CN110272879A - Aldehyde ketone reductase BcAKR and its mutant and application - Google Patents
Aldehyde ketone reductase BcAKR and its mutant and application Download PDFInfo
- Publication number
- CN110272879A CN110272879A CN201910375442.7A CN201910375442A CN110272879A CN 110272879 A CN110272879 A CN 110272879A CN 201910375442 A CN201910375442 A CN 201910375442A CN 110272879 A CN110272879 A CN 110272879A
- Authority
- CN
- China
- Prior art keywords
- mutant
- leu
- aldehyde ketone
- glu
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to field of biotechnology, it is related to aldehyde ketone reductase BcAKR and its mutant and application, the mutant is by wild type Bacillus cereus aldehyde ketone reductase (Bacillus cereus aldo-keto reductase, BcAKR it) sets out and is obtained by mutation, the invention further relates to the preparation method of the aldehyde ketone reductase BcAKR and its mutant.It further relates to the aldehyde ketone reductase BcAKR and its mutant and passes through the reduction for being catalyzed adjacent chlorobenzoyl methyl formate, the method for obtaining S or R configuration secondary alcohols with optical activation.Aldehyde ketone reductase BcAKR and its mutant in the present invention can be catalyzed the available optically pure chiral alcohol of above-mentioned substrate, such as optically pure (R)-o-chloromandelic acid methyl esters, have good application value in chiral alcohol preparation field.
Description
Technical field
The present invention relates to field of biotechnology, are related to aldehyde ketone reductase BcAKR and its mutant and application, the mutant
It is to be gone out by wild type Bacillus cereus aldehyde ketone reductase (Bacillus cereus aldo-keto reductase, BcAKR)
What hair was obtained by mutation, the invention further relates to the preparation methods of the aldehyde ketone reductase BcAKR and its mutant.It further relates to
The aldehyde ketone reductase BcAKR and its mutant are obtained by the reduction of the adjacent chlorobenzoyl methyl formate of catalysis with optics
The method of active S or R configuration secondary alcohols.
Background technique
Clopidogrel is a kind of adenosine diphosphate (ADP) (ADP) receptor blocker, can in conjunction with platelet membrane surface A DP receptor,
Make fibrinogen can not be in conjunction with II b/ of glycoprotein GP, III a receptor, to inhibit platelet aggregation, be mainly used for preventing and control
The heart, brain and other arterial circulation disorder diseases caused by treating because of the aggregation of blood platelet height, have extensive market at home.(R)-neighbour's chlorine
Methyl mandelate (molecular formula o-Cl-C6H4CH(OH)COOCH3, molecular weight 200.62, No. CAS: 32345-59-8) and it is to close
At the important chiral intermediate of clopidogrel, can be obtained by corresponding 2-ketoacid rouge asymmetric reduction.2-ketoacid ester type compound
It is a kind of simple and special compound of structure, there are two carbonyls for tool, and the optics alcohol compound restored is as important
Synthetic intermediate be widely used in chemical industry and field of medicaments.The synthesis of optical activity chirality alcohol has chemical method and biology
Two kinds of method.Compared with chemical method, bioanalysis has reaction condition mild, high conversion rate, enantio-selectivity height etc. a variety of excellent
The application of point, especially the carbonyl asymmetric reduction reaction of biocatalysis in chiral alcohol synthesis is increasingly taken seriously.
Therefore it is directed to above-mentioned compound and its similar compound, finding a kind of carbonyl reductase, can be catalyzed high substrate dense
Highly-solid selectively asymmetric reduction under degree, does not add or adds minute quantity coenzyme, economical and easily available, undoubtedly has extremely heavy
Big meaning.The example that existing document report carries out high concentration of substrate catalysis using aldehyde ketone reductase is such as restored using category aldehyde ketone
The YtbE of enzyme generates clopidogrel intermediate, concentration of substrate up to 500g/L (Tetrahedron Lett 2012,53 (35):
4715-4717)。
Aldehyde ketone reductase (Aldo keto reductases, AKRs) is a kind of dependent on NAD (P)+Oxidoreducing enzyme,
Contain more than 190 members.Its structure is by (α/β)8Barrel-like structure and the area loop are constituted, and activated centre is by loop 4, loop
7 and loop C composition, active site includes Tyr, Asp, Lys and His.Aldehyde ketone reductase is capable of the type of catalysis substrate
Comprising a variety of, such as alditol, steroids, prostaglandin, carbonyls and ketone acid ester type compound etc..From different Pseudomonas
In aldehyde ketone reductase can be catalyzed different types of substrate obtain accordingly with chiral centre redox products, Yi Xieye
Under raw state or the aldehyde ketone reductase after protein modification has obtained reasonable application in chirality pharmaceutical intermediate compound synthesis.
Existing more than 10 aldehyde ketone reductases from different Pseudomonas are characterized at present, therefore, no matter in sphere of learning or in reality
Using in the middle, aldehyde ketone reductase suffers from potential researching value.
However has the aldehyde ketone reductase reported in the literature with high activity and stereoselectivity at present and still occupy the minority.Recently
Have and aldehyde ketone reductase existing for nature be transformed to improve the catalytic performance of aldehyde ketone reductase by protein engineering,
Such as it can be transformed by the area loop to aldehyde ketone reductase to improve the catalytic performance of aldehyde ketone reductase, but successful examples are still
It is less.Therefore it excavates and the demand that aldehyde ketone reductase is transformed to improve its catalytic performance is more urgent.
The aldehyde ketone reductase BcAKR from bacillus cereus that this laboratory is obtained by gene excavating, passes through reason
Property design and Study on Directed Evolution of Proteins improve the activity and stereoselectivity of the enzyme, realize the biocatalysis of optically pure chiral alcohol
Preparation has highly important application value.
Summary of the invention
In order to overcome the drawbacks of the prior art, it the present invention provides a kind of aldehyde ketone reductase BcAKR, additionally provides by right
The reduction enzyme mutant that the aldehyde ketone reductase is mutated, the aldehyde ketone reductase BcAKR and mutant can be improved
Its enantioselectivity and activity to 2-ketoacid ester type compound makes to restore to obtain corresponding chiral alcohol route by aldehyde ketone reductase
Efficiently, feasible.
The present invention provides aldehyde ketone reductase BcAKR, are determined as the reduction of wild type Bacillus cereus aldehyde ketone by sequencing
Enzyme, sequence is as shown in SEQ ID NO.1.
The present invention also provides by wild type Bacillus cereus aldehyde ketone reductase (BcAKR) gene (SEQ ID NO.1)
Obtain having the mutant of the aldehyde ketone reductase of improved properties by mutation, which expresses in colibacillus engineering, the aldehyde
Ketoreductase and its mutant can restore 2-ketoacid ester type compound to obtain S or R configuration secondary alcohol with optical activation.
Further, aldehyde ketone reductase gene is connected in expression plasmid, aldehyde ketone reductase must be recombinated.The expression
Plasmid are as follows: pET-28b-MBP.
The recombination aldehyde ketone reductase includes the amino acid sequence with SEQ ID NO.2 at least 75% identity.
Further, the present invention provides the mutant of aldehyde ketone reductase BcAKR, the mutant is to recombination aldehyde
24 or 112 mutation of ketoreductase (i.e. SEQ ID NO.2) or 24 and 116 simultaneous mutations acquisitions.
The mutant of aldehyde ketone reductase BcAKR of the present invention is smaller corresponding to 24 residues of SEQ ID NO.2
Amino acid residue, 116 residues are larger amino acid residue, these amino acid are for improving the active and right of aldehyde ketone reductase
It is selectively most important to reflect body.
Lesser amino acid involved in the present invention is Ala, Ser, Thr, Val, Ile and Leu, preferably serine
(Ser)；The larger amino acid residue being related to is Pro, Phe, Try, Leu, preferably phenylalanine (Phe).
In some embodiments of the invention, the aldehyde Ketoreductase mutant containing mutation is directed to 2-ketoacid ester type compound
Higher activity and stereoselectivity are shown, these mutant include one or two mutation, i.e., 24 or 116 are mutated,
Or 24 and 116 simultaneous mutations, amino acid sequence 24 sport Ser；Amino acid sequence 116 sport Phe.
Aldehyde Ketoreductase mutant of the present invention, amino acid sequence preferably such as SEQ ID NO.4, shown in 6,8.
Embodiments of the present invention include the nucleic acid for encoding the aldehyde Ketoreductase mutant, of the present invention with encoding
The nucleic acid sequence of BcAKR mutant has at least 75% sequence identity.
The nucleic acid for capableing of encoding mutant body, sequence such as SEQ ID NO.3, shown in 5,7.
Related embodiment of the invention further includes the carrier comprising these nucleic acid and the host cell comprising such carrier.
The answering in reduction 2-ketoacid ester type compound the present invention also provides the aldehyde ketone reductase and its mutant
With.Heretofore described wild type aldehyde ketone reductase BcAKR and its mutant, or containing wild type or mutant enzyme
Cell can be used as catalyst asymmetric reduction 2-ketoacid ester type compound and obtain corresponding optical homochiral product.
The preferable structure of 2-ketoacid ester type compound is such as shown in (II):
Wherein R1For C1-C4 alkyl, phenyl or with the phenyl of substituent group, the substituent group of phenyl is halogen；
R2For C1-C4 alkyl；
Preferred structure is as described in 1a:
An embodiment of the invention provides the method for asymmetric reduction 2-ketoacid ester type compound:
In the phosphate buffer of pH 5-7, in glucose dehydrogenase, glucose and NADP+In the presence of, in aldehyde
Under the catalysis of Ketoreductase mutant, 2-ketoacid ester type compound is restored, generates optical activity chirality secondary alcohol.
Aldehyde Ketoreductase mutant dosage is 0.02-40g/L, and glucose dehydrogenase dosage is 0.01-5g/L, and glucose is used
Amount is 6-200g/L, NADP+Dosage is 0.1-0.5mmol, and the concentration of substrate of 2-ketoacid ester type compound is 3-100g/L, described
Buffer is the phosphate buffer of pH5-7, and reaction temperature is 30-40 DEG C.The aldehyde ketone reductase or its mutant can be a variety of
The diversified forms such as feasible mode such as cell, thick enzyme powder, enzyme solutions, immobilised enzymes exist.
Advantageous effects of the invention: by being mutated to Bacillus cereus aldehyde ketone reductase (BcAKR), gained
To aldehyde Ketoreductase mutant compared with naturally occurring ketoreductase wild type, invert and improve it to 2-ketoacid esters
The activity and enantioselectivity of compound.
Detailed description of the invention
Fig. 1 is the gene of wild type aldehyde ketone reductase BcAKR and its mutant enzyme, the recombinant expression load containing said gene
The building of body.
Fig. 2 is the HPLC testing result of wild type aldehyde ketone reductase BcAKR and its mutant enzyme catalysis substrate 1a reduction；
Sub1: substrate 1a control；Rac-1: product raceme control；Wild type (SEQ ID NO.2) HPLC testing result；
Wild type F24S mutant (SEQ ID NO.4) HPLC testing result；Wild type F24S-W116F double-site mutant body (SEQ ID
NO.8) HPLC testing result.
Specific embodiment
Below by specific embodiment, aldehyde Ketoreductase mutant of the invention is described, and is restored using the enzyme
2-ketoacid ester type compound.Unless specified otherwise, experimental program used in the present invention is known in those skilled in the art
Method.In addition, embodiment be interpreted as it is illustrative, rather than limit the present invention.
The definition of certain terms.
Asymmetric reduction is that reduction prochiral compound obtains a kind of method of optically pure corresponding reduzate, at this
Invention middle finger aldehyde ketone reduction enzymatic alpha-keto ester class compound selectively obtains the corresponding alcohol of S or R configuration.
Enantiomeric excess is defined as the amount more extra than another isomers B of an isomers A in mixture of enantiomers and accounts for
The percentage of total amount is abbreviated as ee, and formula is (A-B)/(A+B) * 100%, and enantiomeric excess value is for indicating a kind of chiralityization
Close the optical purity of object.Ee value is higher, and optical purity is also higher.
20 kinds of amino acid abbreviations are as follows
Asp D aspartic acid Ile I isoleucine
Thr T threonine Leu L leucine
Ser S serine Tyr Y tyrosine
Glu E glutamic acid Phe F phenylalanine
Pro P proline His H histidine
Gly G glycine Lys K lysine
Ala A alanine Arg R arginine
Cys C cysteine Trp W tryptophan
Val V valine Gln Q glutamine
Met M methionine Asn N asparagine
Amino Acid Classification is divided into larger and lesser amino acid according to the steric hindrance of amino acid side groups, the present invention
Involved in the present invention involved in lesser amino acid be Ala, Ser, Thr, Val, Ile and Leu, larger amino acid residue is
Pro、Phe、Try、Leu。
The culture medium prescription that embodiment is related to.
LB liquid medium: 0.5% yeast extract, 1% protein peptone and 1% sodium chloride (such as configuration solid medium,
1.5% agar is added before sterilization), 115 DEG C of high pressure sterilization 30min.
The extraction of 1 bacillus cereus genomic DNA of embodiment
After bacillus cereus is stayed overnight with LB Liquid Culture, fermentation liquid is centrifuged 5min with 1mL centrifuge tube 3000r/min, abandons
Supernatant collects thallus, repeats several times to obtain the cell of sufficient amount；B) bacterial genomes DNA extraction kit operating instruction is pressed
Extract bacillus cereus genome.
The clone of 2 wild type BcAKR gene of embodiment
PCR reaction is carried out as template using the bacillus cereus genomic DNA that embodiment 1 obtains, reaction system is as follows:
Amplification program: 94 DEG C: 10min, (94 DEG C: 30s, 45 DEG C: 30s, 72 DEG C: 30s) 30 circulations, 72 DEG C, 10min.
Primer 1:BcAKR-EcoR I-F:CCGGAATTCGATGAAAAACTTACAAAGT；
Primer 2: BcAKR-Xho I-R:CCGCTCGAGGAAATCGAAGTTATCAGG；
Restriction enzyme digestion sites are marked with underscore；
The DNA fragmentation that PCR amplification obtains is purified with plastic recovery kit.E.coli DH5 containing pET28b MBP plasmid
With 37 DEG C of LB liquid medium, 220r/min overnight incubation, plasmid is extracted using referring to TIANprep Mini Plasmid α
Kit。
Target fragment and plasmid pET28b MBP plasmid limit double digestion, and digestion system is as follows:
Digestion products recycle segment with plastic recovery kit, and are connected by T4 ligase.
The preparation and conversion of embodiment 3E.coli Rosetta (DE3) competent cell
A) 3h is cultivated from taking 0.4mL to be inoculated in 20mL LB liquid medium in seed culture medium；B) 3000r/min,
5min is enriched with 2mL thallus in 1.5mL EP pipe in two times, abandons supernatant；C) the ice-cold TSS solution of 100 μ l is added, again suspended bacteria
Body, ice bath 30min；D) 20 μ L connection liquid are added and gently rotate mixing, ice bath 30min；E) 42 DEG C of heat shock 60s, ice bath 2min,
600 μ L LB liquid mediums are added.37 DEG C of cultures, 150r/min shaken cultivation 1h；F) 150 μ L is taken to be coated on LB resistance respectively
Plate.
The building of 4 mutant of embodiment
The building of mutation library is carried out using mutant primer and flank primers, Overlap extension PCR.(mutation of design is drawn
Object is as follows :)
PCR amplification condition: 94 DEG C: 10Min, (94 DEG C: 30s, 45 DEG C: 30s, 72 DEG C: 30s) 35 circulations, 72 DEG C:
10min.Gained genetic fragment is by purifying, by following PCR amplification
Target fragment is obtained by PCR described in embodiment 2 and is connected on pET28b MBP carrier, by described in embodiment 3
It is transformed into E.coli Rosetta (DE3).Wild type aldehyde ketone reductase BcAKR and its mutant are respectively obtained.
The expression of 5 mutant of embodiment
A) single colonie is taken to be inoculated in 4ml kalamycin resistance LB liquid medium, 37 DEG C, 200rpm is obtained after cultivating 6h
Seed liquor；B) 20 μ l seed liquors are taken to be inoculated in 20ml kalamycin resistance LB liquid medium, 37 DEG C, 200rpm is cultivated to training
Final concentration 0.5mM IPTG is added when reaching 0.8-1.0 in nutrient solution OD600, and cools the temperature to 20 DEG C of inducing expression 20h；c)
4000rpm × 15min centrifugation medium collects thallus, and brine uses 0.1M pH6.0 sodium phosphate buffer weight afterwards twice
Thallus is selected, final concentration 1mg/ml lysozyme is added, 30 DEG C, after 200rpm is crushed 1h, at 4 DEG C, supernatant is collected by centrifugation in 10000rpm
It is screened.
The expression of 6 glucose dehydrogenase of embodiment
E.coli Rosetta (DE3) containing pET22b-GDH plasmid is obtained into grape according to expression described in embodiment 5
Glucocorticoid dehydrogenase.
The catalysis reduction of 7 crude enzyme liquid of embodiment
Reaction system: if each 450 μ l of supernatant described in embodiment 5,6 is mixed, final concentration 0.3mM NADP+, 8mg grape
Sugar, 4mg substrate (100 μ l methanol hydrotropy), 30 DEG C of reaction 6h；Three times with the extraction of isometric ethyl acetate.
8 high-efficient liquid phase analysis substrate of embodiment and product
Typical substrate involved in the present embodiment is as follows:
The condition of detection substrate 1a and product are as follows: chromatographic column: AD-H, mobile phase: n-hexane: isopropanol=90:10, stream
Speed: 0.8ml/min, wavelength: 254nm, column temperature: 25 DEG C, detector: UV detector.
9 wild type of embodiment (SEQ ID NO.2) and F24S mutant (SEQ ID NO.4) selectively measure substrate 1a
As a result
A) conversion ratio [%]；B) reduzate alcohol enantiomeric excess value (ee%)；C) absolute configuration of reduzate alcohol
SEQ ID NO.4 catalysis substrate 1a liquid phase figure is shown in Fig. 2.
10 wild type of embodiment (SEQ ID NO.2) and F24S-W116F double-site mutant body (SEQ ID NO.8) are the bottom of to
The selective determination result of object 1a
A) conversion ratio [%]；B) reduzate alcohol enantiomeric excess value (ee%)；C) absolute configuration of reduzate alcohol
SEQ ID NO.8 catalysis substrate 1a liquid phase figure is shown in Fig. 2.
Sequence table
<110>Shenyang Pharmaceutical University
<120>aldehyde ketone reductase BcAKR and its mutant and application
<141> 2019-01-08
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 837
<212> DNA
<213>Bacillus cercus (Bacillus cereus)
<400> 1
atgaaaaact tacaaagtaa aacagtatta aataatggtg tagaaatgcc ttggttcggt 60
ttaggtgtat ttaaagtaga agaaggacca gaacttgtag aagctgtaaa atcagcgatt 120
aaagcaggat accgtagcat cgatacagct gcaatttacg gaaatgaaaa agctgtaggt 180
gaaggaatcc gtgcaggtat tgaagcgact ggtatttcaa gagaagaatt attcatcact 240
tcaaaagtat ggaacgcaga tcaaggatat gaaacaacaa tcgctgcata cgaagagagt 300
ctaaaaaaat taggactaga ttatttagat ttatatcttg ttcactggcc ttcagaagga 360
aaatataaag atacatggag agcgctagaa acactttata aagaaaagcg cgtacgtgca 420
attggtgtaa gtaacttcca aatccatcac ttacaagatg taatgaaaga tgcagaaatt 480
aaaccaatga ttaaccaagt agaataccac cctcgtttaa cacaaaaaga actacaagct 540
ttctgtaaag aacaaggtat tcaaatggaa gcatggtcac cactaatgca aggtcaatta 600
ttagataacg aaacattaca agagattgct gagaaacacg gtaaaacaac agctcaagtt 660
attttacgtt gggatcttca aaacggagta attacaattc caaaatcaac gaaagaacac 720
cgtattattg caaatgctga tgtatttaac tttgaattaa aaaaagaaga catggaaaaa 780
atcgatgcgt taaaccaaaa tcaccgcgtt ggtccagatc ctgataactt cgatttc 837
<210> 2
<211> 279
<212> PRT
<213>Bacillus cercus (Bacillus cereus)
<400> 2
Met Lys Asn Leu Gln Ser Lys Thr Val Leu Asn Asn Gly Val Glu Met
1 5 10 15
Pro Trp Phe Gly Leu Gly Val Phe Lys Val Glu Glu Gly Pro Glu Leu
20 25 30
Val Glu Ala Val Lys Ser Ala Ile Lys Ala Gly Tyr Arg Ser Ile Asp
35 40 45
Thr Ala Ala Ile Tyr Gly Asn Glu Lys Ala Val Gly Glu Gly Ile Arg
50 55 60
Ala Gly Ile Glu Ala Thr Gly Ile Ser Arg Glu Glu Leu Phe Ile Thr
65 70 75 80
Ser Lys Val Trp Asn Ala Asp Gln Gly Tyr Glu Thr Thr Ile Ala Ala
85 90 95
Tyr Glu Glu Ser Leu Lys Lys Leu Gly Leu Asp Tyr Leu Asp Leu Tyr
100 105 110
Leu Val His Trp Pro Ser Glu Gly Lys Tyr Lys Asp Thr Trp Arg Ala
115 120 125
Leu Glu Thr Leu Tyr Lys Glu Lys Arg Val Arg Ala Ile Gly Val Ser
130 135 140
Asn Phe Gln Ile His His Leu Gln Asp Val Met Lys Asp Ala Glu Ile
145 150 155 160
Lys Pro Met Ile Asn Gln Val Glu Tyr His Pro Arg Leu Thr Gln Lys
165 170 175
Glu Leu Gln Ala Phe Cys Lys Glu Gln Gly Ile Gln Met Glu Ala Trp
180 185 190
Ser Pro Leu Met Gln Gly Gln Leu Leu Asp Asn Glu Thr Leu Gln Glu
195 200 205
Ile Ala Glu Lys His Gly Lys Thr Thr Ala Gln Val Ile Leu Arg Trp
210 215 220
Asp Leu Gln Asn Gly Val Ile Thr Ile Pro Lys Ser Thr Lys Glu His
225 230 235 240
Arg Ile Ile Ala Asn Ala Asp Val Phe Asn Phe Glu Leu Lys Lys Glu
245 250 255
Asp Met Glu Lys Ile Asp Ala Leu Asn Gln Asn His Arg Val Gly Pro
260 265 270
Asp Pro Asp Asn Phe Asp Phe
275
<210> 3
<211> 837
<212> DNA
<213>Bacillus cercus (Bacillus cereus)
<400> 3
atgaaaaact tacaaagtaa aacagtatta aataatggtg tagaaatgcc ttggttcggt 60
ttaggtgtaa gcaaagtaga agaaggacca gaacttgtag aagctgtaaa atcagcgatt 120
aaagcaggat accgtagcat cgatacagct gcaatttacg gaaatgaaaa agctgtaggt 180
gaaggaatcc gtgcaggtat tgaagcgact ggtatttcaa gagaagaatt attcatcact 240
tcaaaagtat ggaacgcaga tcaaggatat gaaacaacaa tcgctgcata cgaagagagt 300
ctaaaaaaat taggactaga ttatttagat ttatatcttg ttcactggcc ttcagaagga 360
aaatataaag atacatggag agcgctagaa acactttata aagaaaagcg cgtacgtgca 420
attggtgtaa gtaacttcca aatccatcac ttacaagatg taatgaaaga tgcagaaatt 480
aaaccaatga ttaaccaagt agaataccac cctcgtttaa cacaaaaaga actacaagct 540
ttctgtaaag aacaaggtat tcaaatggaa gcatggtcac cactaatgca aggtcaatta 600
ttagataacg aaacattaca agagattgct gagaaacacg gtaaaacaac agctcaagtt 660
attttacgtt gggatcttca aaacggagta attacaattc caaaatcaac gaaagaacac 720
cgtattattg caaatgctga tgtatttaac tttgaattaa aaaaagaaga catggaaaaa 780
atcgatgcgt taaaccaaaa tcaccgcgtt ggtccagatc ctgataactt cgatttc 837
<210> 4
<211> 279
<212> PRT
<213>Bacillus cercus (Bacillus cereus)
<400> 4
Met Lys Asn Leu Gln Ser Lys Thr Val Leu Asn Asn Gly Val Glu Met
1 5 10 15
Pro Trp Phe Gly Leu Gly Val Ser Lys Val Glu Glu Gly Pro Glu Leu
20 25 30
Val Glu Ala Val Lys Ser Ala Ile Lys Ala Gly Tyr Arg Ser Ile Asp
35 40 45
Thr Ala Ala Ile Tyr Gly Asn Glu Lys Ala Val Gly Glu Gly Ile Arg
50 55 60
Ala Gly Ile Glu Ala Thr Gly Ile Ser Arg Glu Glu Leu Phe Ile Thr
65 70 75 80
Ser Lys Val Trp Asn Ala Asp Gln Gly Tyr Glu Thr Thr Ile Ala Ala
85 90 95
Tyr Glu Glu Ser Leu Lys Lys Leu Gly Leu Asp Tyr Leu Asp Leu Tyr
100 105 110
Leu Val His Trp Pro Ser Glu Gly Lys Tyr Lys Asp Thr Trp Arg Ala
115 120 125
Leu Glu Thr Leu Tyr Lys Glu Lys Arg Val Arg Ala Ile Gly Val Ser
130 135 140
Asn Phe Gln Ile His His Leu Gln Asp Val Met Lys Asp Ala Glu Ile
145 150 155 160
Lys Pro Met Ile Asn Gln Val Glu Tyr His Pro Arg Leu Thr Gln Lys
165 170 175
Glu Leu Gln Ala Phe Cys Lys Glu Gln Gly Ile Gln Met Glu Ala Trp
180 185 190
Ser Pro Leu Met Gln Gly Gln Leu Leu Asp Asn Glu Thr Leu Gln Glu
195 200 205
Ile Ala Glu Lys His Gly Lys Thr Thr Ala Gln Val Ile Leu Arg Trp
210 215 220
Asp Leu Gln Asn Gly Val Ile Thr Ile Pro Lys Ser Thr Lys Glu His
225 230 235 240
Arg Ile Ile Ala Asn Ala Asp Val Phe Asn Phe Glu Leu Lys Lys Glu
245 250 255
Asp Met Glu Lys Ile Asp Ala Leu Asn Gln Asn His Arg Val Gly Pro
260 265 270
Asp Pro Asp Asn Phe Asp Phe
275
<210> 5
<211> 837
<212> DNA
<213>Bacillus cercus (Bacillus cereus)
<400> 5
atgaaaaact tacaaagtaa aacagtatta aataatggtg tagaaatgcc ttggttcggt 60
ttaggtgtat ttaaagtaga agaaggacca gaacttgtag aagctgtaaa atcagcgatt 120
aaagcaggat accgtagcat cgatacagct gcaatttacg gaaatgaaaa agctgtaggt 180
gaaggaatcc gtgcaggtat tgaagcgact ggtatttcaa gagaagaatt attcatcact 240
tcaaaagtat ggaacgcaga tcaaggatat gaaacaacaa tcgctgcata cgaagagagt 300
ctaaaaaaat taggactaga ttatttagat ttatatcttg ttcactttcc ttcagaagga 360
aaatataaag atacatggag agcgctagaa acactttata aagaaaagcg cgtacgtgca 420
attggtgtaa gtaacttcca aatccatcac ttacaagatg taatgaaaga tgcagaaatt 480
aaaccaatga ttaaccaagt agaataccac cctcgtttaa cacaaaaaga actacaagct 540
ttctgtaaag aacaaggtat tcaaatggaa gcatggtcac cactaatgca aggtcaatta 600
ttagataacg aaacattaca agagattgct gagaaacacg gtaaaacaac agctcaagtt 660
attttacgtt gggatcttca aaacggagta attacaattc caaaatcaac gaaagaacac 720
cgtattattg caaatgctga tgtatttaac tttgaattaa aaaaagaaga catggaaaaa 780
atcgatgcgt taaaccaaaa tcaccgcgtt ggtccagatc ctgataactt cgatttc 837
<210> 6
<211> 279
<212> PRT
<213>Bacillus cercus (Bacillus cereus)
<400> 6
Met Lys Asn Leu Gln Ser Lys Thr Val Leu Asn Asn Gly Val Glu Met
1 5 10 15
Pro Trp Phe Gly Leu Gly Val Phe Lys Val Glu Glu Gly Pro Glu Leu
20 25 30
Val Glu Ala Val Lys Ser Ala Ile Lys Ala Gly Tyr Arg Ser Ile Asp
35 40 45
Thr Ala Ala Ile Tyr Gly Asn Glu Lys Ala Val Gly Glu Gly Ile Arg
50 55 60
Ala Gly Ile Glu Ala Thr Gly Ile Ser Arg Glu Glu Leu Phe Ile Thr
65 70 75 80
Ser Lys Val Trp Asn Ala Asp Gln Gly Tyr Glu Thr Thr Ile Ala Ala
85 90 95
Tyr Glu Glu Ser Leu Lys Lys Leu Gly Leu Asp Tyr Leu Asp Leu Tyr
100 105 110
Leu Val His Phe Pro Ser Glu Gly Lys Tyr Lys Asp Thr Trp Arg Ala
115 120 125
Leu Glu Thr Leu Tyr Lys Glu Lys Arg Val Arg Ala Ile Gly Val Ser
130 135 140
Asn Phe Gln Ile His His Leu Gln Asp Val Met Lys Asp Ala Glu Ile
145 150 155 160
Lys Pro Met Ile Asn Gln Val Glu Tyr His Pro Arg Leu Thr Gln Lys
165 170 175
Glu Leu Gln Ala Phe Cys Lys Glu Gln Gly Ile Gln Met Glu Ala Trp
180 185 190
Ser Pro Leu Met Gln Gly Gln Leu Leu Asp Asn Glu Thr Leu Gln Glu
195 200 205
Ile Ala Glu Lys His Gly Lys Thr Thr Ala Gln Val Ile Leu Arg Trp
210 215 220
Asp Leu Gln Asn Gly Val Ile Thr Ile Pro Lys Ser Thr Lys Glu His
225 230 235 240
Arg Ile Ile Ala Asn Ala Asp Val Phe Asn Phe Glu Leu Lys Lys Glu
245 250 255
Asp Met Glu Lys Ile Asp Ala Leu Asn Gln Asn His Arg Val Gly Pro
260 265 270
Asp Pro Asp Asn Phe Asp Phe
275
<210> 7
<211> 837
<212> DNA
<213>Bacillus cercus (Bacillus cereus)
<400> 7
atgaaaaact tacaaagtaa aacagtatta aataatggtg tagaaatgcc ttggttcggt 60
ttaggtgtaa gcaaagtaga agaaggacca gaacttgtag aagctgtaaa atcagcgatt 120
aaagcaggat accgtagcat cgatacagct gcaatttacg gaaatgaaaa agctgtaggt 180
gaaggaatcc gtgcaggtat tgaagcgact ggtatttcaa gagaagaatt attcatcact 240
tcaaaagtat ggaacgcaga tcaaggatat gaaacaacaa tcgctgcata cgaagagagt 300
ctaaaaaaat taggactaga ttatttagat ttatatcttg ttcactttcc ttcagaagga 360
aaatataaag atacatggag agcgctagaa acactttata aagaaaagcg cgtacgtgca 420
attggtgtaa gtaacttcca aatccatcac ttacaagatg taatgaaaga tgcagaaatt 480
aaaccaatga ttaaccaagt agaataccac cctcgtttaa cacaaaaaga actacaagct 540
ttctgtaaag aacaaggtat tcaaatggaa gcatggtcac cactaatgca aggtcaatta 600
ttagataacg aaacattaca agagattgct gagaaacacg gtaaaacaac agctcaagtt 660
attttacgtt gggatcttca aaacggagta attacaattc caaaatcaac gaaagaacac 720
cgtattattg caaatgctga tgtatttaac tttgaattaa aaaaagaaga catggaaaaa 780
atcgatgcgt taaaccaaaa tcaccgcgtt ggtccagatc ctgataactt cgatttc 837
<210> 8
<211> 279
<212> PRT
<213>Bacillus cercus (Bacillus cereus)
<400> 8
Met Lys Asn Leu Gln Ser Lys Thr Val Leu Asn Asn Gly Val Glu Met
1 5 10 15
Pro Trp Phe Gly Leu Gly Val Ser Lys Val Glu Glu Gly Pro Glu Leu
20 25 30
Val Glu Ala Val Lys Ser Ala Ile Lys Ala Gly Tyr Arg Ser Ile Asp
35 40 45
Thr Ala Ala Ile Tyr Gly Asn Glu Lys Ala Val Gly Glu Gly Ile Arg
50 55 60
Ala Gly Ile Glu Ala Thr Gly Ile Ser Arg Glu Glu Leu Phe Ile Thr
65 70 75 80
Ser Lys Val Trp Asn Ala Asp Gln Gly Tyr Glu Thr Thr Ile Ala Ala
85 90 95
Tyr Glu Glu Ser Leu Lys Lys Leu Gly Leu Asp Tyr Leu Asp Leu Tyr
100 105 110
Leu Val His Phe Pro Ser Glu Gly Lys Tyr Lys Asp Thr Trp Arg Ala
115 120 125
Leu Glu Thr Leu Tyr Lys Glu Lys Arg Val Arg Ala Ile Gly Val Ser
130 135 140
Asn Phe Gln Ile His His Leu Gln Asp Val Met Lys Asp Ala Glu Ile
145 150 155 160
Lys Pro Met Ile Asn Gln Val Glu Tyr His Pro Arg Leu Thr Gln Lys
165 170 175
Glu Leu Gln Ala Phe Cys Lys Glu Gln Gly Ile Gln Met Glu Ala Trp
180 185 190
Ser Pro Leu Met Gln Gly Gln Leu Leu Asp Asn Glu Thr Leu Gln Glu
195 200 205
Ile Ala Glu Lys His Gly Lys Thr Thr Ala Gln Val Ile Leu Arg Trp
210 215 220
Asp Leu Gln Asn Gly Val Ile Thr Ile Pro Lys Ser Thr Lys Glu His
225 230 235 240
Arg Ile Ile Ala Asn Ala Asp Val Phe Asn Phe Glu Leu Lys Lys Glu
245 250 255
Asp Met Glu Lys Ile Asp Ala Leu Asn Gln Asn His Arg Val Gly Pro
260 265 270
Asp Pro Asp Asn Phe Asp Phe
275
Claims (11)
1. aldehyde ketone reductase, which is characterized in that its amino acid sequence is as shown in SEQ ID NO.1.
2. the mutant of aldehyde ketone reductase described in claim 1, which is characterized in that the variant amino acid sequence have with
SEQ ID NO.2 amino acid sequence at least 75% sequence identity, and its 24 or 116 mutation or its 24 and 116
Position simultaneous mutation.
3. aldehyde Ketoreductase mutant as claimed in claim 2, which is characterized in that 24 mutation of the aldehyde ketone reductase
For the amino acid residue of small volume, 116 sport the biggish amino acid residue of volume, and the small volume amino acid is residual
Base is Ala, Val, Ile, Ser, Thr and Leu, preferably Ser；The biggish amino acid residue of volume be Pro, Phe, Try, Leu,
Preferably Phe.
4. the mutant of aldehyde ketone reductase as described in Claims 2 or 3, amino acid sequence such as SEQ ID NO.4, shown in 6,8.
5. a kind of nucleic acid can encode aldehyde Ketoreductase mutant described in any one of claim 2-4.
6. nucleic acid as claimed in claim 5, nucleic acid sequence such as SEQ ID NO.3, shown in 5,7.
7. a kind of expression vector, which contains nucleic acid described in claim 5 or 6 and can be expressed in host cell.
8. a kind of host cell, the nucleic acid containing claim 5 or 6 or expression vector as claimed in claim 7, the place
Chief cell is preferably Escherichia coli.
9. aldehyde Ketoreductase mutant described in any one of aldehyde ketone reductase described in claim 1 or claim 2-4 exists
Restore the application in 2-ketoacid ester type compound.
10. application as claimed in claim 9, which is characterized in that the restoring method are as follows: in the phosphate-buffered of pH5-7
In liquor, in glucose dehydrogenase, glucose and NADP+In the presence of, aldehyde ketone reductase described in claim 1 or right
It is required that restoring under the catalysis of the described in any item aldehyde Ketoreductase mutants of 2-4 to 2-ketoacid ester type compound, light is generated
Learn activity chiral secondary alcohol, it is preferable that it is 0.02-40g/L that aldehyde ketone, which restores enzyme dosage, and glucose dehydrogenase dosage is 0.01-5g/L,
Glucose dosage is 6-200g/L, NADP+Dosage is 0.1-0.5mmol, concentration of substrate 3-100g/L, and the buffer is
The phosphate buffer of pH5-7, reaction temperature are 30-40 DEG C.
11. application as claimed in claim 10, which is characterized in that shown in the 2-ketoacid ester type compound such as formula (I):
Wherein R1For C1-C4 alkyl, phenyl or with the phenyl of substituent group, the substituent group of phenyl is halogen；
R2For C1-C4 alkyl.
Preferably,
R1The phenyl replaced for ortho position chlorine atom；
R2For methyl.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375442.7A CN110272879B (en) | 2019-05-07 | 2019-05-07 | Aldehyde ketone reductase BcAKR and mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375442.7A CN110272879B (en) | 2019-05-07 | 2019-05-07 | Aldehyde ketone reductase BcAKR and mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110272879A true CN110272879A (en) | 2019-09-24 |
| CN110272879B CN110272879B (en) | 2022-11-18 |
Family
ID=67959758
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910375442.7A Active CN110272879B (en) | 2019-05-07 | 2019-05-07 | Aldehyde ketone reductase BcAKR and mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110272879B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058248A (en) * | 2017-04-26 | 2017-08-18 | 浙江工业大学 | One kind restructuring aldehyde Ketoreductase mutant, gene, carrier, engineering bacteria and its application |
| CN109055327A (en) * | 2018-07-23 | 2018-12-21 | 浙江工业大学 | Aldehyde Ketoreductase mutant and its application |
-
2019
- 2019-05-07 CN CN201910375442.7A patent/CN110272879B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058248A (en) * | 2017-04-26 | 2017-08-18 | 浙江工业大学 | One kind restructuring aldehyde Ketoreductase mutant, gene, carrier, engineering bacteria and its application |
| CN109055327A (en) * | 2018-07-23 | 2018-12-21 | 浙江工业大学 | Aldehyde Ketoreductase mutant and its application |
Non-Patent Citations (2)
| Title |
|---|
| BARSKI OA等: "The aldo-keto reductase superfamily and its role in drug metabolism and detoxification", 《DRUG METAB REV》 * |
| GENBANK: "WP_000793561", 《GENBANK》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110272879B (en) | 2022-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111051503B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohol | |
| CN111094557B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohol | |
| Patel et al. | Enantioselective microbial reduction of substituted acetophenones | |
| CN108546690B (en) | Short-chain dehydrogenase and mutant thereof, and preparation and application of gene | |
| CN111433357B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohol | |
| CN109837317B (en) | Synthesis method of chiral bisaryl alcohol compound | |
| CN105543186B (en) | A kind of alcohol dehydrogenase LC3 and its gene and application | |
| CN109468346B (en) | Biological preparation method of (S) -1- (2-iodine-5-fluorophenyl) ethanol | |
| CN110387359A (en) | Carbonyl reduction enzyme mutant and its application | |
| CN109371070B (en) | Method for high yield of alpha-ketoisovaleric acid | |
| CN113528592B (en) | Enzyme-catalyzed (2)S,3R) Synthesis method of (E) -2-substituted aminomethyl-3-hydroxybutyrate | |
| CN111454921A (en) | Ketoreductase mutant with improved enzyme activity and application thereof | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| CN111004787B (en) | Streptomyces phospholipase D mutant, transformation method and application thereof | |
| CN108486075A (en) | A kind of recombination carbonyl reduction enzyme mutant, gene, engineering bacteria and its application | |
| CN111100851B (en) | Alcohol dehydrogenase mutant and application thereof in synthesis of chiral diaryl alcohol compound | |
| CN110272879A (en) | Aldehyde ketone reductase BcAKR and its mutant and application | |
| CN110257350A (en) | Aldehyde ketone reductase BmAKR1 and its mutant and application | |
| CN110283799B (en) | Aldehyde ketone reductase BsAKR (YvgN) and mutant and application thereof | |
| CN110257349A (en) | Aldehyde ketone reductase BmAKR2 and its mutant and application | |
| JP5103616B2 (en) | Method for producing (R) -2-chloromandelic acid methyl ester | |
| CN110358804B (en) | Enzyme method production process of R-3-amino n-butanol | |
| CN114774491B (en) | Method for preparing (2S, 3R) -2- (phthalimidomethyl) -3-hydroxybutyrate | |
| CN112813040B (en) | Old yellow enzyme OYE1 mutant protein and application thereof in enzyme-catalyzed asymmetric reduction of 2-aryl acrylic acid derivatives | |
| CN112852770B (en) | Alcohol dehydrogenase mutant and application thereof in preparing chiral diaryl alcohol compound by efficient asymmetric reduction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |