CN110438221B - Detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs - Google Patents
Detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs Download PDFInfo
- Publication number
- CN110438221B CN110438221B CN201810419739.4A CN201810419739A CN110438221B CN 110438221 B CN110438221 B CN 110438221B CN 201810419739 A CN201810419739 A CN 201810419739A CN 110438221 B CN110438221 B CN 110438221B
- Authority
- CN
- China
- Prior art keywords
- utx
- lymphoma
- chemotherapeutic
- agent
- predicting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4738—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
- A61K31/4745—Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Pathology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Zoology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Hospice & Palliative Care (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- General Engineering & Computer Science (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of curative effect prediction and evaluation of antitumor drugs, and particularly relates to a detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs. The invention discloses a biomarker and a detection method which can be used for predicting and evaluating the curative effect of lymphomas on chemotherapeutic drugs cytarabine, PD-0332991, MTX, CPT and the like; specific methods and primer information for performing prediction and evaluation of the efficacy of lymphomas on chemotherapeutic agents cytarabine, PD-0332991, mtx, cpt, and the like are disclosed. The invention can be used for predicting and evaluating the curative effects of lymphomas on chemotherapeutic drugs such as cytarabine, PD-0332991, MTX, CPT and the like, and has important significance on the selection of the chemotherapeutic drugs of the lymphomas and the real-time monitoring of the administration of the chemotherapeutic drugs.
Description
Technical Field
The invention belongs to the field of curative effect prediction and evaluation of antitumor drugs, and particularly relates to a detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs.
Background
B-cell non-Hodgkin's lymphoma (B-NHL) is the major type of lymphoma, with diffuse large B-cell lymphoma (DLBCL) occurring at the highest rate in B-NHL. Clinically, although the golden chemotherapy regimen CHOP/R-CHOP of lymphomas can substantially cure 60% of DLBCL patients, 40% of DLBCL patients still do not respond to CHOP/R-CHOP treatment regimens, most of these patients are further detected at the late stage of treatment (4.7-9.0 months) for lymphomas that violate the CNS, and if CNS violations occur, the treatment efficacy of such patients is highly undesirable with a subsequent survival of only 2-5 months.
The cause of this phenomenon may be related to the genotype of the patient. Whether or not UTX deficiency would cause a change in tumor cell response to certain antitumor drugs? In this regard, no report has been made yet.
Disclosure of Invention
In order to overcome the problems in the prior art, the invention aims to provide a detection kit for predicting and evaluating the curative effect of lymphoma on chemotherapeutic drugs.
In order to achieve the above and other related objects, the present invention adopts the following technical scheme:
in a first aspect of the invention there is provided the use of UTX for the preparation or screening of an agent for predicting and/or assessing the effect of a chemotherapeutic agent on treatment of lymphoma.
In one embodiment, UTX is used as a biomarker.
In one embodiment, the lymphoma is UTX-deficient lymphoma.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, the chemotherapeutic agent is selected from Ara-C, PD-0332991, MTX, CPT.
It should be noted that Ara-C has a Chinese name of cytarabine and CAS number 147-94-4.PD-0332991 has the Chinese name CDK4/6 kinase inhibitor and CAS number 571190-30-2.MTX Chinese name methotrexate, CAS number 59-05-2.CPT has the Chinese name camptothecine and CAS number 7689-03-4.
In one embodiment, the agent is used in the selection of a lymphoma treatment regimen.
In one embodiment, the agent is used in the selection of a lymphoma chemotherapeutic regimen.
In one embodiment, the agent is used in the selection of a chemotherapeutic agent for lymphoma.
It should be noted that the reagent in the present invention includes, but is not limited to, liquid form.
In one embodiment, the agent that predicts and/or evaluates the effect of a chemotherapeutic agent on lymphoma treatment is an agent that specifically recognizes UTX.
In one embodiment, agents that specifically recognize UTX are prepared or screened based on said UTX as agents for predicting and/or evaluating the effect of chemotherapeutic agents on lymphoma treatment.
In one embodiment, the agent that specifically recognizes UTX is selected from an agent that specifically recognizes the UTX gene or an agent that specifically recognizes the UTX protein.
In one embodiment, agents that specifically recognize the UTX gene are prepared or screened based on the gene sequence of said UTX, as agents for predicting and/or evaluating the effect of chemotherapeutic agents on lymphoma treatment.
In one embodiment, the agent that specifically recognizes the UTX gene is selected from any one or more of the following:
(1) Primers that specifically amplify UTX genes or transcripts;
(2) Probes specifically recognizing UTX genes or transcripts.
In one embodiment, agents that specifically recognize the UTX protein are prepared or screened based on the protein sequence of said UTX, as agents for predicting and/or evaluating the therapeutic effect of chemotherapeutic agents on lymphomas.
In one embodiment, the agent that specifically recognizes the UTX protein is an antibody or ligand to the UTX protein.
In one embodiment, the antibodies include monoclonal antibodies and polyclonal antibodies.
In one embodiment, the agent specifically recognizing UTX is prepared or screened based on the UTX, and the level of UTX in a lymphoma patient is detected, and if UTX is not expressed, is reduced or knocked out, the lymphoma patient is treated with Ara-C, PD-0332991, MTX, CPT and other chemotherapeutic drugs with good treatment effect.
In a second aspect of the invention there is provided the use of an agent that specifically recognizes UTX for the manufacture of a kit for predicting and/or assessing the effect of a chemotherapeutic agent on treatment of lymphoma.
In one embodiment, UTX is used as a biomarker.
In one embodiment, the lymphoma is UTX-deficient lymphoma.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, the chemotherapeutic agent is selected from Ara-C, PD-0332991, MTX, CPT.
In one embodiment, the kit is used for the selection of a lymphoma treatment regimen.
In one embodiment, the kit is used for the selection of lymphoma chemotherapeutic regimen.
In one embodiment, the kit is used for the selection of lymphoma chemotherapeutic agents.
It should be noted that the reagent in the present invention includes, but is not limited to, liquid form.
In one embodiment, the agent that specifically recognizes UTX is selected from an agent that specifically recognizes the UTX gene or an agent that specifically recognizes the UTX protein.
In one embodiment, the agent that specifically recognizes the UTX gene is selected from any one or more of the following:
(1) Primers that specifically amplify UTX genes or transcripts;
(2) Probes specifically recognizing UTX genes or transcripts.
In one embodiment, the agent that specifically recognizes the UTX protein is an antibody or ligand to the UTX protein.
In one embodiment, the antibodies include monoclonal antibodies and polyclonal antibodies.
In one embodiment, the level of UTX in a patient with lymphoma can be detected using an agent that specifically recognizes UTX, and if UTX is not expressed, expressed is reduced or knocked out, the patient with lymphoma is treated with Ara-C, PD-0332991, MTX, CPT, or other chemotherapeutic agents.
In a third aspect of the invention there is provided a kit for predicting and/or assessing the effect of a chemotherapeutic agent on treatment of lymphoma, said kit comprising at least one agent which specifically recognizes UTX.
It should be noted that the reagent in the present invention includes, but is not limited to, liquid form.
In one embodiment, the agent that specifically recognizes UTX is selected from an agent that specifically recognizes the UTX gene or an agent that specifically recognizes the UTX protein.
In one embodiment, the agent that specifically recognizes the UTX gene is selected from any one or more of the following:
(1) Primers that specifically amplify UTX genes or transcripts;
(2) Probes specifically recognizing UTX genes or transcripts.
In one embodiment, the agent that specifically recognizes the UTX protein is an antibody or ligand to the UTX protein.
In one embodiment, the antibodies include monoclonal antibodies and polyclonal antibodies.
In one embodiment, UTX is used as a biomarker.
In one embodiment, the lymphoma is UTX-deficient lymphoma.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, the chemotherapeutic agent is selected from Ara-C, PD-0332991, MTX, CPT.
In one embodiment, the kit is used for the selection of a lymphoma treatment regimen.
In one embodiment, the kit is used for the selection of lymphoma chemotherapeutic regimen.
In one embodiment, the kit is used for the selection of lymphoma chemotherapeutic agents.
In a fourth aspect of the invention, there is provided the use of Ara-C for the manufacture of a medicament for the treatment of UTX-deficient lymphomas.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, ara-C is the sole active ingredient or one of the active ingredients of the therapeutic agent.
In one embodiment, the level of UTX in a patient with lymphoma can be detected using an agent that specifically recognizes UTX, and if UTX is not expressed, expressed is reduced or knocked out, the patient with lymphoma is treated with Ara-C, PD-0332991, MTX, CPT, or other chemotherapeutic agents.
In a fifth aspect of the invention there is provided the use of PD-0332991 for the manufacture of a medicament for the treatment of UTX-deficient lymphomas.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, PD-0332991 is the sole active ingredient or one of the active ingredients of the therapeutic agent.
In a sixth aspect of the invention, there is provided the use of MTX for the manufacture of a medicament for the treatment of UTX-deficient lymphomas.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, MTX is the sole active ingredient or one of the active ingredients of the therapeutic agent.
In a seventh aspect of the invention there is provided the use of CPT for the manufacture of a medicament for the treatment of UTX-deficient lymphomas.
The term "UTX-deficient lymphoma" refers to lymphoma in which UTX is not expressed, expressed is reduced, or knocked out.
In one embodiment, CPT is the sole active ingredient or one of the active ingredients of the therapeutic agent.
Compared with the prior art, the invention has the following beneficial effects:
the invention discloses a biomarker and a detection method which can be used for predicting and evaluating the curative effect of lymphomas on chemotherapeutic drugs cytarabine, PD-0332991, MTX, CPT and the like; specific methods and primer information for performing prediction and evaluation of the efficacy of lymphomas on chemotherapeutic agents cytarabine, PD-0332991, mtx, cpt, and the like are disclosed. The invention can be used for predicting and evaluating the curative effects of lymphomas on chemotherapeutic drugs such as cytarabine, PD-0332991, MTX, CPT and the like, and has important significance on the selection of the chemotherapeutic drugs of the lymphomas and the real-time monitoring of the administration of the chemotherapeutic drugs.
Drawings
Fig. 1: respectively transfecting shCtrl, shUtx-1 and shUtx-2 retrovirus vectors into a retrovirus packaging cell line phoenix cell, and infecting E mu-Myc by a centrifugal method; after p19 Arf-/-cells, quantitative PCR was used to detect the results of expression levels of UTX in the cells.
Fig. 2A: sensitivity screening of UTX-deficient lymphoma cells for various drugs by a drug sensitivity screening experimental system, namely GFP competition experiments, sensitivity detection of the UTX-knocked down lymphoma cells for various chemotherapeutic drugs shows that the UTX-knocked down lymphoma cells are more sensitive to cytarabine AraC, PD-0332991, MTX and CPT.
Fig. 2B: the sensitivity of UTX-deleted lymphoma cells to various drugs is screened, and the result of verification of the protein level on the down-knocking of the UTX gene mediated by shRNA shows that the shRNA specifically knocks down the protein expression level of the UTX gene in the cells.
Fig. 2C: sensitivity screening of UTX-deficient lymphoma cells for various drugs the results of FIG. 2A were confirmed by drug sensitivity assays performed at different concentrations of Ara-C, PD-0332991, MTX, CPT.
Fig. 2D: in vivo efficacy of the UTX knockdown lymphoma cells in response to chemotherapeutic drugs Ara-C, PD-0332991, MTX, CPT was tested by lymphoma transplantation experiments, and the results of experiments in which the control group and drug treatment group tested the growth of lymphoma in recipient mice by touching the axillary lymph node after 12 days of treatment showed fewer lymphomas to occur in the UTX knockdown lymphoma drug treatment group and more effective response to drug treatment than in the non-UTX knockdown lymphoma.
Fig. 2E: survival curve results after drug treatment of mice transplanted with lymphomas without UTX show that the drug-treated mice have no significant difference in survival time compared to controls.
Fig. 2F: survival curve results after drug treatment of recipient mice transplanted with independent UTX-1 mediated UTX knockdown lymphomas show that compared with a control, the drug-treated mice have obviously prolonged survival time, and UTX-low-expression lymphomas are more sensitive to chemotherapeutic drugs Ara-C, PD-0332991, MTX and CPT.
Fig. 2G: survival curve results after drug treatment of mice transplanted with independent shUTX 2-mediated UTX knockdown lymphomas show that compared with a control, the drug-treated mice have obviously prolonged survival time, and UTX-low-expression lymphomas are more sensitive to chemotherapeutic drugs Ara-C, PD-0332991, MTX and CPT.
Detailed Description
The inventor of the application works in the early stage to establish a high-efficiency functional genetic screening system at a cell level, firstly, the functional genetic screening system utilizes RNAi technology to construct a cell line for stably knocking down specific genes so as to simulate cancer related genes with high-frequency deletion mutation in human cancers, then, a plurality of different types of antitumor drugs are screened through GFP competition experiments, and according to experimental results, objective and accurate prediction and evaluation are carried out on the influence of the genes in response of cancer cells to the antitumor drugs.
GFP competition experiments mainly use GFP as a marker, inhibit the expression of a target gene in cells stably for a long time by an shRNA technology, add drug pressure in the same system, detect the common proliferation difference of GFP positive and negative cell groups, and finally detect the change of the proportion of GFP positive cells before and after drug treatment, and can quantitatively and accurately describe and evaluate the influence of a certain gene in anti-tumor drug response by means of a drug Resistance Index (RI) through calculation.
To identify whether UTX depletion would cause altered tumor cell responses to certain antitumor drugs, the inventors of the present application employed a genetically functional drug screening system at E μ -Myc; in p19 Arf-/-mouse lymphoma cells, drug response assays were performed on a number of different mechanisms of anti-tumor drugs. The principle of a genetic functional drug screening system adopted by the inventor is based on GFP competition experiments, firstly, mouse lymphoma cells are infected by shRNA virus with GFP co-expression, the infection efficiency, namely the proportion of GFP positive cells, is controlled to be 30% -50%, then, antitumor drugs with certain killing concentration are used for treatment, finally, the change of the proportion of GFP positive cells before and after the drug treatment is detected, and the influence of a certain gene in antitumor drug response can be quantitatively and accurately described and evaluated by means of drug Resistance Index (RI) through calculation. Wherein the gene bank accession number of the UTX gene is 7403.
The chemotherapeutic agent Ara-C (chinese name cytarabine), a first-line drug for clinical treatment of leukemia and lymphoma, is a cytosine ribonucleoside analogue that kills tumor cells by interfering with nucleic acid anabolism, inhibiting RNA and DNA metabolism in rapidly proliferating tumor cells. Cytarabine Ara-C can cross the blood brain barrier at high concentration and has a certain killing effect on lymphoma, so that the cytarabine Ara-C is clinically used for treating malignant lymphoma, especially lymphoma which invades the CNS of the central nervous system.
PD-0332991 has the Chinese name CDK4/6 kinase inhibitor (targeting agent).
MTX Chinese name methotrexate.
The chinese name of CPT is camptothecin.
The detection result of the detection method of the invention can evaluate the sensibility of the four chemotherapeutic drugs, and can theoretically evaluate similar drugs with the same structural and functional mechanisms as the four chemotherapeutic drugs.
According to the invention, through genetic screening research, the gene UTX-deficient lymphoma is identified to be abnormally sensitive to chemotherapeutic drugs cytarabine, PD-0332991, CPT and MTX, and can be used as a molecular detection index for clinically predicting and evaluating the curative effects of the lymphoma on the chemotherapeutic drugs cytarabine, PD-0332991, CPT and MTX, and has important guiding significance for drug selection of lymphoma treatment.
Before the embodiments of the invention are explained in further detail, it is to be understood that the invention is not limited in its scope to the particular embodiments described below; it is also to be understood that the terminology used in the examples of the invention is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the invention. The test methods in the following examples, in which specific conditions are not noted, are generally conducted under conventional conditions or under conditions recommended by the respective manufacturers.
Where numerical ranges are provided in the examples, it is understood that unless otherwise stated herein, both endpoints of each numerical range and any number between the two endpoints are significant both in the numerical range. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, materials used in the embodiments, any methods, devices, and materials of the prior art similar or equivalent to those described in the embodiments of the present invention may be used to practice the present invention according to the knowledge of one skilled in the art and the description of the present invention.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed in the present invention employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, and related arts. These techniques are well described in the prior art literature and see, in particular, sambrook et al MOLECULAR CLONING: a LABORATORY MANUAL, second edition, cold Spring Harbor Laboratory Press,1989and Third edition,2001; ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, john Wiley & Sons, new York,1987and periodic updates; the series METHODS IN ENZYMOLOGY, academic Press, san Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, third edition, academic Press, san Diego,1998; METHODS IN ENZYMOLOGY, vol.304, chromatin (p.m. wassman and a.p. wolffe, eds.), academic Press, san Diego,1999; and METHODS IN MOLECULAR BIOLOGY, vol.119, chromatin Protocols (p.b. becker, ed.) Humana Press, totowa,1999, etc.
Example 1
1. Materials and methods
1. shRNA vector design and construction for Utx gene:
the shRNA sequence aiming at the Utx gene is obtained through website design, the length of the shRNA sequence is 97 oligonucleotides, and the shRNA sequence is cloned to an MLP vector by introducing XhoI and EcoRI restriction sites through PCR amplification.
The shRNA sequence design is shown in table 1:
TABLE 1
The shRNA sequence information for the Utx gene is as follows:
mouse shUtx-1-1395 (also denoted as shUtx-1):
TGCTGTTGACAGTGAGCGCTACAGGCAATCTATTGATAAATAGTGAAGCCACAGATGTATTTATCAATAGATTGCCTGTAATGCCTACTGCCTCGGA(SEQ ID NO.5)；
mouse shUtx-2-3921 (also denoted as shUtx-2):
TGCTGTTGACAGTGAGCGAAACCTTGAAGATCTATATGAATAGTGAAGCCACAGATGTATTCATATAGATCTTCAAGGTTGTGCCTACTGCCTCGGA(SEQ ID NO.6)。
in addition, shCtrl is used as a control, shCtrl is used as an empty plasmid, and shUTX is cloned as a target plasmid, and no shRNA sequence exists in cloning sites.
2. Retroviral preparation
By CaCl 2 Method shCtrl, shUtx-1, shUtx-2 retroviral vectors were transfected into retroviral packaging cell line phoenix cells, respectively, after 48 hours the viral supernatant was harvested, E.mu. -Myc was infected by centrifugation using 8ug/ml polybrene; p19 Arf-/-cells. The infection efficiency was confirmed by detecting the GFP proportion of the infected cells by BD Accuri C6 flow cytometry 48 hours after infection, and the GFP positive cell proportion was controlled to be 30% -50% by adjusting the virus volume in the drug sensitivity experiment.
Respectively transfecting shCtrl, shUtx-1 and shUtx-2 retrovirus vectors into a retrovirus packaging cell line phoenix cell, and infecting E mu-Myc by a centrifugal method; after p19 Arf-/-cells, the results of quantitative PCR detection of the expression level of UTX in the cells are shown in FIG. 1, and UTX-deleted lymphoma cells were successfully obtained for subsequent experiments.
The PCR primer sequences of human and mouse are shown in Table 2:
TABLE 2
Supplementary to this is: e [ mu ] -Myc; the p19 Arf-/-cell is a mouse lymphoma cell line, obtainable from E.mu. -Myc; the p19 Arf-/-strain was isolated from lymphoma in spontaneous lymphoma mice. These are all known from the prior art.
2. GFP Competition assay
The information on the antitumor drugs used in the study is shown in table 3 below:
TABLE 3 Table 3
* Drug concentration refers to a concentration that kills 80% -90%.
The prepared retrovirus infects E mu-Myc; after p19 Arf-/-cells, the proportion of GFP positive cells was between 30% and 50%. 100ul of 2x10 was added to a 48-well plate 6 Per ml of cells, 100ul of the corresponding concentration of the drug (as shown in Table 2) was added simultaneously, 200ul of the culture solution was supplemented for 24 hours, 400ul of the culture solution was supplemented for 48 hours, 200ul of the cells were taken for 72 hours, 2ul of 0.5ug/ml Propidium Iodide (PI) was added, and after 5 minutes of staining, the on-machine detection was performed, and the proportion of GFP cells in the living cells was detected using BD Accuri C6 flow cytometer.
To compare the relative levels of resistance and sensitivity of cells to chemotherapeutic agents after gene knockdown, we introduced a relative Resistance Index (RI) to accurately analyze the results of GFP competition experiments. First we refer to the RI value as X, the biological meaning of factor X is that in a mix of infected and uninfected (knockdown and non-knockdown) cells, the infected cells are X times more tolerant to drug treatment than the uninfected cells.
If 1/N of uninfected cells survive a drug treatment, then the infected cells should have X/N cell survival, if the total number of uninfected and infected cells is defined as T, the GFP ratio of uninfected cells without drug treatment is G1, then the number of surviving uninfected cells N (un) is T (1-G1) X1/N, and the number of surviving infected cells N (in) is T X G1X/N. The GFP ratio G2 of the surviving cell population after drug treatment should therefore be calculated as N (in)/(N (un) +n (in)), from this formula we can calculate x= (G2-G1X G2)/(G1-G1X G2).
The results are shown in FIG. 2A, and the sensitivity of the UTX knockdown lymphoma cells to various chemotherapeutics is detected by a drug sensitivity screening experiment system, namely GFP competition experiment, and the experiment results show that the UTX knockdown lymphoma cells are more sensitive to cytarabine Ara-C, PD-0332991, MTX and CPT.
As shown in fig. 2B, the experimental results of the verification of the shRNA mediated knockdown of the UTX gene at the protein level show that shRNA specifically knockdown the protein expression level of the UTX gene in the cell.
As shown in FIG. 2C, the results of FIG. 2A were confirmed by drug susceptibility testing with different concentrations of Ara-C, PD-0332991, MTX, CPT.
In conclusion, through a drug sensitivity screening method, it is found that UTX-deleted lymphoma cells are abnormally sensitive to cytarabine Ara-C, PD-0332991, MTX and CPT drugs, and further verified that UTX-deleted lymphoma cells all show a phenotype of being more sensitive to cytarabine Ara-C, PD-0332991, MTX and CPT drugs at a plurality of drug concentrations. This finding suggests that analysis of UTX expression levels can predict the response effect of lymphoma cells to the chemotherapeutic drug cytarabine.
3. Lymphoma transplantation experiments and drug treatment
By tail vein injection, 200ul of 2x10 is injected into each mouse 6 Corresponding to lymphoma single cell suspensions, mice were observed for status 3 times per week after two weeks. Drug treatment, the experimental group was administered in 200mg/kg/d Cytarabine, intraperitoneally, and continuously at 11 th to 15 th days after lymphoma transplantation, for 5 days, and the experimental group was given the corresponding volume of PBS.
Results as shown in fig. 2D, in vivo efficacy of the UTX knockdown lymphoma cells in response to chemotherapeutic agents Ara-C, PD-0332991, mtx, cpt was tested by lymphoma transplantation experiments, and after 12 days of treatment, control and drug treatment groups tested for lymphoma growth in recipient mice by touching the axillary lymph node, and the results showed fewer lymphomas to occur in the UTX knockdown lymphoma drug treatment group and more effective response to drug treatment than in the non-UTX knockdown lymphoma.
As shown in fig. 2E, the survival curve results of mice transplanted with lymphoma without UTX knockdown after drug treatment show that the drug-treated mice have no significant difference in survival time compared to the control.
As shown in fig. 2F, the survival curve results after drug treatment of recipient mice transplanted with UTX knockdown lymphoma mediated by independent hutx-1 show that drug-treated mice have significantly prolonged survival compared to controls, and UTX-low-expressing lymphomas are more sensitive to the chemotherapeutic agent Ara-C.
As shown in fig. 2G, the survival curve results after drug treatment of recipient mice transplanted with UTX knockdown lymphoma mediated by independent hutx2 show that drug-treated mice have significantly prolonged survival compared to controls, and UTX-low-expressing lymphomas are more sensitive to the chemotherapeutic agent Ara-C.
In conclusion, it is further verified that UTX-deficient lymphoma cells are abnormally sensitive to cytarabine Ara-C drugs at animal levels by lymphoma transplantation experiments and drug therapy in vivo experiments. This finding further suggests that analysis of the expression levels of UTX can predict the response effect of lymphoma cells to the chemotherapeutic drug cytarabine.
While the invention has been described with respect to preferred embodiments thereof, it will be understood by those skilled in the art that various modifications and additions may be made without departing from the scope of the invention. Equivalent embodiments of the present invention will be apparent to those skilled in the art having the benefit of the teachings disclosed herein, when considered in the light of the foregoing disclosure, and without departing from the spirit and scope of the invention; meanwhile, any equivalent changes, modifications and evolution of the above embodiments according to the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Sequence listing
<110> Shanghai life science institute of China academy of sciences
<120> detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs
<130> 182364
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
tctacaggca atctattgat aa 22
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
atttatcaat agattgcct 19
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
taaaccttga agatctatat ga 22
<210> 4
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
attcatatag atcttcaag 19
<210> 5
<211> 97
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
tgctgttgac agtgagcgct acaggcaatc tattgataaa tagtgaagcc acagatgtat 60
ttatcaatag attgcctgta atgcctactg cctcgga 97
<210> 6
<211> 97
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tgctgttgac agtgagcgaa accttgaaga tctatatgaa tagtgaagcc acagatgtat 60
tcatatagat cttcaaggtt gtgcctactg cctcgga 97
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
gaaggtgaag gtcggagtca ac 22
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cagagttaaa agcagccctg gt 22
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
aggtcggtgt gaacggattt g 21
<210> 12
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
ggggtcgttg atggcaaca 19
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
Claims (8)
1. Use of shRNA directed against UTX gene for the preparation of a reagent for screening, predicting and/or evaluating the effect of a chemotherapeutic drug on B-cell lymphoma;
the chemotherapeutic drug is selected from Ara-C or PD-0332991.
2. The use according to claim 1, wherein the agent is used for the selection of a B-cell lymphoma treatment regimen.
3. The use according to claim 1, wherein the agent is used for the selection of a B cell lymphoma chemotherapeutic regimen.
4. The use according to claim 1, wherein the agent is used for the selection of a B-cell lymphoma chemotherapeutic agent.
5. Use of a reagent that specifically recognizes the UTX gene for the preparation of a kit for predicting and/or evaluating the effect of a chemotherapeutic agent on B-cell lymphoma;
the chemotherapeutic drug is selected from Ara-C or PD-0332991; the reagent for specifically recognizing the UTX gene is shRNA aiming at the UTX gene.
6. The use according to claim 5, wherein the kit is used for the selection of a B-cell lymphoma treatment regimen.
7. The use according to claim 5, wherein the kit is used for the selection of a B-cell lymphoma chemotherapeutic regimen.
8. The use according to claim 5, wherein the kit is used for the selection of B-cell lymphoma chemotherapeutic drugs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810419739.4A CN110438221B (en) | 2018-05-04 | 2018-05-04 | Detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810419739.4A CN110438221B (en) | 2018-05-04 | 2018-05-04 | Detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438221A CN110438221A (en) | 2019-11-12 |
| CN110438221B true CN110438221B (en) | 2023-06-06 |
Family
ID=68427040
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810419739.4A Active CN110438221B (en) | 2018-05-04 | 2018-05-04 | Detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438221B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101470112A (en) * | 2007-12-28 | 2009-07-01 | 上海交通大学医学院附属瑞金医院 | Molecular marker for treatment guidance and prognosis judgment of diffuse large B cell lymphoma |
| WO2012090073A2 (en) * | 2010-12-30 | 2012-07-05 | The Netherlands Cancer Institute | Methods and compositions for predicting chemotherapy sensitivity |
| WO2014190035A2 (en) * | 2013-05-21 | 2014-11-27 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for identification, assessment, prevention, and treatment of cancer using histone h3k27me2 biomarkers and modulators |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3119390A4 (en) * | 2014-03-21 | 2017-09-20 | Glaxosmithkline Intellectual Property (No. 2) Limited | Methods of treating cancer |
| US10206930B2 (en) * | 2015-08-14 | 2019-02-19 | New York University | Methods for treating T-cell acute lymphoblastic leukemia |
-
2018
- 2018-05-04 CN CN201810419739.4A patent/CN110438221B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101470112A (en) * | 2007-12-28 | 2009-07-01 | 上海交通大学医学院附属瑞金医院 | Molecular marker for treatment guidance and prognosis judgment of diffuse large B cell lymphoma |
| WO2012090073A2 (en) * | 2010-12-30 | 2012-07-05 | The Netherlands Cancer Institute | Methods and compositions for predicting chemotherapy sensitivity |
| WO2014190035A2 (en) * | 2013-05-21 | 2014-11-27 | Dana-Farber Cancer Institute, Inc. | Compositions and methods for identification, assessment, prevention, and treatment of cancer using histone h3k27me2 biomarkers and modulators |
Non-Patent Citations (6)
| Title |
|---|
| Epstein-Barr virus-negative extranodal "true" natural killer-cell lymphoma harbouring a KDM6A mutation;Naoko Tsuyama等;《Hematological oncology》;20170710;第36卷(第1期);第328-335页 * |
| H3K27me3和EZH2在弥漫大B细胞淋巴瘤疗效预测中的意义;邓玉洁等;《中国实验血液学杂志》;20180220;第26卷(第1期);第159-165页 * |
| The H3K27me3 demethylase UTX is a gender-specific tumor suppressor in T-cell acute lymphoblastic leukemia;Joni Van der Meulen等;《Blood》;20141015;第125卷(第1期);第13-21页 * |
| UTX inhibition as selective epigenetic therapy against TAL1-driven T-cell acute lymphoblastic leukemia;Aissa Benyoucef等;《GENES & DEVELOPMENT》;20160301;第30卷(第5期);第508-521页 * |
| 复发/难治性弥漫性大B细胞淋巴瘤靶向药物及免疫治疗研究进展;潘奕彤等;《中南药学》;20180320;第16卷(第3期);第376-381页 * |
| 组蛋白H3K27去甲基化酶UTX在肿瘤研究中的作用;杨贇等;《中国老年学杂志》;20160510;第36卷(第9期);第2278-2280页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438221A (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lochhead et al. | MicroRNA expression shows inflammatory dysregulation and tumor‐like proliferative responses in joints of patients with postinfectious Lyme arthritis | |
| Kim et al. | Identification of novel synergistic targets for rational drug combinations with PI3 kinase inhibitors using siRNA synthetic lethality screening against GBM | |
| US20100310563A1 (en) | Methods for treating induced cellular proliferative disorders | |
| US20130131139A1 (en) | Ror1 as a gene target in acute lymphoblastic leukemia | |
| CN112226510B (en) | Application of MTX1 gene or expression product thereof in preparation of product for diagnosing, preventing or treating liver cancer and related reagent | |
| Huang et al. | MicroRNA miR-126-5p enhances the inflammatory responses of monocytes to lipopolysaccharide stimulation by suppressing cylindromatosis in chronic HIV-1 infection | |
| Zhou et al. | Genome-wide RNAi screen in IFN-γ-treated human macrophages identifies genes mediating resistance to the intracellular pathogen Francisella tularensis | |
| Ju et al. | MicroRNA signature of lung adenocarcinoma with EGFR exon 19 deletion | |
| Li et al. | RIPK2 is an unfavorable prognosis marker and a potential therapeutic target in human kidney renal clear cell carcinoma | |
| Yang et al. | VPS9D1-AS1 overexpression amplifies intratumoral TGF-β signaling and promotes tumor cell escape from CD8+ T cell killing in colorectal cancer | |
| WO2021249355A1 (en) | Biomarker and method for selecting chemotherapy-responsive patient group and use thereof | |
| Yin et al. | Effect of deubiquitinase ovarian tumor domain-containing protein 5 (OTUD5) on radiosensitivity of cervical cancer by regulating the ubiquitination of Akt and its mechanism | |
| Miller et al. | Systemic expression of a viral RdRP protects against retrovirus infection and disease | |
| CN110438221B (en) | Detection kit for predicting and evaluating curative effect of lymphoma on chemotherapeutic drugs | |
| Hojka-Osinska et al. | RNA-Seq-based analysis of differential gene expression associated with hepatitis C virus infection in a cell culture | |
| CN110358834B (en) | Application of lncRNA, kit and medicine | |
| Huang et al. | Identification of crucial genes and prediction of small molecules for multidrug resistance of Hodgkin’s lymphomas | |
| CN105985960B (en) | Medicine for treating or preventing drug-resistant relapse of acute lymphocytic leukemia and application thereof | |
| US20240200140A1 (en) | Compositions and methods for diagnosing and treating cancer | |
| CN116179684B (en) | Application of serum miRNA as interferon treatment response marker for patients with chronic hepatitis B | |
| Emilia et al. | Expression profile of tripartite motif family (TRIM) in human fibroblasts (NHDF) infected with porcine endogenous retrovirus (PERV) | |
| Zhao et al. | Sequence Analysis of Macaca mulatta TRIM4 and Its Role in the Interferon Pathway | |
| Kim et al. | Combinatorial CRISPR screen reveals FYN and KDM4 as targets for synergistic drug combination for treating triple negative breast cancer | |
| WO2023082242A1 (en) | Use of ctd-2256p15.2 and encoding micropeptide thereof as target in development of tumor treatment drug | |
| CN113755599B (en) | Application of GRB7 gene in colorectal cancer diagnosis, prognosis detection and evaluation and medicine preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200417 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Applicant after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai, Xuhui District Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |