a genome editing construct (fig. 5), the sgRNA selected from any region including a promoter, exon, intron, and UTR. A single sgRNA can direct Cas9 enzyme localization to a target region, generate a double strand break on the target DNA sequence, initiate non-homologous end joining (NHEJ) repair mechanisms and homology-mediated repair (HDR), typically inducing random insertions, deletions and substitutions at the target site. For example, the editing may remove an expression element from the promoter region of the OsLOGL5 gene, thereby reducing mRNA levels, or the editing in the coding region results in a change in the structure of the OsLOGL5 polypeptide and thereby reduces OsLOGL5 protein activity.

Two sgRNAs can also be used to construct a genome editing construct (fig. 6), two or more sgRNAs being selected from the group consisting of promoter, exon, intron, and gene fragment region of UTR. The constructs can trigger fragment deletions, point mutations (insertion, deletion and substitution of a small number of bases).

Table 12 shows the primer sequences, target positions and specific strands. The DP3035 and DP3036 constructs comprised one sgRNA, the target primers were first annealed to form short double-stranded fragments, which were then inserted into pHSG396GW-URS-UC-mpCas9& U6-DsRed vector (VK 005-01 modified vector, purchased from Beijing Virginia Retz Biotech).

The elements of the pHSG396GW-URS-UC-mpCas9& U6-DsRed cloning vector are detailed in SEQ ID NO: 9. SEQ ID NO: 10. SEQ ID NO: 11. SEQ ID NO: 12 and SEQ ID NO: 13. after determining the nucleotide sequence of the gRNA fragment, the gRNA fragment was ligated into an expression vector PCAMBIA1300DsRed-GW-adv. For constructs containing two sgrnas, different primers first anneal to form a double-stranded fragment, then the two gRNA fragments are fused and inserted into a cloning vector, followed by insertion into an expression vector to form DP 3043. The predicted cleavage sites can be seen in FIG. 4.

Sgrna(s) in DP3035, DP3036 and DP3043 constructs target genomic regions containing the OsLOGL5 gene.

TABLE 12 primers for construction of CRISPR/Cas9 constructs edited by the OsLOGL5 gene

Construction of RNAi constructs

As set forth in SEQ ID NO:1 as a template, forward and reverse cDNA fragments were cloned using the primers listed in Table 13, and then the forward cDNA fragment (SEQ ID NO:37), intron (SEQ ID NO:36) and reverse cDNA fragment were ligated and ligated to the TA vector. After sequencing and orientation in the construct, the RNAi construct fragment (forward cDNA-intron-reverse cDNA) was cloned into the plant binary construct DP0158 to obtain the RNAi construct DP 3047.

TABLE 13 cloning of primers for construction of RNAi construct fragments

Example 10 transformation to obtain modified Rice plants

CRIPSR-Cas9 construct and RNAi construct of OsLOGL5 gene were transformed into rice, Zhonghua No. 11, using the Agrobacterium-mediated method described by Lin champion and Zhang-inspired ((2005) Plant Cell Rep.23: 540-547). Transgenic seedlings of T0 generation obtained by a transformation laboratory are verified by PCR and sequencing and then transplanted into paddy field to obtain T1 seeds, and the T1 and T2 generation seeds are stored in a cold storage at 4 ℃.

Example 11 determination of OsLOGL5 Gene modification and cleavage sites in Rice plants

The genome DNA of the transformed seedling is used as a template, and a primer is designed to amplify a target sequence near the genome editing site. The amplified target sequences were sequenced to determine the editing results, see in particular fig. 7, 8and 9. Modifications such as insertion, deletion or substitution of at least one nucleotide resulting from genome editing can result in premature termination, translational frameshifting and/or deletion of at least one amino acid residue of the coding sequence.

As shown in FIG. 7, 15 types of mutations were generated at the expected site of the rice plant DP3035 (Zhonghua 11), wherein 1 nucleotide was inserted into the expected sites of the mutation types 1, 2 and 4, and 3n +2(n is an integer of 0 or more) nucleotides were deleted at the expected sites of the mutation types 8, 9, 12 or 13, resulting in a translational frameshift, and the predicted translation was not terminated at the original terminator; deletion of 3n +1(n is an integer of 0 or more) nucleotides at the expected site of mutation type 3, 6,7, 14 or 15, resulting in translational frameshift, predicted translation not terminating at the original terminator; deletion of 3n nucleotides at the expected sites of mutation type 5, 10 or 11 resulted in deletion of 2, 8and 11 amino acid residues, respectively, in the predicted polypeptide.

As shown in FIG. 8, 10 types of mutations were generated at the expected site of the DP3036 (Zhonghua 11) rice plant, in which 1 nucleotide was inserted into the expected sites of mutation types 2, 5, 8and 10, resulting in translational frameshift, but translation was not terminated at the original terminator; a2 nucleotide insertion or a 3n +1(n is an integer equal to or greater than 0) nucleotide deletion at the expected site of mutation type 1, 6,7 or 9, resulting in a translational frameshift, the predicted translation not terminating at the original terminator; mutations of mutation types 3 and 4 lead to premature termination of ORF reading frame translation and result in 223 amino acids.

As shown in FIG. 9, 19 types of mutations were generated at the expected site in the rice plant DP3043 (Zhonghua 11), wherein the mutation of mutation type 3, 9, 11, 15 or 18 resulted in the termination of translation at the original terminator or the premature termination of translation, so that the translated polypeptide had some amino acid residues deleted from the C-terminus; mutations of other translation types result in translational frameshifts, but do not terminate at the original termination.

Mutations in DP3035, DP3036 and DP3043 rice plants result in translational frameshifts, modifying the transcribed mRNA or the translated polypeptide, further affecting the length and activity of the translated polypeptide.

Rice plants homozygous for genome editing were used for subsequent functional testing.

Example 12 modification of the visible phenotype of Rice plants with the OsLOGL5 Gene

Editing root-visible phenotype of Rice seedlings with the OsLOGL5 Gene

Gene-edited rice seeds and ZH11-TC and DP0158 seeds were first sterilized, germinated under normal conditions, the germinated seeds were hydroponically cultured at 30 ℃ for 18 days, and then the root length and the number of roots were determined.

As shown in table 14, the two lines (DP0600.07.01 and DP0600.12.01) with high OsLOGL5 gene expression levels showed significantly shorter roots compared to ZH11-TC and DP0158 seedlings; two lines (DP0600.09.01 and DP0600.14.02) with low OsLOGL5 gene expression levels showed longer root lengths; the roots of 3 CRISPR-Cas construct modified rice plants and RNAi construct rice plants were longer or similar to controls.

As shown in Table 15, two lines (DP0600.07.01 and DP0600.12.01) with high OsLOGL5 gene expression level showed more number of roots and two lines (DP0600.09.01 and DP0600.14.02) with low OsLOGL5 gene expression level showed less number of roots compared to ZH11-TC and DP0158 seedlings; rice plants of CRISPR-Cas and RNAi constructs showed fewer or similar numbers of roots to controls.

The above results indicate that the expression level of OsLOGL5 gene is inversely correlated with the root length.

TABLE 14 modification of root length of Rice seedlings by OsLOGL5 Gene

TABLE 15 root number of OsLOGL5 Gene-modified Rice plants

Example 13 kernels of OsLOGL5 modified Rice plants under Normal watering conditionsYield of the product

Planting the rice modified by the OsLOGL5 gene homozygous for the genome editing of the T1 generation in a rice field for harvesting T2 seeds, normally irrigating rice plants, and measuring the effective spike number and the yield of single-plant seeds; genome editing negative rice plants (transformed but with wild-type genes, i.e., non-mutated genes, negative) were planted next to and used as controls. Throughout the entire growth period, OsLOGL5 gene-modified rice plants showed no visible above-ground phenotype.

As shown in table 16, the effective spike number of DP3035 rice plants was slightly less than that of negative rice plants with gene editing; the single-plant seed yield of 5 genome-edited lines is higher than that of the edited negative rice plant; the yield of the seeds of the individual plants of the 4 lines is less than that of the rice plants negative in gene editing. The mutation types of the OsLOGL5 genome editing rice plant (DP3035) belong to mutation types 1 and 2 in FIG. 7.

TABLE 16 analysis of effective panicle number and kernel yield of T1 generation OsLOGL5 modified rice plant (DP3035) under normal irrigation conditions

As shown in table 17, the effective spike number of 5 DP3036 rice lines was greater than that of the negative rice plants of the gene editing; the yield of single grain of all 11 genome-edited lines was higher than that of editing-negative rice plants. The mutation types of the OsLOGL5 genome editing rice plant (DP3036) belong to mutation types 1, 2 and 5 in FIG. 8.

TABLE 17 analysis of effective spike number and kernel yield of T1 OsLOGL5 modified rice plant (DP3036) under normal irrigation conditions

As shown in table 18, the effective panicle number of DP3043 rice plants was about the same as that of the gene-editing negative rice plants; the single grain yield of all 5 DP03043 genome-edited lines was higher than that of two gene-edited negative rice plants. The mutation types of the OsLOGL5 genome editing rice plant (DP3043) belong to mutation types 1, 2 and 3 in FIG. 9.

TABLE 18 analysis of effective panicle number and grain yield of OsLOGL5 modified rice plants (DP3043) of T1 generation under normal irrigation conditions

Grain yield was again tested for OsLOGL5 modified rice plants of the T2 generation, and genome editing negative rice plants were grown adjacent and used as controls. Normally irrigating rice plants, and measuring the effective spike number and the yield of single-plant grains; throughout the entire growth period, OsLOGL5 gene-modified rice plants showed no visible above-ground phenotype.

As shown in table 19, at the construct level, the yield of individual grain of DP3035 rice plants was significantly higher than that of negative rice plants with genome editing; the yield of the individual grain of all tested strains DP3035 was higher than the control.

TABLE 19 analysis of kernel yield under normal watering conditions for T2 OsLOGL5 modified rice plants (DP3035)

As shown in table 20, at the construct level, the yield of individual grain of DP3036 rice plants was significantly higher than that of negative rice plants with genome editing; the yield of the single grain of most of the DP3036 strains tested was higher than that of the control.

TABLE 20 kernel yield analysis of OsLOGL5 modified rice plants (DP3036) from T2 generations under normal watering conditions

As shown in table 21, at the construct level, the yield of individual grain of DP3043 rice plants was significantly higher than that of negative rice plants with genome editing; the yield of the individual grains of all tested strains DP3043 is higher than the control.

TABLE 21 analysis of kernel yield of OsLOGL5 modified rice plants (DP3043) of the T2 generation under normal watering conditions

Example 14 field drought test of OsLOGL5 modified Rice plants

OsLOGL5 genome editing rice (DP3025, DP3036 and DP3043) and OsLOGL5 inhibition rice plants (DP3047) were tested in the field to verify whether inactivation of OsLOGL5 polypeptide or reduction of OsLOGL5 gene expression would increase drought tolerance in rice plants, DP0158 rice plants and genome editing negative rice plants were planted in close proximity and used as controls. And stopping watering when the main stem spike is in the young spike differentiation stage II, and slowly reducing the volume water content of the soil from 36% to 20%. 32 days after water cut, the rice plants are in the heading stage; 35 days after water cut, rice plants developed a drought stress phenotype such as leaf rolling.

As shown in table 22, at the construct level, the yield per plant of DP3035 rice plants was significantly higher than DP0158 and the genome editing negative control, and the yield per plant kernel was greater for all DP3035 strains tested than the control.

TABLE 22 kernel yield analysis of OsLOGL5 modified rice plants (DP3035) under field drought conditions

Table 23 shows that at the construct level, the yield per plant of DP3036 rice plants was significantly higher than DP0158 and the genome editing negative control, and that kernel yield per plant of nearly all DP3036 strains tested was higher than DP0158 and the negative control.

TABLE 23 analysis of kernel yield of OsLOGL5 modified rice plants (DP3036) under field drought conditions

Table 24 shows that at the construct level, the yield per plant of DP3043 rice plants was significantly higher than DP0158 and the genome editing negative control, and the yield per plant grain was higher for all DP3043 lines tested than for DP0158 and the negative control.

TABLE 24 kernel yield analysis of OsLOGL5 modified rice plants (DP3043) under field drought conditions

Testing 6 OsLOGL5 inhibition strains (DP3047), wherein the yield of each seed of a DP3047 rice plant is higher than that of DP0158 and negative control of genome editing on the level of a construct; the yield of single-plant grains of 5 DP3047 rice lines is higher.

TABLE 25 analysis of kernel yield of OsLOGL5 inhibited rice plants (DP3047) under field drought conditions

These results indicate that OsLOGL5 modified rice plants improve drought tolerance, and that inactivation of OsLOGL5 polypeptide or reduction of OsLOGL5 gene expression level through CRISPR/Cas technology can increase drought tolerance.

Sequence listing

<110> Ming Bio-agriculture group Co., Ltd

Pioneer overseas Co Ltd

<120> root length regulatory gene LOGL5, corresponding construct and application thereof

<130>RTS22593M

<160>88

<170>PatentIn version 3.5

<210>1

<211>851

<212>DNA

<213> Rice

<400>1

cgtcggccgt atatatgatg atggagaata gcagggagca gcagccggag tcgtcgccgg 60

cgaacaacaa tagcaagaag aagaagaaga agaagacggc gtcgcggttc cggcgtgtgt 120

gcgtgttctg cggcagcagc cccgggaaga aggcgtcgta ccaggtggcc gccgtgcagc 180

tggggcagca gctggtggag cgcggcatcg acctggtgta cggcggcggc agcgttgggc 240

tgatggggct ggtgtcccgc gccgtccacg gaggcggcgg gcacgtggtg ggcgtggtgc 300

ccaatggcgt gctgccacgc gagctgatcg gcgagacgct gggggaggtg agggcggtgg 360

gaagcatgca ccagcggaag gcggagatgg cgcgggagtc ggacgccttc atcgccctcc 420

ccggcggcta cggcacgctg gaggagctcc tcgaggtcat cacctgggct cagctccgca 480

tccaccacaa gcccgtcggc ctcctcaacg tcgacggcta ctacgactcc ctgctcgcct 540

tcatcgacaa ggccgtccac gaaggcttcg tctcgccgcc cgcccgccgc atcatcgtcg 600

ccgcacccac cgcctccgac ctgctctgca agctcgagga atacgtgccg ccgccgcacg 660

acgccaccgc cctgaagctc acctgggaga tgtccaccgt atcggagcag cacgccggaa 720

gcatctactc ccccaagccc gacatggcac gctagctagc tagctagcta ctcgatccac 780

ttcattatta cttatcttgt ttcttctcat ataatcttgc tgctaattat ttcttccata 840

tattaattcc c 851

<210>2

<211>741

<212>DNA

<213> Rice

<400>2

atgatgatgg agaatagcag ggagcagcag ccggagtcgt cgccggcgaa caacaatagc 60

aagaagaaga agaagaagaa gacggcgtcg cggttccggc gtgtgtgcgt gttctgcggc 120

agcagccccg ggaagaaggc gtcgtaccag gtggccgccg tgcagctggg gcagcagctg 180

gtggagcgcg gcatcgacct ggtgtacggc ggcggcagcg ttgggctgat ggggctggtg 240

tcccgcgccg tccacggagg cggcgggcac gtggtgggcg tggtgcccaa tggcgtgctg 300

ccacgcgagc tgatcggcga gacgctgggg gaggtgaggg cggtgggaag catgcaccag 360

cggaaggcgg agatggcgcg ggagtcggac gccttcatcg ccctccccgg cggctacggc 420

acgctggagg agctcctcga ggtcatcacc tgggctcagc tccgcatcca ccacaagccc 480

gtcggcctcc tcaacgtcga cggctactac gactccctgc tcgccttcat cgacaaggcc 540

gtccacgaag gcttcgtctc gccgcccgcc cgccgcatca tcgtcgccgc acccaccgcc 600

tccgacctgc tctgcaagct cgaggaatac gtgccgccgc cgcacgacgc caccgccctg 660

aagctcacct gggagatgtc caccgtatcg gagcagcacg ccggaagcat ctactccccc 720

aagcccgaca tggcacgcta g 741

<210>3

<211>246

<212>PRT

<213> Rice

<400>3

Met Met Met Glu Asn Ser Arg Glu Gln Gln Pro Glu Ser Ser Pro Ala

1 5 10 15

Asn Asn Asn Ser Lys Lys Lys Lys Lys Lys Lys Thr Ala Ser Arg Phe

20 25 30

Arg Arg Val Cys Val Phe Cys Gly Ser Ser Pro Gly Lys Lys Ala Ser

35 40 45

Tyr Gln Val Ala Ala Val Gln Leu Gly Gln Gln Leu Val Glu Arg Gly

50 55 60

Ile Asp Leu Val Tyr Gly Gly Gly Ser Val Gly Leu Met Gly Leu Val

65 70 75 80

Ser Arg Ala Val His Gly Gly Gly Gly His Val Val Gly Val Val Pro

85 90 95

Asn Gly Val Leu Pro Arg Glu Leu Ile Gly Glu Thr Leu Gly Glu Val

100 105 110

Arg Ala Val Gly Ser Met His Gln Arg Lys Ala Glu Met Ala Arg Glu

115 120 125

Ser Asp Ala Phe Ile Ala Leu Pro Gly Gly Tyr Gly Thr Leu Glu Glu

130 135 140

Leu Leu Glu Val Ile Thr Trp Ala Gln Leu Arg Ile His His Lys Pro

145 150 155 160

Val Gly Leu Leu Asn Val Asp Gly Tyr Tyr Asp Ser Leu Leu Ala Phe

165 170 175

Ile Asp Lys Ala Val His Glu Gly Phe Val Ser Pro Pro Ala Arg Arg

180 185 190

Ile Ile Val Ala Ala Pro Thr Ala Ser Asp Leu Leu Cys Lys Leu Glu

195 200 205

Glu Tyr Val Pro Pro Pro His Asp Ala Thr Ala Leu Lys Leu Thr Trp

210 215 220

Glu Met Ser Thr Val Ser Glu Gln His Ala Gly Ser Ile Tyr Ser Pro

225 230 235 240

Lys Pro Asp Met Ala Arg

245

<210>4

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223> Forward primer for cloning OsLOG5 Gene cDNA sequence

<400>4

cgtcggccgt atatatgatg atggag 26

<210>5

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> reverse primer for cloning OsLOG5 gene cDNA sequence

<400>5

gggaattaat atatggaaga aataattagc agc 33

<210>6

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> forward primer for real-time RT-PCR analysis of OsLOG5 gene

<400>6

ctctgcaagc tcgaggaata c 21

<210>7

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> reverse primer for real-time RT-PCR analysis of OsLOG5 gene

<400>7

gagtagatgc ttccggcg 18

<210>8

<211>2656

<212>DNA

<213> Rice

<400>8

ggcgccggtg gaccgggctc acctcgcgtg gtcccgagtg ggacccgctt gtcagcggct 60

cggctcaccg tgcggaggga gcacgcggcg cacgcgcgtg ggcgggggag ggatgcggtg 120

cacgcgcgcg gttcgcggtg gaacggatgc ggcgggccca cgcgcagcct cacggctcgc 180

ggtggaacgc gcgcacgggg aggggctgac cggggtcaat tcgacccggc cttggccgag 240

cttgcgccga cgtggcgcct acgtggctgc cacgcgggcc ggcgggaggt agacgacgac 300

gccggccgga acgaacggcg gacgacagcg gcgagcggcg gagcgaacca cggcgatata 360

ggcgaaagcg agcacaccgg gtggttgcac gagacgaggg gagacgagcc aacggctcgg 420

attcgccgga gggagcttga cggcggcgaa tcgcggcggc ggcaaccggc ggcgggagga 480

ggggaaaacg gcgacgaggt cacaaggggc cgattcctgg cggcgagagc atctacgcgg 540

ctacgggaat ccgatgctag cgttggatta ggaggaaacg catcgaggga ggccggcgac 600

gagaggcgct tccgagctcg ggcagcgaca gcggcgagca catggcgagc ggcggcaacg 660

gtcggggcgg cgccggctag ctacggggag gctactcgtg ctactacccg agtctaaggg 720

gaggagatgg agcgaggagg gagaacggag ggatgcacta ccgtgcgggc ggggcgcagt 780

gacgagaggc cgacggcgcg ggagtaatct ctccggcctc gggccgggga agaggaagga 840

gagggcgcgc ccggagtccc cttccgcgtc cttgctcgtg ccggctcctc cgacacgcgc 900

aacgacgaaa ggcgacggcg aacagagcac gggaggcggc ggcaatggcg tggaggcgaa 960

cgggagagga aaggaaaggg ggaagcttag gtttataggg gcggcaatgt cagtttggga 1020

gaggggaacc gacattggac ggtcaagccg acgagctggc gctccggcta gcggccaaaa 1080

cggcgacagg aggtgacgcc ggcgagaggg aaaaaggaag aaaagggggg agagaaaggg 1140

ggcttgtccc ttgcctcttc gggaaaagga ggggggagcg gggcgacgcg gcagagggag 1200

gagggactct gcctccgccc cttggaggct agcgcgcgga gtggcggggc cgaggcgatg 1260

atgacggcgg ggcggtgtgg agcggagcgg cgacacgggc gacaggcgcg agcaggcgct 1320

gacgacggcg gcgaccaggc ggtcggccac tcggcactcg cgcgcggctt gcaacgggag 1380

gcgcggcgga tggagtggcg cggctcgggc acgcgcgctg gctgcggggc cgagcggctg 1440

caggcgtggc agggcagcgg ggccgggcgg cgcagacagc gcagacagcg caggcatgat 1500

gcgagcgacg accacgcggg cgcgcgcgcg cgaacgacgc gcggggagcg gcagcgaggg 1560

agcgaagagg agggctcggc tcggcgcggg cggctcacgc acgcgcgggc agagcggagg 1620

gagcggagga ggggcgttcg gcgcgagcgg ctcacgcgca cgcgcgcgcg gcgcgcgggc 1680

ggagcggagc ggagggggag agagagagag agagagagag atagccgggg agggaggggg 1740

agatgggccg agagagattc ggcccatcga acccaggggg aggcaaaata gacttttgcg 1800

gaggaatttg agatctgaga tggcacggac actagacaac aagcaaagaa acaaatttcg 1860

caattagggt ttttaagaga taattttccc gctaggcgcc acgacggaac gggcgctaca 1920

gctttggaat ggcaatggtt gggtgggagc tggtgctgtg ggcgaaatcc tagctcgatg 1980

ttttcgggtt gacaacgatg acgcctcggt gttgtacttg ctcttgagaa tgttgctgag 2040

ttgtcagctc tctccacccg atatgacttt tcgggtgaaa acctagtcca aggtggatag 2100

cctccatgga ggcaccgcct cgaaggtcat gttccctcgc attcattgcc ttcttcctag 2160

tttggccttc tgcgttcggt tagtttcgtc tctaggttgg tgtaagaatg agcagatctt 2220

tccccctctc tctctctctc atcctcatcc tcaaacctcc tgtgagggtg gccgggagtc 2280

tgtcgtcgac attcttggtg aaattggttt gaagcgagag cgtctgcgac ctccttgtag 2340

ggctagcaat tatcggtcac gtacaacggg tgtgtgtttg gagcctgtag catgtggtgg 2400

agtagtcttt tttttttccc taattatgac cttcttctgt tgtaattcta tacataattt 2460

ttttcatgct atatcaatat gaatcttctt gtgttgtctt gtgcgggtca ttcagaaaaa 2520

aacactatta gtaagtggga aactagaggc cgaccggagg tttctttcta tcgttgggag 2580

cctctctgcc ttccgacctc catcgaattg ggtgcagacc agcagcagcc aataattaag 2640

gtcgtcggcc gtatat 2656

<210>9

<211>1934

<212>DNA

<213> corn

<400>9

cagtgcagcg tgacccggtc gtgcccctct ctagagataa tgagcattgc atgtctaagt 60

tataaaaaat taccacatat tttttttgtc acacttgttt gaagtgcagt ttatctatct 120

ttatacatat atttaaactt tactctacga ataatataat ctatagtact acaataatat 180

cagtgtttta gagaatcata taaatgaaca gttagacatg gtctaaagga caattgagta 240

ttttgacaac aggactctac agttttatct ttttagtgtg catgtgttct cctttttttt 300

tgcaaatagc ttcacctata taatacttca tccattttat tagtacatcc atttagggtt 360

tagggttaat ggtttttata gactaatttt tttagtacat ctattttatt ctattttagc 420

ctctaaatta agaaaactaa aactctattt tagttttttt atttaataat ttagatataa 480

aatagaataa aataaagtga ctaaaaatta aacaaatacc ctttaagaaa ttaaaaaaac 540

taaggaaaca tttttcttgt ttcgagtaga taatgccagc ctgttaaacg ccgtcgacga 600

gtctaacgga caccaaccag cgaaccagca gcgtcgcgtc gggccaagcg aagcagacgg 660

cacggcatct ctgtcgctgc ctctggaccc ctctcgagag ttccgctcca ccgttggact 720

tgctccgctg tcggcatcca gaaattgcgt ggcggagcgg cagacgtgag ccggcacggc 780

aggcggcctc ctcctcctct cacggcaccg gcagctacgg gggattcctt tcccaccgct 840

ccttcgcttt cccttcctcg cccgccgtaa taaatagaca ccccctccac accctctttc 900

cccaacctcg tgttgttcgg agcgcacaca cacacaacca gatctccccc aaatccaccc 960

gtcggcacct ccgcttcaag gtacgccgct cgtcctcccc cccccccctc tctaccttct 1020

ctagatcggc gttccggtcc atggttaggg cccggtagtt ctacttctgt tcatgtttgt 1080

gttagatccg tgtttgtgtt agatccgtgc tgctagcgtt cgtacacgga tgcgacctgt 1140

acgtcagaca cgttctgatt gctaacttgc cagtgtttct cttggggaat cctgggatgg 1200

ctctagccgt tccgcagacg ggatcgattt catgattttt tttgtttcgt tgcatagggt 1260

ttggtttgcc cttttccttt atttcaatat atgccgtgca cttgtttgtc gggtcatctt 1320

ttcatgcttt tttttgtctt ggttgtgatg atgtggtctg gttgggcggt cgttctagat 1380

cggagtagaa ttctgtttca aactacctgg tggatttatt aattttggat ctgtatgtgt 1440

gtgccataca tattcatagt tacgaattga agatgatgga tggaaatatc gatctaggat 1500

aggtatacat gttgatgcgg gttttactga tgcatataca gagatgcttt ttgttcgctt 1560

ggttgtgatg atgtggtgtg gttgggcggt cgttcattcg ttctagatcg gagtagaata 1620

ctgtttcaaa ctacctggtg tatttattaa ttttggaact gtatgtgtgt gtcatacatc 1680

ttcatagtta cgagtttaag atggatggaa atatcgatct aggataggta tacatgttga 1740

tgtgggtttt actgatgcat atacatgatg gcatatgcag catctattca tatgctctaa 1800

ccttgagtac ctatctatta taataaacaa gtatgtttta taattatttt gatcttgata 1860

tacttggatg atggcatatg cagcagctat atgtggattt ttttagccct gccttcatac 1920

gctatttatt tgct 1934

<210>10

<211>4206

<212>DNA

<213> Artificial sequence

<220>

<223> nuclear localization sequence and nucleotide sequence of Cas9 gene

<400>10

atggccccta agaagaagag aaaggtcggt attcacggcg ttcctgcggc gatggacaag 60

aagtatagta ttggtctgga cattgggacg aattccgttg gctgggccgt gatcaccgat 120

gagtacaagg tcccttccaa gaagtttaag gttctgggga acaccgatcg gcacagcatc 180

aagaagaatc tcattggagc cctcctgttc gactcaggcg agaccgccga agcaacaagg 240

ctcaagagaa ccgcaaggag acggtataca agaaggaaga ataggatctg ctacctgcag 300

gagattttca gcaacgaaat ggcgaaggtg gacgattcgt tctttcatag attggaggag 360

agtttcctcg tcgaggaaga taagaagcac gagaggcatc ctatctttgg caacattgtc 420

gacgaggttg cctatcacga aaagtacccc acaatctatc atctgcggaa gaagcttgtg 480

gactcgactg ataaggcgga ccttagattg atctacctcg ctctggcaca catgattaag 540

ttcaggggcc attttctgat cgagggggat cttaacccgg acaatagcga tgtggacaag 600

ttgttcatcc agctcgtcca aacctacaat cagctctttg aggaaaaccc aattaatgct 660

tcaggcgtcg acgccaaggc gatcctgtct gcacgccttt caaagtctcg ccggcttgag 720

aacttgatcg ctcaactccc gggcgaaaag aagaacggct tgttcgggaa tctcattgca 780

ctttcgttgg ggctcacacc aaacttcaag agtaattttg atctcgctga ggacgcaaag 840

ctgcagcttt ccaaggacac ttatgacgat gacctggata accttttggc ccaaatcggc 900

gatcagtacg cggacttgtt cctcgccgcg aagaatttgt cggacgcgat cctcctgagt 960

gatattctcc gcgtgaacac cgagattaca aaggccccgc tctcggcgag tatgatcaag 1020

cgctatgacg agcaccatca ggatctgacc cttttgaagg ctttggtccg gcagcaactc 1080

ccagagaagt acaaggaaat cttctttgat caatccaaga acggctacgc tggttatatt 1140

gacggcgggg catcgcagga ggaattctac aagtttatca agccaattct ggagaagatg 1200

gatggcacag aggaactcct ggtgaagctc aatagggagg accttttgcg gaagcaaaga 1260

actttcgata acggcagcat ccctcaccag attcatctcg gggagctgca cgccatcctg 1320

agaaggcagg aagacttcta cccctttctt aaggataacc gggagaagat cgaaaagatt 1380

ctgacgttca gaattccgta ctatgtcgga ccactcgccc ggggtaattc cagatttgcg 1440

tggatgacca gaaagagcga ggaaaccatc acaccttgga acttcgagga agtggtcgat 1500

aagggcgctt ccgcacagag cttcattgag cgcatgacaa attttgacaa gaacctgcct 1560

aatgagaagg tccttcccaa gcattccctc ctgtacgagt atttcactgt ttataacgaa 1620

ctcacgaagg tgaagtatgt gaccgaggga atgcgcaagc ccgccttcct gagcggcgag 1680

caaaagaagg cgatcgtgga ccttttgttt aagaccaatc ggaaggtcac agttaagcag 1740

ctcaaggagg actacttcaa gaagattgaa tgcttcgatt ccgttgagat cagcggcgtg 1800

gaagacaggt ttaacgcgtc actggggact taccacgatc tcctgaagat cattaaggat 1860

aaggacttct tggacaacga ggaaaatgag gatatcctcg aagacattgt cctgactctt 1920

acgttgtttg aggataggga aatgatcgag gaacgcttga agacgtatgc ccatctcttc 1980

gatgacaagg ttatgaagca gctcaagaga agaagataca ccggatgggg aaggctgtcc 2040

cgcaagctta tcaatggcat tagagacaag caatcaggga agacaatcct tgactttttg 2100

aagtctgatg gcttcgcgaa caggaatttt atgcagctga ttcacgatga ctcacttact 2160

ttcaaggagg atatccagaa ggctcaagtg tcgggacaag gtgacagtct gcacgagcat 2220

atcgccaacc ttgcgggatc tcctgcaatc aagaagggta ttctgcagac agtcaaggtt 2280

gtggatgagc ttgtgaaggt catgggacgg cataagcccg agaacatcgt tattgagatg 2340

gccagagaaa atcagaccac acaaaagggt cagaagaact cgagggagcg catgaagcgc 2400

atcgaggaag gcattaagga gctggggagt cagatcctta aggagcaccc ggtggaaaac 2460

acgcagttgc aaaatgagaa gctctatctg tactatctgc aaaatggcag ggatatgtat 2520

gtggaccagg agttggatat taaccgcctc tcggattacg acgtcgatca tatcgttcct 2580

cagtccttcc ttaaggatga cagcattgac aataaggttc tcaccaggtc cgacaagaac 2640

cgcgggaagt ccgataatgt gcccagcgag gaagtcgtta agaagatgaa gaactactgg 2700

aggcaacttt tgaatgccaa gttgatcaca cagaggaagt ttgataacct cactaaggcc 2760

gagcgcggag gtctcagcga actggacaag gcgggcttca ttaagcggca actggttgag 2820

actagacaga tcacgaagca cgtggcgcag attctcgatt cacgcatgaa cacgaagtac 2880

gatgagaatg acaagctgat ccgggaagtg aaggtcatca ccttgaagtc aaagctcgtt 2940

tctgacttca ggaaggattt ccaattttat aaggtgcgcg agatcaacaa ttatcaccat 3000

gctcatgacg catacctcaa cgctgtggtc ggaacagcat tgattaagaa gtacccgaag 3060

ctcgagtccg aattcgtgta cggtgactat aaggtttacg atgtgcgcaa gatgatcgcc 3120

aagtcagagc aggaaattgg caaggccact gcgaagtatt tcttttactc taacattatg 3180

aatttcttta agactgagat cacgctggct aatggcgaaa tccggaagag accacttatt 3240

gagaccaacg gcgagacagg ggaaatcgtg tgggacaagg ggagggattt cgccacagtc 3300

cgcaaggttc tctctatgcc tcaagtgaat attgtcaaga agactgaagt ccagacgggc 3360

gggttctcaa aggaatctat tctgcccaag cggaactcgg ataagcttat cgccagaaag 3420

aaggactggg acccgaagaa gtatggaggt ttcgactcac caacggtggc ttactctgtc 3480

ctggttgtgg caaaggtgga gaagggaaag tcaaagaagc tcaagtctgt caaggagctc 3540

ctgggtatca ccattatgga gaggtccagc ttcgaaaaga atccgatcga ttttctcgag 3600

gcgaagggat ataaggaagt gaagaaggac ctgatcatta agcttccaaa gtacagtctt 3660

ttcgagttgg aaaacggcag gaagcgcatg ttggcttccg caggagagct ccagaagggt 3720

aacgagcttg ctttgccgtc caagtatgtg aacttcctct atctggcatc ccactacgag 3780

aagctcaagg gcagcccaga ggataacgaa cagaagcaac tgtttgtgga gcaacacaag 3840

cattatcttg acgagatcat tgaacagatt tcggagttca gtaagcgcgt catcctcgcc 3900

gacgcgaatt tggataaggt tctctcagcc tacaacaagc accgggacaa gcctatcaga 3960

gagcaggcgg aaaatatcat tcatctcttc accctgacaa accttggggc tcccgctgca 4020

ttcaagtatt ttgacactac gattgatcgg aagagataca cttctacgaa ggaggtgctg 4080

gatgcaaccc ttatccacca atcgattact ggcctctacg agacgcggat cgacttgagt 4140

cagctcgggg gggataagag accagcggca accaagaagg caggacaagc gaagaagaag 4200

aagtag 4206

<210>11

<211>367

<212>DNA

<213> cauliflower mosaic virus

<400>11

cggtacgctg aaatcaccag tctctctcta caaatctatc tctctctatt ttctccataa 60

ataatgtgtg agtagtttcc cgataaggga aattagggtt cttatagggt ttcgctcatg 120

tgttgagcat ataagaaacc cttagtatgt atttgtattt gtaaaatact tctatcaata 180

aaatttctaa ttcctaaaac caaaatccag tactaaaatc cagatctcct aaagtcccta 240

tagatctttg tcgtgaatat aaaccagaca cgagacgact aaacctggag cccagacgcc 300

gttcgaagct agaagtaccg cttaggcagg aggccgttag ggaaaagatg ctaaggcagg 360

gttggtt 367

<210>12

<211>742

<212>DNA

<213> Rice

<400>12

ctcattagcg gtatgcatgt tggtagaagt cggagatgta aataattttc attatataaa 60

aaaggtactt cgagaaaaat aaatgcatac gaattaattc tttttatgtt ttttaaacca 120

agtatataga atttattgat ggttaaaatt tcaaaaatat gacgagagaa aggttaaacg 180

tacggcatat acttctgaac agagagggaa tatggggttt ttgttgctcc caacaattct 240

taagcacgta aaggaaaaaa gcacattatc cacattgtac ttccagagat atgtacagca 300

ttacgtaggt acgttttctt tttcttcccg gagagatgat acaataatca tgtaaaccca 360

gaatttaaaa aatattcttt actataaaaa ttttaattag ggaacgtatt attttttaca 420

tgacaccttt tgagaaagag ggacttgtaa tatgggacaa atgaacaatt tctaagaaat 480

gggcatatga ctctcagtac aatggaccaa attccctcca gtcggcccag caatacaaag 540

ggaaagaaat gagggggccc acaggccacg gcccactttt ctccgtggtg gggagatcca 600

gctagaggtc cggcccacaa gtggcccttg ccccgtggga cggtgggatt gcagagcgcg 660

tgggcggaaa caacagttta gtaccacctc gctcacgcaa cgacgcgacc acttgcttat 720

aagctgctgc gctgaggctc ag 742

<210>13

<211>83

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA framework

<400>13

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt ttt 83

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA1 targeting OsLOG5 gene sequence

<400>14

accgtatcgg agcagcacgc 20

<210>15

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA2 targeting OsLOG5 gene sequence

<400>15

acatctccca ggtgagcttc 20

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA3 targeting OsLOG5 gene sequence

<400>16

ctgggagatg tccaccgtat 20

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA4 targeting OsLOG5 gene sequence

<400>17

tgttctgcgg cagcagcccc 20

<210>18

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA5 targeting OsLOG5 gene sequence

<400>18

gctcctcgag gtcatcacct 20

<210>19

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA6 targeting OsLOG5 gene upstream sequence

<400>19

aattatcggt cacgtacaac 20

<210>20

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA7 targeting OsLOG5 gene sequence

<400>20

cttccgacct ccatcgaatt 20

<210>21

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA8 targeting OsLOG5 gene sequence

<400>21

gtgggaaact agaggccgac 20

<210>22

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA9 targeting OsLOG5 gene sequence

<400>22

cggccgacga ccttaattat 20

<210>23

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA10 targeting OsLOG5 gene sequence

<400>23

gatagaaaga aacctccggt 20

<210>24

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA11 targeting OsLOG5 gene upstream sequence

<400>24

agggaacatg accttcgagg 20

<210>25

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA12 targeting OsLOG5 gene upstream sequence

<400>25

ctacagcttt ggaatggcaa 20

<210>26

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA13 targeting OsLOG5 gene upstream sequence

<400>26

cgcgcaacga cgaaaggcga 20

<210>27

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA14 targeting OsLOG5 gene upstream sequence

<400>27

gaagaaggca atgaatgcga 20

<210>28

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA15 targeting OsLOG5 gene sequence

<400>28

agaccgatcc aactatccaa 20

<210>29

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA16 targeting OsLOG5 gene sequence

<400>29

agctacatcg aagaggcagg 20

<210>30

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA17 targeting OsLOG5 gene sequence

<400>30

ctcataataa cactccatag 20

<210>31

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA18 targeting OsLOG5 gene upstream sequence

<400>31

gggtcaattc gacccggcct 20

<210>32

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA19 targeting OsLOG5 gene upstream sequence

<400>32

gccgaggcga tgatgacggc 20

<210>33

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA20 targeting OsLOG5 gene upstream sequence

<400>33

gcagacagcg cagacagcgc 20

<210>34

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA21 targeting OsLOG5 gene upstream sequence

<400>34

tggcggcgag agcatctacg 20

<210>35

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of gRNA22 targeting OsLOG5 gene upstream sequence

<400>35

tgatgcgagc gacgaccacg 20

<210>36

<211>199

<212>DNA

<213> tomato

<400>36

gtacggaccg tactactcta ttcgtttcaa tatatttatt tgtttcagct gactgcaaga 60

ttcaaaaatt tctttattat tttaaatttt gtgtcactca aaaccagata aacaatttga 120

tatagaggca ctatatatat acatattctc gattatatat gtaaatgagt taaccttttt 180

ttccacttaa attatatag 199

<210>37

<211>153

<212>DNA

<213> Rice

<400>37

atgatgatgg agaatagcag ggagcagcag ccggagtcgt cgccggcgaa caacaatagc 60

aagaagaaga agaagaagaa gacggcgtcg cggttccggc gtgtgtgcgt gttctgcggc 120

agcagccccg ggaagaaggc gtcgtaccag gtg 153

<210>38

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> cloning of Forward primer for construction of OsLOGL5 Gene cDNA sense Strand of RNAi construct DP3047

<400>38

ctgctgagga tgatgatgga gaatagcagg gag 33

<210>39

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> cloning of reverse primer for constructing OsLOGL5 gene cDNA sense strand of RNAi construct DP3047

<400>39

gcttgctgag gcacctggta cgacgccttc ttc 33

<210>40

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> cloning of Forward primer for constructing OsLOGL5 gene cDNA antisense strand of RNAi construct DP3047

<400>40

ccgctgagga tgatgatgga gaatagcagg gag 33

<210>41

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> cloning of reverse primer for constructing OsLOGL5 gene cDNA antisense strand of RNAi construct DP3047

<400>41

gcctgctgag gcacctggta cgacgccttc ttc 33

<210>42

<211>100

<212>DNA

<213> Rice

<400>42

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcacgccgg aagcatctac tcccccaagc ccgacatggc 100

<210>43

<211>101

<212>DNA

<213> Rice

<400>43

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcatcgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>44

<211>101

<212>DNA

<213> Rice

<400>44

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcaacgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>45

<211>99

<212>DNA

<213> Rice

<400>45

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agccgccgga agcatctact cccccaagcc cgacatggc 99

<210>46

<211>101

<212>DNA

<213> Rice

<400>46

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcaccgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>47

<211>94

<212>DNA

<213> Rice

<400>47

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggacg 60

ccggaagcat ctactccccc aagcccgaca tggc 94

<210>48

<211>96

<212>DNA

<213> Rice

<400>48

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

cgccggaagc atctactccc ccaagcccga catggc 96

<210>49

<211>90

<212>DNA

<213> Rice

<400>49

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcgccgg 60

aagcatctac tcccccaagc ccgacatggc 90

<210>50

<211>86

<212>DNA

<213> Rice

<400>50

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

atctactccc ccaagcccga catggc 86

<210>51

<211>95

<212>DNA

<213> Rice

<400>51

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

gccggaagca tctactcccc caagcccgac atggc 95

<210>52

<211>76

<212>DNA

<213> Rice

<400>52

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

ccaagcccga catggc 76

<210>53

<211>80

<212>DNA

<213> Rice

<400>53

cgccgccgca cgacgccacc gccctgaagc tcacctgaag ctcacgccgg aagcatctac 60

tcccccaagc ccgacatggc 80

<210>54

<211>98

<212>DNA

<213> Rice

<400>54

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcaccggaa gcatctactc ccccaagccc gacatggc 98

<210>55

<211>98

<212>DNA

<213> Rice

<400>55

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agccccggaa gcatctactc ccccaagccc gacatggc 98

<210>56

<211>93

<212>DNA

<213> Rice

<400>56

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

cggaagcatctactccccca agcccgacat ggc 93

<210>57

<211>87

<212>DNA

<213> Rice

<400>57

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggaag 60

catctactcc cccaagcccg acatggc 87

<210>58

<211>100

<212>DNA

<213> Rice

<400>58

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcacgccgg aagcatctac tcccccaagc ccgacatggc 100

<210>59

<211>99

<212>DNA

<213> Rice

<400>59

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc tatcggagca 60

gcacgccgga agcatctact cccccaagcc cgacatggc 99

<210>60

<211>101

<212>DNA

<213> Rice

<400>60

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gatatcggag 60

cagcacgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>61

<211>214

<212>DNA

<213> Rice

<400>61

cgccgccgca cgacgccacc gcttgtgacc ctcagtaatt ttccagtggt gtttgtaata 60

tatcctcatt ataacttgga taacatttgt ttatttttct aggttgtgtc tttctatctg 120

ccagataaaa tactataaca atgttgatga gtatatatat tttcctatcg gagcagcacg 180

ccggaagcat ctactccccc aagcccgaca tggc 214

<210>62

<211>78

<212>DNA

<213> Rice

<400>62

cgccgccgca cgacgccacc gccctgaagc tcacctgaag cacgccggaa gcatctactc 60

ccccaagccc gacatggc 78

<210>63

<211>101

<212>DNA

<213> Rice

<400>63

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gttatcggag 60

cagcacgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>64

<211>102

<212>DNA

<213> Rice

<400>64

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtttatcgga 60

gcagcacgcc ggaagcatct actcccccaa gcccgacatg gc 102

<210>65

<211>93

<212>DNA

<213> Rice

<400>65

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtatcgg agcagcacgc 60

cggaagcatc tactccccca agcccgacat ggc 93

<210>66

<211>101

<212>DNA

<213> Rice

<400>66

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gctatcggag 60

cagcacgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>67

<211>90

<212>DNA

<213> Rice

<400>67

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtcgagc agcacgccgg 60

aagcatctac tcccccaagc ccgacatggc 90

<210>68

<211>101

<212>DNA

<213> Rice

<400>68

cgccgccgca cgacgccacc gccctgaagc tcacctggga gatgtccacc gtatcggagc 60

agcatcgccg gaagcatcta ctcccccaag cccgacatgg c 101

<210>69

<211>120

<212>DNA

<213> Rice

<400>69

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagc tcacctggga 60

gatgtccacc gtatcggagc agcacgccgg aagcatctac tcccccaagc ccgacatggc 120

<210>70

<211>122

<212>DNA

<213> Rice

<400>70

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaag ctcacctggg 60

agatgtccac cgttatcgga gcagcacgcc ggaagcatct actcccccaa gcccgacatg 120

gc 122

<210>71

<211>122

<212>DNA

<213> Rice

<400>71

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaag ctcacctggg 60

agatgtccac cgatatcgga gcagcacgcc ggaagcatct actcccccaa gcccgacatg 120

gc 122

<210>72

<211>120

<212>DNA

<213> Rice

<400>72

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaag ctcacctggg 60

agatgtccac ctatcggagc agcacgccgg aagcatctac tcccccaagc ccgacatggc 120

<210>73

<211>115

<212>DNA

<213> Rice

<400>73

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaag ctcacctggg 60

agatgttatc ggagcagcac gccggaagca tctactcccc caagcccgac atggc 115

<210>74

<211>107

<212>DNA

<213> Rice

<400>74

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaga tgtccaccta 60

tcggagcagc acgccggaag catctactcc cccaagcccg acatggc 107

<210>75

<211>119

<212>DNA

<213> Rice

<400>75

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagc tcacctggga 60

gatgtccacc tatcggagca gcacgccgga agcatctact cccccaagcc cgacatggc 119

<210>76

<211>89

<212>DNA

<213> Rice

<400>76

caagctcgag gaatacgtgc cgccgccgca cgacgccacc tatcggagca gcacgccgga 60

agcatctact cccccaagcc cgacatggc 89

<210>77

<211>122

<212>DNA

<213> Rice

<400>77

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaatg ctcacctggg 60

agatgtccac cgttatcgga gcagcacgcc ggaagcatct actcccccaa gcccgacatg 120

gc 122

<210>78

<211>117

<212>DNA

<213> Rice

<400>78

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaag ctcacctggg 60

agatgtccaa tcggagcagc acgccggaag catctactcc cccaagcccg acatggc 117

<210>79

<211>121

<212>DNA

<213> Rice

<400>79

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagc tcacctggga 60

gatgtccacc gttatcggag cagcacgccg gaagcatcta ctcccccaag cccgacatgg 120

c 121

<210>80

<211>117

<212>DNA

<213> Rice

<400>80

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagg ctcacctggg 60

agatgtccta tcggagcagc acgccggaag catctactcc cccaagcccg acatggc 117

<210>81

<211>121

<212>DNA

<213> Rice

<400>81

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagc tcacctggga 60

gatgtccacc gatatcggag cagcacgccg gaagcatcta ctcccccaag cccgacatgg 120

c 121

<210>82

<211>113

<212>DNA

<213> Rice

<400>82

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagc tcacctggga 60

gatgtatcgg agcagcacgc cggaagcatc tactccccca agcccgacat ggc 113

<210>83

<211>121

<212>DNA

<213> Rice

<400>83

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagc tcacctggga 60

gatgtccacc ggtatcggag cagcacgccg gaagcatcta ctcccccaag cccgacatgg 120

c 121

<210>84

<211>111

<212>DNA

<213> Rice

<400>84

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaaga gatgtccacc 60

gctatcggag cagcacgccg gaagcatcta ctcccccaag cccgacatgg c 111

<210>85

<211>122

<212>DNA

<213> Rice

<400>85

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagg ctcacctggg 60

agatgtccac cgatatcgga gcagcacgcc ggaagcatct actcccccaa gcccgacatg 120

gc 122

<210>86

<211>122

<212>DNA

<213> Rice

<400>86

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctgaagg ctcacctggg 60

agatgtccac cgttatcgga gcagcacgcc ggaagcatct actcccccaa gcccgacatg 120

gc 122

<210>87

<211>119

<212>DNA

<213> Rice

<400>87

caagctcgag gaatacgtgc cgccgccgca cgacgccacc gccctctagt acacacgttg 60

atgtccacct tatcggagca gcacgccgga agcatctact cccccaagcc cgacatggc 119

<210>88

<211>66

<212>DNA

<213> Rice

<400>88

caagctcgag gaatacgtgc cgccgccgtc caccgcgtat cggagcagca cgccggaagc 60

atctac 66

Claims (21)

1. An isolated polynucleotide comprising: (a) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:1 is at least 85% identical; (b) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:2 is at least 85%; (c) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes to SEQ ID NO:3 is at least 90%; or (d) the full-length complement of nucleotide sequence (a), (b) or (c), wherein increasing the expression level of the polynucleotide shortens the root length of the plant.

2. The isolated polynucleotide of claim 1, wherein the polynucleotide comprises the sequence of SEQ ID NO:1 or SEQ ID NO: 2.

3. The isolated polynucleotide of claim 1, wherein the polypeptide encoded by the isolated polynucleotide comprises the amino acid sequence of SEQ ID NO: 3.

4. Use of the isolated polynucleotide of any one of claims 1-3 to modulate root length in a plant.

5. A recombinant DNA construct comprising the isolated nucleotide of any one of claims 1-3 operably linked to at least one heterologous regulatory element.

6. A modified plant, plant cell, or seed having an altered amount of expression of at least one polynucleotide encoding a root length modulating polypeptide, LOGL5, wherein the plant exhibits altered root length as compared to a control plant grown under the same conditions but without the altered expression of LOGL 5.

7. The plant of claim 6, wherein increasing expression of root length regulatory gene LOGL5 reduces root length in the plant compared to a control plant which does not increase expression of LOGL 5.

8. The plant of claim 6, wherein decreasing expression of root length regulatory gene LOGL5 increases root length in the plant compared to a control plant which does not decrease expression of LOGL 5.

9. The plant of claim 8, wherein said plant comprises a suppression DNA construct comprising a suppression element and at least one heterologous regulatory element operably linked thereto, said suppression element comprising the following sequence of at least 100bp base pairs contiguous: (a) and SEQ ID NO:1 or 2, which is at least 85% identical in nucleotide sequence; (b) the encoded polypeptide has the sequence shown in SEQ ID NO:3 with at least 90% amino acid sequence identity; (c) the full-length complementary sequence of the nucleotide sequence (a) or (b).

10. The plant of claim 8, wherein said plant comprises a modification of root length regulatory gene LOGL5 or a regulatory element thereof, said modification obtained by (a) introducing or deleting or replacing a DNA segment, or (b) introducing one or more nucleotide changes, into a genomic region comprising the endogenous LOGL5 gene and a regulatory element thereof, wherein the expression level or activity of said endogenous LOGL5 polypeptide is reduced as compared to the expression and activity of a wild-type LOGL5 polypeptide in a control plant.

11. The plant of claim 10, wherein said plant comprises a mutated LOGL5 gene; expression or activity of a LOGL5 polypeptide is reduced in said plant compared to a control plant, which plant exhibits longer roots.

12. The plant of claim 10, wherein said plant comprises a mutated LOGL5 gene; the activity of the LOGL5 polypeptide is reduced or abolished in said plant compared to a control plant, which plant exhibits longer roots.

13. The plant of claim 10, wherein said plant comprises a mutant LOGL5 regulatory element, wherein expression of a LOGL5 polypeptide is reduced in said plant as compared to a control plant, and wherein said plant exhibits longer roots.

14. The plant of any one of claims 8-13, wherein the modified plant has higher yield under normal conditions than a control.

15. The plant of any one of claims 6 to 13, wherein the plant is selected from rice, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, sugar cane, or switchgrass.

16. A method for regulating the root length of a rice plant, which comprises changing the expression level of a polynucleotide encoding a root length regulating polypeptide LOGL5 in the rice plant.

17. The method of claim 16, wherein the polynucleotide comprises: (a) a polynucleotide whose nucleotide sequence is identical to SEQ ID NO:1 sequence identity of at least 85%; (b) a polynucleotide whose nucleotide sequence is identical to SEQ id no:

2 is at least 85%; (c) a polynucleotide encoding a polypeptide having an amino acid sequence that hybridizes with SEQ id no:

3 is at least 90%.

18. A method according to claim 16 or 17, wherein the expression of said polynucleotide is altered by one of the following steps:

(a) increasing expression in a plant of a polynucleotide encoding a LOGL5 polypeptide by a recombinant DNA construct comprising a polynucleotide encoding a LOGL5 polypeptide and at least one heterologous regulatory element operably linked thereto, wherein the amino acid sequence of the polypeptide encoded by the polynucleotide is identical to the amino acid sequence of seq i ID NO:3 is at least 90%;

(b) increasing or decreasing expression of an endogenous polynucleotide encoding a polypeptide having an amino acid sequence that differs from the amino acid sequence of seq id NO:3 is at least 90%;

(c) reducing expression in a plant of a polynucleotide encoding a LOGL5 polypeptide by a recombinant DNA construct comprising a suppression element for down-regulating expression of said endogenous polynucleotide encoding a polypeptide having an amino acid sequence that differs from the amino acid sequence set forth in SEQ ID NO:3 is at least 90%.

19. The method of claim 18, wherein reducing expression of said polynucleotide in a rice plant promotes root elongation as compared to a control plant that does not have said reduced expression.

20. A method for reducing the level of expression or activity of a plant endogenous LOGL5 polypeptide as compared to the level of expression or activity of a wild-type LOGL5 polypeptide of a control plant; and the plant exhibits longer roots as compared to a control plant; the method comprises the following steps: introducing a DNA fragment in the genomic region of the endogenous LOGL5 gene (i) reduces the expression of LOGL5, or (ii) introduces one or more nucleotide changes, wherein the change is effective to reduce the expression level or activity of the endogenous LOGL5 polypeptide.

21. The method of claim 20, wherein the alteration is introduced by a zinc finger nuclease, transcription activator-like effector nucleases (TALENs), CRISPR-Cas, guide Cas endonuclease, homing endonucleases (meganucleotides), or CRISPR-Cas ribonucleoprotein complex.

Images