CN110669737A - Method for amplifying grassland caterpillar nuclear polyhedrosis virus - Google Patents
Method for amplifying grassland caterpillar nuclear polyhedrosis virus Download PDFInfo
- Publication number
- CN110669737A CN110669737A CN201910705079.0A CN201910705079A CN110669737A CN 110669737 A CN110669737 A CN 110669737A CN 201910705079 A CN201910705079 A CN 201910705079A CN 110669737 A CN110669737 A CN 110669737A
- Authority
- CN
- China
- Prior art keywords
- caterpillar
- nuclear polyhedrosis
- polyhedrosis virus
- grassland
- larvae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
- C12N2710/14151—Methods of production or purification of viral material
Abstract
The invention provides a method for amplifying prairie caterpillar nuclear polyhedrosis virus, which comprises the following steps of (1) feeding beet armyworm larvae with a feeding feed added with a certain amount of purified prairie caterpillar nuclear polyhedrosis virus A for a period of time, and then feeding with a normal feeding feed until the beet armyworm larvae die or pupate; (2) extracting prairie caterpillar nuclear polyhedrosis virus B from dead insect cadavers of beet armyworm larvae. The method for amplifying the grassland caterpillar nuclear polyhedrosis virus can obtain the grassland caterpillar nuclear polyhedrosis virus for killing grassland caterpillars, can realize amplification of the grassland caterpillar nuclear polyhedrosis virus by utilizing artificially fed asparagus caterpillar larvae, solves the problem of amplification of the insect source of the grassland caterpillar nuclear polyhedrosis virus, can realize amplification of a large amount of the grassland caterpillar nuclear polyhedrosis virus, and further realizes commercialization of the grassland caterpillar nuclear polyhedrosis virus.
Description
Technical Field
The invention relates to the technical field of grassland caterpillar nuclear polyhedrosis virus, in particular to a method for amplifying grassland caterpillar nuclear polyhedrosis virus.
Background
The prairie caterpillars are important pests in plateau pastoral areas in China, are called red-head black caterpillars and prairie moths, belong to Lepidoptera and Bombycidae, have 15 kinds of prairie caterpillars in the world, and are mainly distributed in polar regions and alpine regions. The prairie caterpillars are mainly harmful to various pasture grasses of Cyperaceae, Gramineae, Leguminosae, Polygonaceae, Rosaceae and the like, the prairie caterpillars are seriously harmful when outbreak occurs, most stem leaves of the pasture grasses are eaten, only dead branches and residual leaves are left, the growth of the pasture grasses is influenced, the grassland is lack of the pasture grasses, and the development of the animal husbandry is seriously influenced [ Malliqing, Qinghai animal husbandry and veterinary journal, 2013,43(1):40-42 ]. Grassland caterpillars not only harm forage grass, but also have certain influence on human and livestock, body hair and cocoon hair of the grassland caterpillars are extremely toxic, and when cattle and sheep eat forage grass with insects or cocoons, oral mucosa red swelling, vesicles, dental root or tongue erosion and the like can be caused [ Nima, et al, livestock and veterinarian, 2011,44(4):111 ].
The grassland caterpillar Nuclear polyhedrosis virus (GrNPV for short) has strong toxicity to grassland caterpillar, and the GrNPV has no infectivity, pathogenicity and other toxicity to human and spinal animals [ Yangxiang, et al, Sichuan university report (Nature science edition), 1990(2): 232-. Liu Shi Gui is equal to the GrNPV which is firstly separated from the grassland in northwest Sichuan in 1982-1983, and a preliminary bioassay experiment shows that the GrNPV has stronger infection lethal capability to the grassland caterpillars [ Liu Shi Gui, et al, school newspaper of Sichuan university (Nature science edition), 1984,01:104-112 ]. GrNPV is obtained by separating morbid and dead grassland caterpillar larvae from grasslands of North China, sea, Qinghai province in 1987 by cunningrs, and test results show that GrNPV has strong toxicity to grassland caterpillar, the insecticidal effect of GrNPV reaches 85%, and the GrNPV has a later effect [ cunnings, grass science, 1996,13(3):50-54 ]. The grassland caterpillar nuclear polyhedrosis virus GrNPV is successfully amplified by utilizing grassland caterpillar in the natural protection zone from Wangjinchang to gaga-Yuanxu nationality (Wangjinchang, et al. Biochemical engineering, 2017,3(1): 21-24.).
However, the problem of the source of the grassland caterpillars is that the grassland caterpillars are used to amplify the grassland caterpillars nuclear polyhedrosis virus GrNPV. The wild prairie caterpillars are suitable for amplifying the prairie caterpillars nuclear polyhedrosis virus GrNPV only in three months of 5 months, 6 months and 7 months. The artificial feeding of the grassland caterpillars is not solved at present, so that the grassland caterpillars nuclear polyhedrosis virus GrNPV is difficult to be amplified in large quantity by using the grassland caterpillars, and the commercialization of the grassland caterpillars nuclear polyhedrosis virus GrNPV is difficult to be realized.
Accordingly, the present invention provides a method for amplifying a grassland caterpillar nuclear polyhedrosis virus to solve the above-mentioned drawbacks.
Disclosure of Invention
The invention aims to provide a method for amplifying prairie caterpillar nuclear polyhedrosis virus by utilizing spodoptera exigua larvae, solves the problems of adopting a prairie caterpillar source, and can realize large-scale amplification of the prairie caterpillar nuclear polyhedrosis virus.
To achieve the above object, the present invention provides a method for amplifying a grassland caterpillar nuclear polyhedrosis virus, comprising the steps of:
(1) feeding beet armyworm larvae with a feeding feed added with a certain amount of purified prairie caterpillar nuclear polyhedrosis virus A for a period of time, and then feeding with a normal feeding feed until the beet armyworm larvae die or pupate;
(2) extracting prairie caterpillar nuclear polyhedrosis virus B from dead insect cadavers of beet armyworm larvae.
Preferably, in step (1), the obtaining of the larvae of the spodoptera exigua comprises: and (3) putting the beet noctuid eggs in a constant-temperature incubator, incubating, and artificially feeding beet noctuid larvae to 3 years old.
Preferably, in step (1), the obtaining of the grassland caterpillar nuclear polyhedrosis virus A comprises:
(a) collecting 2-instar grassland caterpillar larvae, and feeding the caterpillar larvae with elymus nutans and meadow bluegrass to 3 instar;
(b) coating the stock solution of the grassland caterpillar nuclear polyhedrosis virus on elymus nutans and poa pratensis, feeding the larvae of the grassland caterpillar by using the elymus nutans and the poa pratensis for a period of time, and feeding the larvae of the grassland caterpillar by using normal feed until the larvae of the grassland caterpillar die;
(c) extracting prairie caterpillar nuclear polyhedrosis virus A from dead corpses of prairie caterpillar larvae.
Preferably, in step (1), the concentration of the grassland caterpillar nuclear polyhedrosis virus A is 1X 103PIB/mL～1×108PIB/mL; for example, the concentration of the grassland caterpillar nuclear polyhedrosis virus A may be 1X 103PIB/mL、1×104PIB/mL、1×105PIB/mL、1×106PIB/mL、1×107PIB/mL、1×108PIB/mL. Wherein the addition amount of the grassland caterpillar nuclear polyhedrosis virus A is 5 uL-15 uL, for example, the addition amount of the grassland caterpillar nuclear polyhedrosis virus A can be 5uL, 10uL and 15 uL. Wherein the feeding feed added with a certain amount of purified grassland caterpillar nuclear polyhedrosis virus A is used for feeding beet armyworm larvae for 24-48 hours.
Preferably, in step (2), the prairie caterpillar nuclear polyhedrosis virus B is purified by differential centrifugation.
Specifically, the rotation speed of the differential centrifugation is 4000rpm to 6000rpm, and then the rotation speed is changed to 800rpm to 1000 rpm. The time of differential centrifugation is selected to be 5 min-10 min.
Preferably, the method for amplifying the grassland caterpillar nuclear polyhedrosis virus further comprises the steps of:
(3) feeding beet armyworm larvae with a feeding feed added with a certain amount of purified prairie caterpillar nuclear polyhedrosis virus B for a period of time, and then feeding with a normal feeding feed until the beet armyworm larvae die or pupate;
(4) the prairie caterpillar nuclear polyhedrosis virus is extracted from dead insect bodies of the beet armyworm larvae.
It should be noted that the grassland caterpillar nuclear polyhedrosis virus, grassland caterpillar nuclear polyhedrosis virus B and grassland caterpillar nuclear polyhedrosis virus A mentioned in the present application are all grassland caterpillar nuclear polyhedrosis virus.
Preferably, in step (3), the concentration of the grassland caterpillar nuclear polyhedrosis virus B is 1X 103PIB/mL～1×108PIB/mL. For example, the concentration of the BmDNV B may be 1X 103PIB/mL、1×104PIB/mL、1×105PIB/mL、1×106PIB/mL、1×107PIB/mL、1×108PIB/mL. Wherein the addition amount of the grassland caterpillar nuclear polyhedrosis virus B is 5 uL-15 uL, for example, the addition amount of the grassland caterpillar nuclear polyhedrosis virus B can be 5uL, 10uL and 15 uL. Wherein the feeding feed added with a certain amount of purified grassland caterpillar nuclear polyhedrosis virus B is used for feeding beet armyworm larvae for 24-48 hours.
Preferably, the method for amplifying the grassland caterpillar nuclear polyhedrosis virus further comprises the step (5) of verifying the grassland caterpillar nuclear polyhedrosis virus, comprising the steps of:
(51) extracting the genome of the grassland caterpillar nuclear polyhedrosis virus;
(52) using the genome of grassland caterpillar nuclear polyhedrosis virus as template and primer
polyhedrin-F: CGTGCACTCGAATAGCATGT (SEQ ID:1) and polyhedrin-R: GAATACAGGGGCGCATCGG (SEQ ID:2), performing PCR verification;
(52) detecting the amplification product.
The invention also provides a prairie caterpillar nuclear polyhedrosis virus prepared by the method for amplifying the prairie caterpillar nuclear polyhedrosis virus, wherein the prairie caterpillar nuclear polyhedrosis virus is preserved in the China center for type culture collection in 7-18 months in 2019, and the preservation numbers are as follows: CCTCC NO: V201951.
The invention also provides application of the beet armyworm larvae in amplification of the grassland caterpillar nuclear polyhedrosis virus.
The method for amplifying the grassland caterpillar nuclear polyhedrosis virus comprises the steps of adding the purified grassland caterpillar nuclear polyhedrosis virus A into feed for the beet armyworm larvae, feeding for a period of time, feeding the beet armyworm larvae with the feed for a period of time until the beet armyworm larvae die or pupate, and extracting the grassland caterpillar nuclear polyhedrosis virus B from dead bodies of the beet armyworm larvae, so that the grassland caterpillar nuclear polyhedrosis virus for killing the grassland caterpillars can be obtained. Therefore, the method can realize amplification of the grassland caterpillar nuclear polyhedrosis virus by utilizing the artificially fed asparagus caterpillar larvae, solves the problem of amplification of the insect source of the grassland caterpillar nuclear polyhedrosis virus, can realize large-scale amplification of the grassland caterpillar nuclear polyhedrosis virus, and further realizes commercialization of the grassland caterpillar nuclear polyhedrosis virus.
The preservation date of the grassland caterpillar nuclear polyhedrosis virus is 2019, 7 months and 18 days, and the preservation numbers are as follows: CCTCC NO, V201951, classification name: the grassland caterpillar nuclear Polyhedrosis virus GrNPV (Gynaephora ruoregen Nuclear Polyhedrosis Virus) with the name of the depositary unit: china center for type culture Collection, the collection center addresses are: wuhan university school of eight-channel 299 # in Wuchang area of Wuhan city, Hubei province.
Drawings
FIG. 1 is an electron micrograph of a prairie caterpillar nuclear polyhedrosis virus A obtained by amplification of prairie caterpillar;
FIG. 2 is an electron microscope image of a section of the grassland caterpillar nuclear polyhedrosis virus obtained by amplifying beet armyworm larvae;
FIG. 3 is a genomic diagram of a grassland caterpillar nuclear polyhedrosis virus A amplified using grassland caterpillars and a grassland caterpillar nuclear polyhedrosis virus amplified using beet armyworm larvae;
FIG. 4 is an electrophoresis diagram showing PCR verification of the polyhedrin gene PCR products of the grassland caterpillar nuclear polyhedrosis virus A amplified by using grassland caterpillar and the grassland caterpillar nuclear polyhedrosis virus amplified by using beet armyworm larva.
Detailed Description
To better illustrate the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments. It should be noted that the following implementation of the method is a further explanation of the present invention, and should not be taken as a limitation of the present invention. The materials and reagents used in the examples of the present invention are commercially available unless otherwise specified.
The artificial feed for the beet armyworm eggs and the beet armyworm provided by the invention is purchased from Jiyuan Keyun biology Limited company. The stock solution of the grassland caterpillar nuclear polyhedrosis virus is presented by Wuhan virus of Chinese academy of sciences.
Example 1 amplification of grassland caterpillar Nuclear polyhedrosis Virus A
(a) Collecting 2-instar grassland caterpillar larvae, and feeding the caterpillar larvae with elymus nutans and meadow bluegrass to 3 instar;
(b) during proliferation, 400 robust and regularly developed 3-year-old caterpillars are selected, and the stock solution of the nuclear polyhedrosis virus of the caterpillars is diluted to 2 × 10 with sterile water3PIB/mL、2×104PIB/mL、2×105PIB/mL、2×106PIB/mL, respectively coating the diluted solution of the prairie caterpillar nuclear polyhedrosis virus on the elymus nutans and the prairie grassland bluegrass by using a writing brush, drying in the shade, putting into 4 insect cages, marking, inoculating 3-instar prairie caterpillar larvae, naturally feeding at room temperature, observing at every day during the period, feeding the prairie caterpillar larvae with the elymus nutans and the prairie bluegrass for 48h, then replacing with fresh forage, and timely taking out dead caterpillar pests for storage;
(c) extracting prairie caterpillar nuclear polyhedrosis virus A from dead corpses of prairie caterpillar larvae;
(d) and (3) carrying out differential centrifugation on the prairie caterpillar nuclear polyhedrosis virus A to purify the virus for multiple times, wherein the differential centrifugation speed is 4000rpm firstly, and the rotation speed is changed to 800rpm after the centrifugation is carried out for 5min and then the centrifugation is carried out for 5 min.
Under an optical microscope (10X 100), the virus solution of the grassland caterpillar nuclear polyhedrosis virus A was stored in a refrigerator at 4 ℃ by counting with a hemocytometer and photographing. A small amount of virus was sent to Wuhan virus section of Chinese court of hosting department for identification, and typical baculovirus characteristics were observed, see FIG. 1.
Example 2 amplification of spodoptera exigua larvae to obtain the grassland caterpillar nuclear polyhedrosis virus B
(1) Placing beet armyworm eggs in a constant temperature incubator at 27 deg.C, incubating, artificially feeding beet armyworm larvae to 3 years old, and preparing purified grassland caterpillars nuclear polyhedrosis virus A with sterile water to obtain 1 × 108PIB/mL、1×107PIB/mL、1×106PIB/mL、1×105PIB/mL、 1×104PIB/mL、1×103And (2) adding the six kinds of PIB/mL concentrations of the grassland caterpillar nuclear polyhedrosis virus A under each concentration of 10uL into feed for feeding the beet armyworm larvae for 24 hours, feeding the beet armyworm larvae with normal feed until the beet armyworm larvae die or pupate, and finding that the pupation rate of the beet armyworm larvae is obviously reduced: respectively only 52.1%, 54.1%, 45.8%, 31.3%, 25% and 77%;
(2) extracting prairie caterpillar nuclear polyhedrosis virus B from dead insect bodies of spodoptera exigua larvae, carrying out differential centrifugation on the prairie caterpillar nuclear polyhedrosis virus B for multiple times, wherein the differential centrifugation speed is 4000rpm firstly, the rotation speed is changed to 800rpm after 5min of centrifugation, then the centrifugation is carried out for 5min, and counting is carried out by using a blood counting chamber under an optical microscope (10 multiplied by 100).
(3) Adding purified grassland caterpillar nuclear polyhedrosis virus B into appropriate amount of sterile water to obtain 1 × 108PIB/mL、1×107PIB/mL、1×106PIB/mL、1×105PIB/mL、1×104PIB/mL、1×103The six kinds of concentration of PIB/mL, separately taking 10uL of grassland caterpillar nuclear polyhedrosis virus B under each concentration, adding the grassland caterpillar nuclear polyhedrosis virus B into feed to feed the beet armyworm larvae for 24 hours, then feeding the beet armyworm larvae with normal feed until the beet armyworm larvae die or pupate, and finding that the death rate of the beet armyworm larvae reaches 99%;
(4) extracting prairie caterpillar nuclear polyhedrosis virus from dead insect bodies of spodoptera exigua larvae, carrying out differential centrifugation on the prairie caterpillar nuclear polyhedrosis virus for multiple times, wherein the differential centrifugation speed is 4000rpm firstly, the rotation speed is changed to 800rpm after 5min of centrifugation, then carrying out centrifugation for 5min, counting and photographing by using a blood counting plate under an optical microscope (10 multiplied by 100), and storing virus liquid of the prairie caterpillar nuclear polyhedrosis virus in a refrigerator at 4 ℃. A small amount of virus was sent to Wuhan virus section of Chinese court of hosting department for identification, and typical baculovirus characteristics were observed, see FIG. 2.
As can be seen from FIGS. 1 and 2, the electron microscope slides of the grassland caterpillar nuclear polyhedrosis virus amplified from the beet armyworm larvae are identical to the electron microscope slides of the grassland caterpillar nuclear polyhedrosis virus A amplified from the grassland caterpillar.
Example 3 extraction of genome B of the amplified Lyophyllum exigua larva Salicina Nuclear polyhedrosis Virus and genome A of the amplified Lyophyllum exigua Nuclear polyhedrosis Virus
The method comprises the following steps:
1) taking 1.5mL of purified prairie caterpillar nuclear polyhedrosis virus A suspension (shaking uniformly when taken out) and putting into a centrifuge tube, 10000 r/min, 30min, and taking out the precipitate;
2) to the precipitate was added 900. mu.l of ddH2Adding 100 mul SDS solution (original concentration is 10%, final concentration is 1%) to make total volume be 1ml, and keeping temperature at 37 deg.C for 30 min;
3) adding 500 μ l of alkaline lysis solution (3 × DAS), and keeping the temperature at 37 deg.C for 30 min;
4) clarifying after alkaline lysis, subpackaging into 3 tubes (500 mul each), adding 100 mul Tris-HCl (pH 7.4) into each tube to terminate the alkaline hydrolysis reaction, adding 66.67 mul 10% SDS solution into each tube to make the final concentration 1%, adding 20 mul proteinase K (protease K), and keeping the temperature at 37 ℃ for 30 min;
5) extracting each tube with phenol once, adding 667 μ l of equal volume Tris-saturated phenol, inverting and shaking for several times, 12000r/min, 5min, and collecting supernatant;
6) adding the collected supernatant into equal volume of phenol, chloroform and isoamylol (25: 24: 1) for 5min, shaking and mixing at 12000r/min for 5min, dividing into three layers (virus DNA is dissolved in the supernatant, protein is in the middle layer, and chloroform is in the lower layer), and collecting the supernatant;
7) adding chloroform and isoamylol (24: 1) with the same volume into each tube, shaking and mixing uniformly for 5min, 12000r/min, 5min, and taking the supernatant;
8) and finally, filling the supernatant into a centrifuge tube, and placing 3 tubes together in a refrigerator at-20 ℃ for storage to obtain the genome A.
Wherein, the final concentration of alkaline hydrolysis liquid (DAS): 0.1mol/L NaCO3，0.01mol/L EDTA，0.17mol/L NaCl，pH 10.8。
The genome B can be obtained by replacing the grassland caterpillar nuclear polyhedrosis virus A with the grassland caterpillar nuclear polyhedrosis virus by the same method.
The extraction results of the viral genome A and the viral genome B were examined by 1% agarose electrophoresis, see FIG. 3.
FIG. 3 shows that lane 1 is 10Kb Maker, lane 2 is the genome A of the grassland caterpillar nuclear polyhedrosis virus A amplified by using grassland caterpillar, and lane 3 is the genome B of the grassland caterpillar nuclear polyhedrosis virus amplified by using beet armyworm larvae.
As can be seen from FIG. 3, the genome A of the grassland caterpillar nuclear polyhedrosis virus A obtained by amplification using the grassland caterpillar and the genome B of the grassland caterpillar nuclear polyhedrosis virus obtained by amplification using the beet armyworm larvae are equal in size.
Example 4PCR amplification of viral polyhedrosis Gene verification of whether the genome A of the grassland caterpillars nucleopolyhedrosis Virus A amplified by the use of grassland caterpillars and the genome B of the grassland caterpillars nucleopolyhedrosis Virus amplified by the use of beet armyworm larvae are the same genome
The genome of the grassland caterpillar nuclear polyhedrosis virus was subjected to whole genome sequencing using 2-generation sequencing technology, resulting in 21 scfolds.
According to the sequencing result, the virus polyhedron gene primer is designed as follows:
polyhedrin-F：CGTGCACTCGAATAGCATGT；
polyhedrin-R：GAATACAGGGGCGCATCGG，
then, PCR verification was performed, and the PCR reaction system and the PCR reaction program were as shown in Table 1 and Table 2, respectively.
Table 1: PCR reaction system
Table 2: PCR reaction procedure
The same procedure can be used to replace genome A with genome B, which will not be described herein. After the amplification reaction, the PCR amplification product was electrophoresed in 1% agarose gel, and the electrophoresis result is shown in FIG. 4.
FIG. 4 shows that lane 1 is 5000Kb Maker, lanes 2 and 4 are PCR products of polyhedrin gene of grassland caterpillar nuclear polyhedrosis virus A amplified by using grassland caterpillar, and lanes 3 and 5 are PCR products of polyhedrin gene of grassland caterpillar nuclear polyhedrosis virus amplified by using beet armyworm larvae.
As can be seen from FIG. 4, the genome A of the prairie caterpillar nuclear polyhedrosis virus A amplified using the prairie caterpillar and the genome B of the prairie caterpillar nuclear polyhedrosis virus amplified using the beet armyworm larvae are the same genome. Therefore, in the method, the spodoptera exigua larvae are successfully amplified to obtain the grassland caterpillar nuclear polyhedrosis virus.
Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
Sequence listing
<110> institute of microbiology of academy of sciences of Jiangxi province
<120> a method for amplifying grassland caterpillar nuclear polyhedrosis virus
<130>DG18470CN
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgtgcactcg aatagcatgt 20
<210>2
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gaatacaggg gcgcatcgg 19
Claims (10)
1. A method for amplifying a grassland caterpillar nuclear polyhedrosis virus, which is characterized by comprising the following steps:
(1) feeding beet armyworm larvae with a feeding feed added with a certain amount of purified prairie caterpillar nuclear polyhedrosis virus A for a period of time, and then feeding with a normal feeding feed until the beet armyworm larvae die or pupate;
(2) extracting prairie caterpillar nuclear polyhedrosis virus B from dead insect cadavers of beet armyworm larvae.
2. The method for amplifying the grassland caterpillar nuclear polyhedrosis virus according to claim 1, further comprising the steps of:
(3) feeding beet armyworm larvae with a feeding feed added with a certain amount of purified prairie caterpillar nuclear polyhedrosis virus B for a period of time, and then feeding with a normal feeding feed until the beet armyworm larvae die or pupate;
(4) the prairie caterpillar nuclear polyhedrosis virus is extracted from dead insect bodies of the beet armyworm larvae.
3. The method for amplifying the grassland caterpillar nuclear polyhedrosis virus according to claim 1, wherein in the step (2), the grassland caterpillar nuclear polyhedrosis virus B is purified by differential centrifugation.
4. The method for amplifying the grassland caterpillar nuclear polyhedrosis virus according to claim 3, wherein in the step (2), the rotation speed of the differential centrifugation is 4000rpm to 6000rpm, and then the rotation speed is changed to 800rpm to 1000 rpm.
5. The method for amplifying the grassland caterpillar nuclear polyhedrosis virus according to claim 2, wherein the concentration of the grassland caterpillar nuclear polyhedrosis virus A in the step (1) is 1X 103PIB/mL～1×108PIB/mL; in the step (3), the concentration of the grassland caterpillar nuclear polyhedrosis virus B is 1X 103PIB/mL～1×108PIB/mL。
6. The method for amplifying the prairie caterpillar nuclear polyhedrosis virus of claim 1, wherein in step (1), the obtaining of the larvae of spodoptera exigua comprises: and (3) putting the beet noctuid eggs in a constant-temperature incubator, incubating, and artificially feeding beet noctuid larvae to 3 years old.
7. The method for amplifying prairie caterpillar nuclear polyhedrosis virus according to claim 1, wherein obtaining prairie caterpillar nuclear polyhedrosis virus a comprises:
(a) collecting 2-instar grassland caterpillar larvae, and feeding the caterpillar larvae with elymus nutans and meadow bluegrass to 3 instar;
(b) coating the stock solution of the grassland caterpillar nuclear polyhedrosis virus on elymus nutans and poa pratensis, feeding the larvae of the grassland caterpillar by using the elymus nutans and the poa pratensis for a period of time, and feeding the larvae of the grassland caterpillar by using normal feed until the larvae of the grassland caterpillar die;
(c) extracting prairie caterpillar nuclear polyhedrosis virus A from dead corpses of prairie caterpillar larvae.
8. The method for amplifying prairie caterpillar nuclear polyhedrosis virus of claim 2, further comprising the step (5) of verifying prairie caterpillar nuclear polyhedrosis virus, comprising the steps of:
(51) extracting the genome of the grassland caterpillar nuclear polyhedrosis virus;
(52) the genome of the grassland caterpillar nuclear polyhedrosis virus is taken as a template, and a primer polyhedrin-F: CGTGCACTCGAATAGCATGT and polyhedrin-R: GAATACAGGGGCGCATCGG, performing PCR verification;
(52) detecting the amplification product.
9. A grassland caterpillar nuclear polyhedrosis virus obtained by the method for amplifying the grassland caterpillar nuclear polyhedrosis virus according to any one of claims 1 to 8, wherein the grassland caterpillar nuclear polyhedrosis virus is deposited at the collection of typical cultures in china at 7/18 of 2019 under the following deposit numbers: CCTCC NO: V201951.
10. An application of beet armyworm larva in amplifying grassland caterpillar nuclear polyhedrosis virus is disclosed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910705079.0A CN110669737A (en) | 2019-07-31 | 2019-07-31 | Method for amplifying grassland caterpillar nuclear polyhedrosis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910705079.0A CN110669737A (en) | 2019-07-31 | 2019-07-31 | Method for amplifying grassland caterpillar nuclear polyhedrosis virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110669737A true CN110669737A (en) | 2020-01-10 |
Family
ID=69068690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910705079.0A Pending CN110669737A (en) | 2019-07-31 | 2019-07-31 | Method for amplifying grassland caterpillar nuclear polyhedrosis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669737A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112471079A (en) * | 2020-12-11 | 2021-03-12 | 兰州大学 | Indoor artificial feeding method for Qinghai-Tibet plateau grassland caterpillars |
| CN113940363A (en) * | 2021-11-03 | 2022-01-18 | 江西省科学院微生物研究所 | Tea caterpillar nuclear polyhedrosis virus gaga-sea strain EupsNPV-Gr, biological control agent and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589691A (en) * | 2013-10-28 | 2014-02-19 | 中国农业科学院茶叶研究所 | Production method for euproctis pseudoconspersa nuclear polyhedrosis virus |
| CN105779399A (en) * | 2016-03-28 | 2016-07-20 | 广西壮族自治区林业科学研究院 | Insect baculovirus purification method |
-
2019
- 2019-07-31 CN CN201910705079.0A patent/CN110669737A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589691A (en) * | 2013-10-28 | 2014-02-19 | 中国农业科学院茶叶研究所 | Production method for euproctis pseudoconspersa nuclear polyhedrosis virus |
| CN105779399A (en) * | 2016-03-28 | 2016-07-20 | 广西壮族自治区林业科学研究院 | Insect baculovirus purification method |
Non-Patent Citations (2)
| Title |
|---|
| 周敏砚等编著: "《生物防治指南》", 31 December 1994, 出版社：东北大学出版社 * |
| 王金昌等: "GrNPV 病毒的扩增及与生物农药的复配", 《生物化工》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112471079A (en) * | 2020-12-11 | 2021-03-12 | 兰州大学 | Indoor artificial feeding method for Qinghai-Tibet plateau grassland caterpillars |
| CN113940363A (en) * | 2021-11-03 | 2022-01-18 | 江西省科学院微生物研究所 | Tea caterpillar nuclear polyhedrosis virus gaga-sea strain EupsNPV-Gr, biological control agent and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fukatsu et al. | Isolation, Inoculation to Insect Host, and Molecular Phylogeny of an Entomogenous FungusPaecilomyces tenuipes | |
| CN108018242B (en) | A kind of serratia marcescens and its separation method and application | |
| CN109777743B (en) | Entomogenous fungus strain SB009 with high pathogenic capability to bemisia tabaci and application thereof | |
| McKee et al. | The transmission of European foulbrood (Melissococcus plutonius) to artificially reared honey bee larvae (Apis mellifera) | |
| CN111117972A (en) | Domestication method and application of nuclear polyhedrosis virus suitable for spodoptera frugiperda | |
| CN110669737A (en) | Method for amplifying grassland caterpillar nuclear polyhedrosis virus | |
| CN114806885B (en) | Spodoptera frugiperda microsporidian CT-WB2022 and application thereof | |
| CN113215039A (en) | Lactobacillus W8173 and application thereof | |
| CN113265350B (en) | Bifidobacterium W8118 and application thereof | |
| CN111607570B (en) | Novel oleander hornworm cytoplasmic polyhedrosis virus and application thereof | |
| Vung et al. | Breeding and selection for resistance to sacbrood virus for Apis cerana | |
| CN112746025A (en) | Beauveria bassiana preparation as well as preparation method and use method thereof | |
| CN109810907B (en) | Beauveria bassiana BbJ L-01 with strong pathogenicity on terminal-age larvae of cryptomeria fortunei caterpillars | |
| CN109136101B (en) | Fungus strain and application thereof | |
| Wilson | Pathogens and parasites of terrestrial molluscs | |
| CN112342199A (en) | Spodoptera frugiperda virus-resistant pesticide production strain and preparation method and application thereof | |
| CN110759983A (en) | Recombinant fungus expressed by targeted silent pest pattern recognition protein GNBP3 gene and application thereof in pest control | |
| Darsouei et al. | Natural enemies of the sugar beet army worm, Spodoptera exigua (Lepidoptera: Noctuidae) in Northeast Iran | |
| CN115197855A (en) | Beauveria bassiana, beauveria bassiana and Spodoptera frugiperda egg parasitic wasp combination and application thereof | |
| Perumal et al. | First report on the enzymatic and immune response of Metarhizium majus bag formulated conidia against Spodoptera frugiperda: An ecofriendly microbial insecticide | |
| CN110055182B (en) | Entomogenous fungus strain SP433 with high pathogenic capability to bemisia tabaci and application thereof | |
| Demir et al. | A highly effective nucleopolyhedrovirus against Malacosoma spp.(Lepidoptera: Lasiocampidae) from Turkey: isolation, characterization, phylogeny, and virulence | |
| Marsberg | The isolation and genetic characterisation of a novel alphabaculovirus for the microbial control of Cryptophlebia peltastica and closely related tortricid pests | |
| CN111117971A (en) | Domestication method and application of nuclear polyhedrosis virus suitable for yellow poplar silk wild borer | |
| Zhang et al. | Microbial ecology and association of Bacillus thuringiensis in chicken feces originating from feed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20200110 |
|
| WD01 | Invention patent application deemed withdrawn after publication |