CN109929929A

CN109929929A - Kit and clinical application for Human epidermal growth factor receptor detection in Gene Mutation

Info

Publication number: CN109929929A
Application number: CN201711350078.6A
Authority: CN
Inventors: 马永; 丁燕芬; 丁娜
Original assignee: ZONHON BIOPHARMA INSTITUTE Inc
Current assignee: ZONHON BIOPHARMA INSTITUTE Inc
Priority date: 2017-12-15
Filing date: 2017-12-15
Publication date: 2019-06-25

Abstract

The present invention relates to primer, probe and the kits of a kind of Human epidermal growth factor receptor detection in Gene Mutation.The specific ARMS primer and probe of screening, and the reaction system of optimization are invented, the excellent kit for Human epidermal growth factor receptor detection in Gene Mutation of detection performance can be obtained, quickly, detection can be completed in 90 minutes in kit detection；High sensitivity can detecte content in 10ng DNA sample down to 1% EGFR genetic mutation；It is specific high, with wild-type samples without amplification；It is easy to operate, it is low in cost, be conducive to scale, the marketization can be efficiently applied to clinical accurate direction of medication usage.

Description

Kit and clinical application for Human epidermal growth factor receptor detection in Gene Mutation

Technical field

The present invention relates to genetic engineering fields, primer, spy more specifically to a kind of Human epidermal growth factor receptor detection in Gene Mutation Needle and kit.

Background technique

EGFR (EGF-R ELISA) is a kind of glycoprotein, belongs to tyrosine kinase receptor, is proto-oncogene C- The expression product of erbB-1, the assignment of genes gene mapping are made of, overall length 200kb in No. 7 the short arm of a chromosome 28 exons.Study table Bright high expression or unconventionality expression in many entity tumors there are EGFR.The proliferation of EGFR and tumour cell, swells at angiogenesis Tumor invasion, transfer and the inhibition of Apoptosis are related.The high expression of EGFR can cause the enhancing of downstream signal transduction；Receptor down-regulated The destruction of mechanism；The activation etc. of abnormal signal conduction path.The overexpression of EGFR plays an important role in the evolution of malignant tumour, There is the overexpression of EGFR in the tissue such as spongiocyte, kidney, lung cancer, prostate cancer, cancer of pancreas, breast cancer.Mutant egf R Effect may include: with ligand independent form receptor cell continuous activation；Due to EGFR certain structural domains missing and Lead to the destruction of receptor down-regulated mechanism, the activation of abnormal signal conduction path, inhibition of Apoptosis etc..Cut-off 2017, FDA It is common to have crossed 10 kinds using EGFR as the targeted drug of target spot, include 6 kinds of small molecules such as Tarceva, Gefitinib, Conmana 4 kinds of macromolecular targeted drugs such as inhibitor and Cetuximab, Buddhist nun's trastuzumab, Victibix.EGFR gene detection helps In clinical guidance medication.

EGFR genetic mutation multidigit is in exons 1 8-21.The most common mutation includes 9 deletion mutation of exons 1 and outer aobvious Sub 21 point mutation, both are mutated the 85-90% for accounting for about all mutation.The base deletion of exons 19 is mainly 746-752 The missing of bit codon causes amino acid sequence in EGFR albumen to be lost, this missing changes receptor tyrosine kinase ATP knot The angle for closing slot, to enhance cell to the sensitivity of TKI preparation.The point mutation of exon 21 is mainly situated in the 858th password There is T-G conversion in son, and the amino acid in the site in albumen is caused to be changed into smart oxygen acid, i.e. L858R by leucine, this structure changes Enhance cell to the sensibility of TKI preparation.The Meta analysis of China EGFR-TKI treatment is shown with EGFR sensitizing mutation Patient's effective percentage is up to 60.75%.With inch, EGFR-TKI has better clinical efficacy compared with chemotherapy, and adverse reaction is slight, Convenient to take, the life matter of patient is greatly improved.In non-small cell lung cancer the mutation of EGFR focus primarily upon the 18th, 19, 20 and 21 exons, wherein based on 19 exons and the mutation of 21 exons.Wherein 747-750 is ammonia on l9 exon The different missings of about more than 20 kinds of base acid, account for about the 45% of mutation；The mutation 40-45% of 2l exon；18 exons are about 5%, the insertion mutation on 20 exons accounts for about 1%.

Clinical EGFR detection is mainly used for the matching detection before tumor-targeting drug use, and exons 18,19,21 is prominent Become, display is preferable using EGFR-TKI targeting medicament curative effect；And extron 20 mutation prompt drug resistance.After patient takes a stage Abrupt climatic change is carried out again, and extron 20 has secondary mutation, prompts unsatisfactory curative effect.This project exploitation kit predominantly detects needle EGFR gene the 19th, 20 and 21 exons are detected.

Existing detection method of gene mutation mainly has direct Sequencing, restricted small fragment length polymorphism (Restriction Fragment Length Polymorphism, RFLP), high-resolution solubility curve analyze (High Resolution Melting Curve Analysis, HRM) etc..Direct sequencing sensitivity is lower, and detection cycle is long, cost High, flux is not high, and is non-stopped pipe reaction, it is difficult to avoid cross contamination.That there are detection cycles is long for RFLP method, operates numerous It is trivial, it is with high costs, it is easy to pollute the deficiencies of.HRM method equally exists complicated for operation, it is difficult to the disadvantages of avoiding pollution.

The application uses amplification refractory mutation system technology (Amplification Refractpry Mutation System, ARMS) combined with Taqman probe method detection EGFR genetic mutation.Amplification refractory mutation system also known as equipotential Gene specific PCR is 3 ' tip designs of the technology ARMS primer of the detection point mutation of based on PCR technology or polymorphism in mutation position Point, the base pairing of the last one base and mutation；It, can specificity using the Taq archaeal dna polymerase without 3 ' -5 ' 5 prime excision enzyme activities Ground identifies that 3 ' end of primer, only 3 ' end of primer are matched clock synchronization completely, could normally be expanded, when mispairing occurs for 3 ' end of primer When, it cannot effectively expand.For Substitution, when using ARMS primer, due to wild type and only one base of saltant type Difference, when wild-type template content is high, it may occur however that invalid primer combines, and thus generates non-specific amplification.Therefore, It is artificially introduced a base mismatch again at the end of primer 3 ', i.e. there are two base mismatch for such wild-type template, are greatly improved and draw Specificity of the object to saltant type template；To only one base mismatch of saltant type template, and can not by experiment in 3 ' ends Screening has the primer of high joint efficiency with mutagenesis template.Suitable primer can be designed for known mutations using ARMS method, And selectively expand mutated gene.

Taqman probe is the detection technique of fluorescence that developed on the basis of Real-time round pcr, is that height is special Different quantitative PCR technique, principle is 5 ' -3 ' the 5 prime excision enzyme activities cutting probe using Taq archaeal dna polymerase, to generate glimmering Optical signal.Original probe 5 ' holds mark fluorescent reporter group, and when probe is complete, base is quenched in 3 ' end mark fluorescent quenching groups Group absorbs the fluorescent energy of reporter group, and probe does not shine, and instrument cannot detect fluorescence signal.It is reacted in quantitative fluorescent PCR In the process, if template DNA does not have to keep intact, cannot equally detect with probe complementary pairing, probe both ends group Fluorescence signal.With the progress of PCR amplification, complementary pairing occurs for template DNA and probe, and probe is by the 3 ' of Taq enzyme -5 ' excision enzymes Activity is cut off, and reporter group is separate with quenching group, and the fluorescence signal of sending can be detected by instrument.Due to probe and template Specific binding, the power of fluorescence signal just represent PCR product number, the fluorescence signal intensity of accumulation and PCR product Amount synchronizes, that is, the amount of the fluorescence issued and the recurring number of amplified reaction are in a linear relationship.Taqman probe the advantages of be energy Enough distinguish the amplification of non-specific amplification and target fragment.

Detection in Gene Mutation is carried out using ARMS combination Taqman probe technique, has high sensitivity compared to other methods, The features such as detection cycle is short, easy to operate, and cost is relatively low, and as a result interpretation is simple and clear.And stopped pipe detects, entire detection process Not open pipe can prevent to pollute.

Summary of the invention

The present invention is directed to screen the ARMS primer and probe that obtain specificity, and optimizing reaction system, detection performance is established The excellent kit for Human epidermal growth factor receptor detection in Gene Mutation.

EGFR genetic mutation focuses primarily upon the 19/20th codon, and the mutantional hotspot that the present invention predominantly detects is shown in Table 1

1 Human epidermal growth factor receptor gene hot somatic mutation of table

The ARMS primer and Taqman for Human epidermal growth factor receptor detection in Gene Mutation has been determined by experiment screening inventor repeatedly Probe.

Present invention firstly provides a kind of kit for Human epidermal growth factor receptor detection in Gene Mutation, respectively include:

For detecting E746_A750del (1)；The mutation upstream primer of E746_A750del (2) mutation, base sequence As shown in SEQ ID NO:11；And/or

For detecting the mutation upstream primer of L858R mutation, base sequence is as shown in SEQ ID NO:16；And/or

For detecting the mutation upstream primer of T790M mutation, base sequence is as shown in SEQ ID NO:18；And/or

For people E746_A750del (1)；The mutation downstream primer of E746_A750del (2) detection in Gene Mutation, base Sequence is as shown in SEQ ID NO:21；And/or

For detecting the mutation downstream primer of L858R mutation, base sequence is as shown in SEQ ID NO:23；And/or

For detecting the mutation downstream primer of T790M mutation, base sequence is as shown in SEQ ID NO:25；And/or

For internal control/external control upstream primer of Human epidermal growth factor receptor detection in Gene Mutation, base sequence is as shown in SEQ ID NO:27； And/or

For internal control/external control downstream primer of Human epidermal growth factor receptor detection in Gene Mutation, base sequence is as shown in SEQ ID NO:28； And/or

For detecting E746_A750del (1)；The mutant probe of E746_A750del (2) mutation, base sequence such as SEQ Shown in ID NO:22；And/or

For detecting the mutant probe of T790M mutation, base sequence is as shown in SEQ ID NO:26；And/or

For detecting the mutant probe of L858R mutation, base sequence is as shown in SEQ ID NO:24；And/or

Preferably, the mutant probe for Human epidermal growth factor receptor detection in Gene Mutation, external control probe, 5 ' terminal modified FAM fluorescence Group；3 ' terminal modified BHQ-1 fluorophors；

For internal control/external control probe of Human epidermal growth factor receptor detection in Gene Mutation, base sequence is as shown in SEQ ID NO:29；With/ Or

Preferably, the internal control probe for Human epidermal growth factor receptor detection in Gene Mutation, 5 ' terminal modified VIC or HEX fluorophors； 3 ' terminal modified BHQ-1 fluorophors.

The above-mentioned kit for Human epidermal growth factor receptor detection in Gene Mutation further includes Uracil DNA Glycosylase (UNG Enzyme is purchased from Jiangsu Zhonghong Biopharma Institute Inc. or Takara), Taq enzyme (be purchased from Jiangsu crowd red-face role's object Engineering Chuan Yao Co., Ltd, research institute or Takara), 10* buffer, MgCl₂, dU plus dNTP (be purchased from Takara), ddH₂O。

The above-mentioned kit for Human epidermal growth factor receptor detection in Gene Mutation, reaction system are UNG enzyme 1-2U, Taq enzyme 0.25- 0.5U, 10* buffer 4ul, 25mMMgCl24~6ul, 10uM dU plus dNTP0.5~1.0ul, DNA profiling 10ng, 1uM Each 1~3ul of upstream and downstream primer, 0.5~1ul of 1uM mutant probe, 1~2ul of 1uM internal control probe, ddH₂O supplies 40ul.

Preferably, the ingredient and content of above-mentioned 10* buffer: 100mMTris-HCl (pH 8.8), 500mM KCl, 15mM MgCl₂, 0.8% (V/V) NP-40.The buffer is that inventor's repeated screening obtains, and can preferably carry out nucleic acid amplification, into And obtain the excellent kit of detection performance.

The above-mentioned kit application method for Human epidermal growth factor receptor detection in Gene Mutation: being added the DNA of clinical sample, synchronous to carry out The detection of positive quality control product and negative quality-control product (purified water), can be completed.PCR response procedures: 50 DEG C, 10min；95 DEG C, 5min；95 DEG C of 15sec, 60 DEG C of 1min 40 circulations.Fluorescence is collected at 60 DEG C.

The specific ARMS primer and probe screened using the present invention, and the reaction system of optimization, can obtain detection Quickly, detection can be completed in 90 minutes in the excellent kit for Human epidermal growth factor receptor detection in Gene Mutation of energy, kit detection；Spirit Sensitivity is high, can detecte content in 10ngDNA sample down to 1% EGFR genetic mutation；Specific high and wild-type samples without Amplification；It is easy to operate, it is low in cost, be conducive to scale, the marketization.

Detailed description of the invention

Fig. 1 L858R F1 and mutant plasmid, wild plasmid amplification situation

Fig. 2 L858R F2 and mutant plasmid, wild plasmid amplification situation

Fig. 3 L858R F4 and mutant plasmid, wild plasmid amplification situation

Fig. 4 L858R F3 and mutant plasmid, wild plasmid amplification situation

Fig. 5 L858R 10%2ng/uL mutant plasmid expanding effect

Fig. 6 L858R 5%2ng/uL mutant plasmid expanding effect

Fig. 7 L858R 1%2ng/uL mutant plasmid expanding effect

Fig. 8 clinical sample testing result (del 19 is positive)

Specific embodiment

Embodiment 1EGFR wild plasmid, mutant plasmid, internal control plasmid construction

EGFR mutant plasmid construct used carrier be Puc57, overall length 2710bp, it is limited by Nanjing Jin Sirui biotechnology Company's building.It is wild plasmid segment 300bp (NG_007726.3), mutant plasmids segment 300bp (NG_007726.3), interior Control plasmid fragments 300bp (NG_007726.3) (choosing conservative region as internal control) is connect with carrier, synthetic plasmid respectively.

The design of embodiment 2 primer, probe

According to abrupt information, the design of primed probe is carried out using 5.0 software of Primer Premier, while in EGFR Design primer and probe on exons 1, as internal control and external control: internal control external control sequence is consistent, and the reporter fluorescence group of modification is not Together.

Primer length is in 19-30 base or so, and G/C content is in 40-60%, and Tm value is at 59-61 DEG C, amplified fragments 150bp Left and right.Missense mutation site is located at last position at the end of upstream primer 3 ', while introducing in the different location of mutation upstream primer Mispairing mutating alkali yl selects satisfactory mutation upstream primer by screening:

E746_A750del(1)；E746_A750del(2):

F1:GTTAAAATTCCCGTCGCTATCAAA

F2:GTTAAAATTCCCGTCGCTATCATA

F3:GTTAAAATTCCCGTCGCTATCACA

F4:GTTAAAATTCCCGTCGCTATCCCA

L858R:

F1:AGCATGTCAAGATCACAGATTTTGGGCG

F2:AGCATGTCAAGATCACAGATTTTGGGAG

F3:AGCATGTCAAGATCACAGATTTTGGACG

F4:AGCATGTCAAGATCACAGATTTTGGTCG

T790M:

F1:CTCCACCGTGCAGCTCATCAT

F2:CTCCACCGTGCAGCTCATCGT

F3:CTCCACCGTGCAGCTCATAAT

F4:CTCCACCGTGCAGCTCATACT

The above primer is respectively as shown in SEQ ID NO:9~SEQ ID NO:20.

29-35 base of probe length or so, G/C content is in 40-60%, and Tm value is at 67-70 DEG C.The following are in kit Other primer and probes used:

It is mutated downstream primer:

E746_A750del(1)；E746_A750del(2):

R:CTCTGAACCTCAGGCCCAC

L858R:

R:GCAGCCTGGTCCCTGGTGT

T790M:

R:GATTACCTTTGCGATCTGCACACAC

The above mutation downstream primer is respectively as shown in SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25.

Inside/outside control primer:

Inside/outside control upstream primer: TGCCAAGGCACGAGTAACAAG

Inside/outside control downstream primer: TCCAAATTCCCAAGGACCAC

Above inside/outside control upstream and downstream primer is respectively as shown in SEQ ID NO:27, SEQ ID NO:28.

Mutant probe:

E746_A750del(1)；E746_A750del(2):

P:CCAACAAGGAAATCCTCGATGTGAGTTTCTG

L858R:

P:CTGGGTGCGGAAGAGAAAGAATACCATGCAG

T790M:

P:AGCTCATGCCCTTCGGCTGCCTCCT

Mutant probe 5 becomes terminal modified FAM fluorophor, and 3 ' quenching groups are BHQ1.

The above mutant probe is respectively as shown in SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26.

Internal control probe: TCTCAGCCTCCAGAGGATGTTCAATAACT

The terminal modified VIC/HEX fluorophor of internal control probe 5 ', 3 ' quenching groups are BHQ1.

External control probe: TCTCAGCCTCCAGAGGATGTTCAATAACT

The terminal modified FAM fluorophor of external control probe 5 ', 3 ' quenching groups are BHQ1.

The above inside/outside control probe is as shown in SEQ ID NO:29.

The preliminary screening of 3 primer of embodiment, probe

Mutant plasmid carried out respectively to primed probe, wild plasmid, the amplification of internal control plasmid, satisfactory mutation draws Object probe combinations are as follows: amplification mutant plasmid does not have amplified reaction with wild type and internal control plasmid.

2 primed probe primary dcreening operation PCR reaction system of table

PCR response procedures: 50 DEG C of 10min；95℃5min；95 DEG C of 15sec, 60 DEG C of 1min 40 circulations, 60 DEG C of whens, collect Fluorescence.

Wherein: internal control/external control amplified fragments are as shown in SEQ ID NO:1；

19 wild-type amplification segment of del is as shown in SEQ ID NO:2；

L858R wild-type amplification segment is as shown in SEQ ID NO:3；

T790M wild-type amplification segment is as shown in SEQ ID NO:4；

19 saltant type of del (E746_A750del (1)) amplified fragments are as shown in SEQ ID NO:5；

19 saltant type of del (E746_A750del (2)) amplified fragments are as shown in SEQ ID NO:6；

L858R saltant type amplified fragments are as shown in SEQ ID NO:7；

T790M saltant type amplified fragments are as shown in SEQ ID NO:8.

L858R primer screening:

When upstream primer selects F1, wild plasmid, mutant plasmids are expanded, undesirable.See Fig. 1.

When upstream primer selects F2, wild plasmid, mutant plasmids are expanded, undesirable.See Fig. 2.

When upstream primer selects F3, mutant plasmids specific amplification, wild plasmid is not expanded, and meets kit research and development It is required that.See Fig. 4.

When upstream primer selects F4, mutant plasmids, wild plasmid are not expanded, undesirable.See Fig. 3.

del 19(E746_A750del(1)；E746_A750del (2)), L858R, T790M primer screening result such as following table It is shown:

Table 3 is mutated upstream primer the selection result

It is mutated upstream primer	Whether mutant plasmids expand	Whether wild plasmid expands	Whether meet kit research and development to require
				del 19-F1	√	√	×
del 19-F2	√	√	×
				del 19-F3	√	×	√
del 19-F4	×	×	×
				L858R-F1	×	×	×
L858R-F2	√	√	×
				L858R-F3	√	√	×
L858R-F4	√	×	√
				T790M-F1	√	√	×
T790M-F2	√	×	√
				T790M-F3	√	√	×
T790M-F4	×	×	×

4 ARMS quantitative fluorescent PCR reaction system of embodiment is established

1, reaction system is established

L858R abrupt climatic change reaction system is established:

Reaction system 1-8 investigates influence of the different magnesium ion concentrations to expanding effect, changes MgCl in table 2₂Dosage point Not Wei 1ul, 2ul, 3ul, 4ul, 5ul, 6ul, 7ul, 8ul, remaining condition is the same as table 2.By comparing, to select 2~4ul be final Concentration.Concentration too low influence PCR amplification yield when other concentration is selected even to expand failure；Excessive concentration influences amplifying specific Property.

Reaction system 9-14 investigates influence of the different dU plus dNTP concentration to expanding effect, changes dU plus in table 2 The dosage of dNTP is respectively 0.2ul, 0.4ul, 0.6ul, 1.0ul, 1.5ul, 2ul, remaining condition is the same as table 2.By comparing choosing Selecting 0.6~1.5ul is ultimate density.When selecting that excessive concentration is easy to happen the starting and extension of non-targeted position when other concentration Nucleotide mismatch generates non-specific band, the yield of the low PCR product of the more sinkings of concentration.

Reaction system 15-19 investigates influence of the different upstream and downstream primer concentration to expanding effect, and upstream and downstream is drawn in change table 2 The dosage of object is respectively each 1ul, 2ul, 3ul, 4ul, 5ul, remaining condition is the same as table 2.By comparing, to select 1~3ul be final Concentration.It selects when other concentration that primer concentration is excessively high to cause mispairing and non-specific amplification, and increases and form two between primer The chance of aggressiveness, the too low then PCR product yield of concentration are few.

Reaction system 20-24 investigates influence of the different probe concentration to expanding effect, and 2 middle probe dosage of change table is respectively 0.5ul, 1ul, 1.5ul, 2ul, 3ul, remaining condition is the same as table 2.By comparing selection 1~2ul of internal control probe, mutant probe 0.5~1ul is ultimate density.It selects when other concentration that concentration and probe concentration is excessively high to cause mispairing and non-specific amplification, and increases The chance of dimer is formed between primer, the too low then PCR product yield of concentration is few.

Reaction system 25-29 investigates influence of the different Taq concentration to expanding effect, changes the dosage difference of Taq enzyme in table 2 For 0.25U, 0.5U, 1U, 2U, 3U, remaining condition is the same as table 2.Select 0.25~0.5U for ultimate density by comparing.Select it Taq enzyme excessive concentration causes non-specific amplification when his concentration, and the too low then PCR product yield of concentration is few

The screening of 4 reaction system of table

It is screened according to same method, (the E746_A750del (1) of del 19；E746_A750del (2)), T790M mutation inspection Survey Establishing:

The preferred reaction system of table 5

2, reaction system performance detection

2.1 kit sensitivity:

3 abrupt climatic change systems carry out the preparation of different proportion plasmid:

Mutant plasmid ratio is 10%, and mutant plasmid concentration is 2ng/ul, internal control plasmid: wild plasmid: mutant plasmid =35:45:20, as strong positive sample；

Mutant plasmid ratio be 5%, mutant plasmid concentration be 2ng/ul, internal control plasmid: wild plasmid: mutant plasmid= 35:55:10, as secondary strong positive sample；

Mutant plasmid ratio be 1%, mutant plasmid concentration be 2ng/ul, internal control plasmid: wild plasmid: mutant plasmid= 35:64:1, as weakly positive sample；

The verifying of sensitivity is carried out using above-mentioned sample.

L858R uses system: Taq 0.25U, UNG 1U, 10*buffer 4ul, 25mM MgCl₂3ul、10uM Each 2ul, 1uM mutant probe 0.5ul of dNTP1.0ul, 1uM upstream and downstream primer, internal control probe 1.5ul, wild/mutation/internal control matter Grain 10ng, ddH₂O complements to 40ul), as a result see Fig. 5-7.The kit high sensitivity of primer of the present invention, probe and its composition, Content in 10ngDNA sample be can detecte down to 1% EGFR genetic mutation.

del 19(E746_A750del(1)；E746_A750del (2)), T790M using in table 5 through preferred reactant System can detecte the clinical sample of the EGFR genetic mutation of content in 10ngDNA sample down to 1%.

2.2 Cut off values (result judgement)

PCR detection is carried out using specific primer and fluorescence probe, is mutated by FAM signal designation, internal control is believed by KEX/VIC Number instruction, external control is by FAM signal designation.

(1) for positive quality control product, mutation, internal control, external control have specific amplification curve；It is interior for negative quality-control product Control, external control have specific amplification curve, are mutated without specific amplification curve；Meet above-mentioned requirements, this test is effective.

(2) every sample be mutated simultaneously, internal control, the amplification of external control, internal control Ct range 15-25；External control Ct range 15- 25；Same sample mutation has specific amplification curve, and being mutated Ct value and external control Ct is worth difference less than 6, then the sample is Otherwise EGFR saltant type is wild type.

The kit of the present invention of embodiment 5 detects clinical sample KRAS gene mutation

5 non-small cell carcinoma clinic paraffin section DNA detections, the extraction of DNA, side are carried out using the paraffin section of OMEGA Method is as follows:

Paraffin section 3-5 of 10-20uM are selected, tumour cell is scraped with blade, is put into 1.5ml centrifuge tube, adds Enter 1ml dimethylbenzene, 10,000 × g 2min after being sufficiently mixed remove dimethylbenzene；

1ml dehydrated alcohol is added, 10,000 × g 2min removes dehydrated alcohol；

Centrifuge tube is opened into lid, 37 DEG C of heat preservation 15min completely remove dehydrated alcohol；

Addition 200ul FTL buffer, 20ul OB Protease, after being sufficiently mixed, 55 DEG C of incubations 3 hours or mistake During which night is mixed by inversion several times；90 DEG C are incubated for 1 hour；

220ul BL buffer is added, is uniformly mixed, 250ul dehydrated alcohol is added and is uniformly mixed；

Mixed liquor is transferred in pillar, pillar is put into collecting pipe, 10,000 × g 1min centrifugation；

Pillar is moved into new collecting pipe, 500ul HB buffer is added, 10,000 × g 1min centrifugation is abandoned and collected Pipe；

Pillar is put into new collecting pipe, 500ul Wash buffer is added, 10,000 × g 1min centrifugation is abandoned and received Collect liquid in pipe；

Pillar is put into new collecting pipe, 500ul Wash buffer is added, 10,000 × g 1min centrifugation is abandoned and received Collector；

Pillar is put into new 1.5ml centrifuge tube, 50ul Elution Buffer is added, is placed at room temperature for 3min, 10, 000 × g 1min is centrifuged to arrive DNA solution.

The paraffin section DNA that the above method extracts is detected, reaction system is 26 (i.e. Taq of reaction system in table 4 0.5U、UNG 1U、10*buffer 4ul、25mM MgCl₂4ul, 10uM dNTP 0.6ul, each 1ul of 1uM upstream and downstream primer, 1uM mutant probe 1ul, internal control probe 1ul, clinical sample 10ng, ddH₂O complements to 40ul)

PCR response procedures: 50 DEG C of 10min；95℃5min；95 DEG C of 15sec, 60 DEG C of 1min 40 circulations, 60 DEG C of whens, collect Fluorescence

In 5 non-small cell carcinoma clinic paraffin sections, 2 EGFR mutation are detected, 3 do not detect that EGFR is mutated, with Xiamen Ai De kit compares, coincidence rate 100%, wherein 1 positive findings is shown in Fig. 8.

3, sequence verification method and conclusion

Paraffin section DNA is subjected to regular-PCR amplification

Reaction system are as follows: Taq enzyme 1U, 10* buffer 4ul, MgCl₂4ul, dU plus dNTP 0.8ul, DNA profiling 50ng, upstream primer 2ul, downstream primer 2ul, ddH₂O supplies 40ul.

Response procedures: 95 DEG C of 5min；95 DEG C of 15sec, 56 DEG C of 30min, 72 DEG C of 30min 35 circulations

Sent outside sequencing (Nanjing Genscript Biotechnology Co., Ltd.) after purification to PCR product, by sequencing result with EGFR genetic mutation detection kit testing result of the present invention is compared, and yin and yang attribute coincidence rate is 100%.

Sequence table

<110>Jiangsu Zhonghong Biopharma Institute Inc.

<120>for the kit of Human epidermal growth factor receptor detection in Gene Mutation and clinical application

<130> 2017.11.29

<160> 29

<170> SIPOSequenceListing 1.0

<210> 1

<211> 300

<212> DNA

<213> Homo sapiens

<400> 1

ccttgaggga ttgttttatt ttagtttttc tgcatttctc agtatttcat gtgatatctg 60

tctttttctt ccagtttgcc aaggcacgag taacaagctc acgcagttgg gcacttttga 120

agatcatttt ctcagcctcc agaggatgtt caataactgt gaggtggtcc ttgggaattt 180

ggaaattacc tatgtgcaga ggaattatga tctttccttc ttaaaggttg gtgactttga 240

ttttcctaca caaataaaat tggagaaaat ctaagtggag aaaggcctgg gcagaattcc 300

<210> 2

<211> 300

<212> DNA

<213> Homo sapiens

<400> 2

agatcactgg gcagcatgtg gcaccatctc acaattgcca gttaacgtct tccttctctc 60

tctgtcatag ggactctgga tcccagaagg tgagaaagtt aaaattcccg tcgctatcaa 120

ggaattaaga gaagcaacat ctccgaaagc caacaaggaa atcctcgatg tgagtttctg 180

ctttgctgtg tgggggtcca tggctctgaa cctcaggccc accttttctc atgtctggca 240

gctgctctgc tctagaccct gctcatctcc acatcctaaa tgttcacttt ctatgtcttt 300

<210> 3

<211> 300

<212> DNA

<213> Homo sapiens

<400> 3

gtttcagggc atgaactact tggaggaccg tcgcttggtg caccgcgacc tggcagccag 60

gaacgtactg gtgaaaacac cgcagcatgt caagatcaca gattttgggc tggccaaact 120

gctgggtgcg gaagagaaag aataccatgc agaaggaggc aaagtaagga ggtggcttta 180

ggtcagccag cattttcctg acaccaggga ccaggctgcc ttcccactag ctgtattgtt 240

taacacatgc aggggcggat gctctccaga cattctgggt gagctcgcag cagctgctgc 300

<210> 4

<211> 300

<212> DNA

<213> Homo sapiens

<400> 4

ctcaagatcg cattcatgcg tcttcacctg gaaggggtcc atgtgcccct ccttctggcc 60

accatgcgaa gccacactga cgtgcctctc cctccctcca ggaagcctac gtgatggcca 120

gcgtggacaa cccccacgtg tgccgcctgc tgggcatctg cctcacctcc accgtgcagc 180

tcatcacgca gctcatgccc ttcggctgcc tcctggacta tgtccgggaa cacaaagaca 240

atattggctc ccagtacctg ctcaactggt gtgtgcagat cgcaaaggta atcagggaag 300

<210> 5

<211> 300

<212> DNA

<213> Homo sapiens

<400> 5

agatcactgg gcagcatgtg gcaccatctc acaattgcca gttaacgtct tccttctctc 60

tctgtcatag ggactctgga tcccagaagg tgagaaagtt aaaattcccg tcgctatcaa 120

aacatctccg aaagccaaca aggaaatcct cgatgtgagt ttctgctttg ctgtgtgggg 180

gtccatggct ctgaacctca ggcccacctt ttctcatgtc tggcagctgc tctgctctag 240

accctgctca tctccacatc ctaaatgttc actttctatg tctttccctt tctagctcta 300

<210> 6

<211> 300

<212> DNA

<213> Homo sapiens

<400> 6

agatcactgg gcagcatgtg gcaccatctc acaattgcca gttaacgtct tccttctctc 60

tctgtcatag ggactctgga tcccagaagg tgagaaagtt aaaattcccg tcgctatcaa 120

gacatctccg aaagccaaca aggaaatcct cgatgtgagt ttctgctttg ctgtgtgggg 180

gtccatggct ctgaacctca ggcccacctt ttctcatgtc tggcagctgc tctgctctag 240

accctgctca tctccacatc ctaaatgttc actttctatg tctttccctt tctagctcta 300

<210> 7

<211> 300

<212> DNA

<213> Homo sapiens

<400> 7

gtttcagggc atgaactact tggaggaccg tcgcttggtg caccgcgacc tggcagccag 60

gaacgtactg gtgaaaacac cgcagcatgt caagatcaca gattttgggc gggccaaact 120

gctgggtgcg gaagagaaag aataccatgc agaaggaggc aaagtaagga ggtggcttta 180

ggtcagccag cattttcctg acaccaggga ccaggctgcc ttcccactag ctgtattgtt 240

taacacatgc aggggcggat gctctccaga cattctgggt gagctcgcag cagctgctgc 300

<210> 8

<211> 300

<212> DNA

<213> Homo sapiens

<400> 8

ctcaagatcg cattcatgcg tcttcacctg gaaggggtcc atgtgcccct ccttctggcc 60

accatgcgaa gccacactga cgtgcctctc cctccctcca ggaagcctac gtgatggcca 120

gcgtggacaa cccccacgtg tgccgcctgc tgggcatctg cctcacctcc accgtgcagc 180

tcatcatgca gctcatgccc ttcggctgcc tcctggacta tgtccgggaa cacaaagaca 240

atattggctc ccagtacctg ctcaactggt gtgtgcagat cgcaaaggta atcagggaag 300

<210> 9

<211> 24

<212> DNA

<213> Homo sapiens

<400> 9

gttaaaattc ccgtcgctat caaa 24

<210> 10

<211> 24

<212> DNA

<213> Homo sapiens

<400> 10

gttaaaattc ccgtcgctat cata 24

<210> 11

<211> 24

<212> DNA

<213> Homo sapiens

<400> 11

gttaaaattc ccgtcgctat caca 24

<210> 12

<211> 24

<212> DNA

<213> Homo sapiens

<400> 12

gttaaaattc ccgtcgctat ccca 24

<210> 13

<211> 28

<212> DNA

<213> Homo sapiens

<400> 13

agcatgtcaa gatcacagat tttgggcg 28

<210> 14

<211> 28

<212> DNA

<213> Homo sapiens

<400> 14

agcatgtcaa gatcacagat tttgggag 28

<210> 15

<211> 28

<212> DNA

<213> Homo sapiens

<400> 15

agcatgtcaa gatcacagat tttggacg 28

<210> 16

<211> 28

<212> DNA

<213> Homo sapiens

<400> 16

agcatgtcaa gatcacagat tttggtcg 28

<210> 17

<211> 21

<212> DNA

<213> Homo sapiens

<400> 17

ctccaccgtg cagctcatca t 21

<210> 18

<211> 21

<212> DNA

<213> Homo sapiens

<400> 18

ctccaccgtg cagctcatcg t 21

<210> 19

<211> 21

<212> DNA

<213> Homo sapiens

<400> 19

ctccaccgtg cagctcataa t 21

<210> 20

<211> 21

<212> DNA

<213> Homo sapiens

<400> 20

ctccaccgtg cagctcatac t 21

<210> 21

<211> 19

<212> DNA

<213> Homo sapiens

<400> 21

ctctgaacct caggcccac 19

<210> 22

<211> 31

<212> DNA

<213> Homo sapiens

<400> 22

ccaacaagga aatcctcgat gtgagtttct g 31

<210> 23

<211> 19

<212> DNA

<213> Homo sapiens

<400> 23

gcagcctggt ccctcctgt 19

<210> 24

<211> 31

<212> DNA

<213> Homo sapiens

<400> 24

ctgggtgcgg aagagaaaga ataccatgca g 31

<210> 25

<211> 25

<212> DNA

<213> Homo sapiens

<400> 25

gattaccttt gcgatctgca cacac 25

<210> 26

<211> 25

<212> DNA

<213> Homo sapiens

<400> 26

agctcatgcc cttcggctgc ctcct 25

<210> 27

<211> 21

<212> DNA

<213> Homo sapiens

<400> 27

tgccaaggca cgagtaacaa g 21

<210> 28

<211> 20

<212> DNA

<213> Homo sapiens

<400> 28

tccaaattcc caaggaccac 20

<210> 29

<211> 29

<212> DNA

<213> Homo sapiens

<400> 29

tctcagcctc cagaggatgt tcaataact 29

Claims

1. it is used for the kit of Human epidermal growth factor receptor detection in Gene Mutation, respectively include:

For detecting E746_A750del (1)；The mutation upstream primer of E746_A750del (2) mutation, base sequence such as SEQ Shown in ID NO:11；And/or

For people E746_A750del (1)；The mutation downstream primer of E746_A750del (2) detection in Gene Mutation, base sequence As shown in SEQ ID NO:21；And/or

For internal control/external control upstream primer of Human epidermal growth factor receptor detection in Gene Mutation, base sequence is as shown in SEQ ID NO:27；With/ Or

For internal control/external control downstream primer of Human epidermal growth factor receptor detection in Gene Mutation, base sequence is as shown in SEQ ID NO:28；With/ Or

For detecting E746_A750del (1)；The mutant probe of E746_A750del (2) mutation, base sequence such as SEQ ID Shown in NO:22；And/or

For the internal control probe of Human epidermal growth factor receptor detection in Gene Mutation, base sequence is as shown in SEQ ID NO:29.

2. the kit according to claim 1 for Human epidermal growth factor receptor detection in Gene Mutation, it is characterised in that: described to be used for people The internal control probe of EGFR genetic mutation detection, 5 ' terminal modified VIC or HEX fluorophors；3 ' terminal modified BHQ-1 fluorophors.

3. the kit according to claim 1 for Human epidermal growth factor receptor detection in Gene Mutation, it is characterised in that: described to be used for people Mutant probe, the external control probe of EGFR genetic mutation detection, 5 ' terminal modified FAM fluorophors, 3 ' quenching groups are BHQ1.

4. the kit according to claim 1 for Human epidermal growth factor receptor detection in Gene Mutation, it is characterised in that: kit reaction Contain 1~2ul of each 1~3ul of 1uM upstream and downstream primer, 1uM mutant probe 0.5-1ul, 1uM internal control or external control probe in system.

5. the kit according to claim 4 for Human epidermal growth factor receptor detection in Gene Mutation, it is characterised in that: kit reaction It further include UNG enzyme 1U, Taq enzyme 0.25-0.5U, 10* buffer 4ul, 2~4ul of 25mM MgCl2,10uM dU in system 0.6~1.5ul of plus dNTP, each 1~3ul of DNA profiling 10ng, 1uM upstream and downstream primer, 0.5~1ul of 1uM mutant probe, 1~2ul of 1uM internal control probe, ddH2O supply 40ul.

6. the kit according to claim 5 for Human epidermal growth factor receptor detection in Gene Mutation, it is characterised in that: the 10* is slow The ingredient and content of fliud flushing: 100mM Tris-HCl (PH 8.8), 500mM KCl, 15mM MgCl₂, 0.8% (V/V) NP-40.