CN109913483A

CN109913483A - A kind of fermentation manufacturing technique of protein drug

Info

Publication number: CN109913483A
Application number: CN201711320516.4A
Authority: CN
Inventors: 张英豪; 李小灵; 孙荣勋; 宛佳; 高海源; 付晶鹏
Original assignee: Shanghai Qingliu Biological Pharmaceutical Co Ltd
Current assignee: Shanghai Puyou Biomedical Co ltd
Priority date: 2017-12-12
Filing date: 2017-12-12
Publication date: 2019-06-21
Also published as: WO2019114534A1

Abstract

The invention discloses a kind of fermentation manufacturing techniques of protein drug, are suitble to industrialization fermenting and producing sDSS1 protein drug, and it includes purification tag in integrator gene segment that step, which includes: that sDSS1 genetic fragment is integrated into expression plasmid first with genetic engineering means,；Expression plasmid is inverted to enter corresponding expressive host, constructs high expression recombined engineering cell；Recombined engineering cell is fermented, inducing expression, cracking, renaturation, digestion obtain thick pure protein；Continue a series of sDSS1 albumen that polishing purification steps obtain high-purity.This process economics is effective.

Description

A kind of fermentation manufacturing technique of protein drug

Technical field

The present invention relates to a kind of fermentation manufacturing techniques of protein drug, belong to protein drug industrialization preparation technical field.

Background technique

Obtaining highly purified destination protein on a large scale and economically is one important for Bio-pharmaceutical Industry Project.In general, the activated protein naturally extracted is more directly effectively, but limited by factors such as raw material, protein abundance, purifying process System, the albumen naturally extracted often not economical and efficient.For routine protein drug, including hormone, vaccine, antibody, polypeptide etc., A more economical efficient approach is provided using the production of the large scale fermentations such as mammalian cell, bacterium, saccharomycete, and Significantly reduce drug cost.But it either ferments for activated protein since protein itself is prone to react The expression efficiency of production and the efficiency of protein purification are all subject to a significant impact.Required reactive protein is split with cell Solution liquid or fermentation liquid are isolated and purified, and reach the purity and safety standard of enough clinical uses, and reduce as far as possible at This, these are the problems that current industrial circle faces.

Shfm1 (split hand/split foot malformation type 1) gene is the pass in people's crab claw disease One of key gene, highly conserved in evolution, its encoded protein D SS1 participates in stable genome, homologous gene recombination, DNA The processes such as injury repair and cell Proliferation [1-4].The result of study of inventor herein shows that DSS1 albumen can be with as label It is added on oxidation protein by the enzymatic reaction of energy consumption, is helped cell clearance oxidation protein [5].These DSS1 eggs as the result is shown The white important function in biological activity.SDSS1 albumen is the DSS1 protein subunit of latest find, and the two is on amino acid sequence There is part similitude, but polypeptide structure is entirely different.As a kind of new type natural albumen, sDSS1 is in amino acid sequence and more Difference in peptide structure determines that its function is more special, thus has bigger potential using value.There has been no data at present Report is directed to the fermentation manufacturing technique of sDSS1 albumen.

Foregoing is directed to quotation:

1.Van Silfhout AT,van den Akker PC,Dijkhuizen T,Verheij JB,Olderode- Berends MJ,Kok K,Sikkema-Raddatz B,van Ravenswaaij-Arts CM(2009)Split hand/ foot malformation due to chromosome 7q aberrations(SHFM1):additional support for functional haploinsufficiency as the causative mechanism.EurJ Hum Genet 17(11):1432-8.

2.Li J,Zou C,Bai Y,Wazer DE,Band V,Gao Q(2006)DSS1is required for the stability of BRCA2.Oncogene 25:1186–1194.

3.Liu J,Doty T,Gibson B,Heyer WD(2010)Human BRCA2protein promotes RAD51filament formation on RPA-covered singlestranded DNA.Nat Struct Mol Biol 17:1260–1262.

4.Zhou Q,Kojic M,Cao Z,Lisby M,Mazloum NA,Holloman WK(2007) Dss1interaction with Brh2as a regulatory mechanism for recombinational repair.Mol Cell Biol 2:2512–2526.

5.Zhang Y,Chang FM,Huang J,Junco JJ,Maffi SK,Pridgen HI,Catano G,Dang H,Ding X,Yang F,Kim DJ,Slaga TJ,He R,Wei SJ(2014)DSSylation,a novel protein modification targets proteins induced by oxidative stress,and facilitates their degradation in cells.Protein Cell 5(2):124-40.

Summary of the invention

The present invention provides a kind of fermentation manufacturing techniques of protein drug, so as to large scale preparation sDSS1 albumen medicine Object.

More particularly to the recombinant vector of sDSS1 albumen, recombined engineering cell, the recombined engineering cell for expressing sDSS1 albumen Fermentation manufacturing technique and application etc. content.

Specific technical solution is as follows:

A kind of recombinant vector of sDSS1 albumen, comprising the genetic fragment of sDSS1 albumen can be encoded in the recombinant vector.

Preferably, the sDSS1 albumen includes that people, chimpanzee, bonobo, gorilla, red hair orangutan, white cheek are long-armed Ape, Rhinopithecus roxellana, rhesus macaque, Rhinopithecus bieti, East Africa baboon, Angola, white any for pushing up white-browed monkey, drill, bruh SDSS1 protein sequence, the wherein amino acid sequence of people sDSS1 such as SEQ ID NO:1, the amino acid sequence of chimpanzee sDSS1 is such as SEQ ID NO:2, the amino acid sequence of bonobo sDSS1 such as SEQ ID NO:3, the amino acid sequence of gorilla sDSS1 is such as The amino acid sequence such as SEQ ID NO:5 of SEQ ID NO:4, red hair orangutan sDSS1, the amino acid sequence of Hylobates leucogenys sDSS1 It arranges such as SEQ ID NO:6, the amino acid sequence of Rhinopithecus roxellana sDSS1 such as SEQ ID NO:7, the amino acid sequence of rhesus macaque sDSS1 It arranges such as SEQ ID NO:8, the amino acid sequence of Rhinopithecus bieti sDSS1 such as SEQ ID NO:9, the amino acid of East Africa baboon sDSS1 Sequence such as SEQ ID NO:10, the amino acid sequence of Angola sDSS1 such as SEQ ID NO:11, white top white-browed monkey sDSS1 Amino acid sequence such as SEQ ID NO:12, the amino acid sequence of drill sDSS1 such as SEQ ID NO:13, bruh sDSS1's Amino acid sequence such as SEQ ID NO:14.

Preferably, the sDSS1 albumen be it is any reach with the described sDSS1 albumen similarity 70% or more egg It is white.

Preferably, the sDSS1 albumen is any based on described 58 amino acid of sDSS1 albumen nitrogen end, Nitrogen end or carbon teminal merge other polypeptide fragments, the structure feature or amino acid sequence feature of the polypeptide fragment for fusion with it is described 31 the same or similar albumen of sequence of sDSS1 albumen carbon teminal.

Preferably, the sDSS1 albumen is any based on described 58 amino acid of sDSS1 albumen nitrogen end, Nitrogen end or carbon teminal merge other polypeptide fragments, and fused albumen is able to achieve the albumen of transmembrane transport function.

31 sequences of 58 amino acid of sDSS1 albumen nitrogen end and sDSS1 albumen carbon teminal described in present specification are respectively Refer to 1-58 amino acid of sDSS1 albumen and the 59-89 amino acid of sDSS1 albumen.

Preferably, the recombinant vector is the expression plasmid of Escherichia coli, bacillus subtilis or streptomycete, or is used In the recombinant dna fragment of Escherichia coli, bacillus subtilis or streptomycete.

Preferably, the carrier is yeast expressed plasmid, or the recombinant dna fragment for saccharomycete.

Preferably, the carrier be the plasmid for mammalian cell expression, slow virus, adenovirus, adeno-associated virus, Retrovirus or baculoviral.

A kind of recombined engineering cell, the engineering cell are that the recombination of any sDSS1 albumen of above scheme is carried Body imported into the recombined engineering cell that can express the sDSS1 albumen that building in corresponding host cell obtains.

Preferably, the recombined engineering cell is Escherichia coli, bacillus subtilis or streptomycete, or can expressed The Escherichia coli of unnatural amino acid, the engineered cells of bacillus or streptomycete are mixed in product.

Preferably, the recombined engineering cell is saccharomycete, or non-natural amino can be mixed in expression product The engineered cells of the saccharomycete of acid.

Preferably, the recombined engineering cell is human embryonic kidney epithelial cells (HEK293 cell), Chinese hamster ovary cell (Chinese hamster ovary celI), small hamster kidney cell (bhk cell), MK cells (COS cell) or insect cell, or can express Mixed in product the human embryonic kidney epithelial cells (HEK293 cell) of unnatural amino acid, Chinese hamster ovary cell (Chinese hamster ovary celI), The engineered cells of small hamster kidney cell (bhk cell), MK cells (COS cell) or insect cell.

Preferably, the protein expression form is inclusion body.

Preferably, the protein expression form is plasmosin.

Preferably, the protein expression form is secretory protein.

A kind of recombined engineering cell, the engineering cell are the recombinant vectors of any sDSS1 albumen of above scheme The middle cell that can express the sDSS1 albumen merges the hybridoma to be formed with tumour cell.

A kind of recombined engineering cell fermentation production technology for expressing sDSS1 albumen refers to above scheme is any described Recombined engineering cell carries out fermenting and producing, including fermentation, the thick pure and fine purification step of albumen of destination protein.

Preferably, the fermentation medium optimization of C/C composites in the fermentation process for Escherichia coli is: yeast extract 10- 50g/L, peptone 10-30g/L, ammonium sulfate 2-10g/L, sodium chloride 2-10g/L, potassium dihydrogen phosphate 0-10g/L, dipotassium hydrogen phosphate 2-15g/L, defoaming agent 0.01-0.1% (v/v), FeSO₄·7H₂O 0-0.1g/L、ZnSO₄·7H₂O 0-0.02g/L、 CuSO₄·5H₂O 0-0.1g/L、MnSO₄·5H₂O 0-0.05g/L、CaCl₂·7H₂O 0-0.01g/L、CoCl₂·6H₂O 0- 0.01g/L、Na₂MoO₄·2H₂O 0-0.01g/L、H₃BO₃ 0-0.0005g/L、Biotin 0-0.005g/L。

Preferably, it is that the culture that fermentation process is generated carries out preliminary treatment that destination protein is slightly pure, and its step are as follows:

1., collect all cells, after smudge cells, isolate inclusion body protein；

2., inclusion body protein pass through denaturation, renaturation, digestion, obtain comprising sDSS1 albumen thick pure products.

Preferably, it is that the culture that fermentation process generates carries out preliminary treatment that destination protein is slightly pure, and its step are as follows:

1., collect all cells, after smudge cells, isolate plasmosin；

2., plasmosin pass through denaturation, renaturation, digestion, obtain comprising sDSS1 albumen thick pure products.

Culture solution is collected, thallus and impurity are removed, obtains the thick pure products in supernatant comprising sDSS1 albumen.

Preferably, albumen polishing purification is that thick pure destination protein is carried out chromatogram purification, obtains the sDSS1 egg of high-purity It is white.

Preferably, the chromatogram purification is any one or any combination that can choose in following chromatography method:

Ion exchange is carried out with strong anion exchange resin, weak anion exchange resin or multi-mode anion exchange resin Chromatography, affinity chromatography carry out reversed phase chromatography with reverse phase filler, sieve chromatography are carried out with molecular exclusion filler and is filled out with hydrophobic Material carries out hydrophobic chromatography.

A kind of application, the recombinant vector of sDSS1 albumen, recombined engineering cell described in above scheme and recombined engineering Cell fermentation production technology is applied to industrial large scale fermentation and produces and purify sDSS1 albumen.

The features of the present invention and/or beneficial effect have:

The recombinant vector of comprehensive sDSS1 albumen, recombined engineering cell, the recombined engineering cell fermentation for expressing sDSS1 albumen Production technology and application etc. content, it can be seen that the fermentation manufacturing technique of protein drug of the invention is first with base Because the sDSS1 genetic fragment of synthesis is integrated on expression vector by engineering means, integrator gene segment constructs be used for albumen simultaneously The label and restriction enzyme site of purifying.Expression vector is inverted to enter corresponding expressive host, to obtain the high table of sDSS1 albumen The recombined engineering cell reached.Recombined engineering cell is fermented, inducing expression, cracking, renaturation, digestion obtain thick pure albumen and produce Object；Continue a series of sDSS1 albumen that polishing purification steps obtain high-purity.

The technical problem to be solved by the present invention is to construct complete sDSS1 albumen industrialized producing technology process, from And meet the demand of functional study and the clinical application of sDSS1 albumen.SDSS1 albumen is a kind of secretory protein, and property is active, easily Protein interaction occurs in other albumen and shields the toxicity of toxic protein.In technical process provided by the invention, add auxiliary Helping the factor (such as urea and surfactant reagent) can be reached by improving the separating degree of destination protein and other albumen point From effect.In fermentation production process, realizes inclusion body expression or the secreting, expressing of sDSS1 albumen, can reduce to the greatest extent The influence of protease digestion.Tunning can simplify purifying by two processes of thick pure procedure and polishing purification to the greatest extent Technique improves purification efficiency, final to obtain the higher destination protein of purity.The combined application of a variety of purifying process can be mentioned greatly High protein purity.This process economics is effective, provides the approach of a plurality of sDSS1 albumen industrialized production.

Detailed description of the invention

With reference to the accompanying drawing, further details of elaboration is done to the present invention, it is clear, complete to enable the invention to, but not It is to limit the scope of the invention.

The Escherichia coli recombinant vector that the verifying building of Fig. 1 agarose gel electrophoresis is completed.By restriction endonuclease BglII and BamHI double digestion, it can be seen that Insert FragmentAnd plasmid fragments

Fig. 2 identifies recombination bacillus coli.SDS-PAGE detects recombination bacillus coli destination protein after IPTG is induced SDSS1 expression.Compared with the control sample not induced, destination protein can be significantly seen by IPTG induction (Strepavidin-SMT3-sDSS1) expression up-regulation.

Escherichia coli Growth curve in Fig. 3 fermentation process.IPTG induction purpose egg was initially added at bacterial growth 3 hours White expression.

Destination protein expression is monitored in Fig. 4 fermentation process.It was sampled respectively at 3 hours, 4 hours, 5 hours of IPTG induction SDS-PAGE testing goal protein expression is carried out, destination protein can stablize expression in the cell.

Fig. 5 inclusion body is enriched with destination protein.SDS-PAGE shows that destination protein is largely enriched in inclusion body, by clear Step is washed, the purity of destination protein further increases in inclusion body.In bacterial lysate and cleaning solution remaining destination protein compared with It is few.

Fig. 6 Protease Treatment obtains sDSS1 albumen.It is incubated for by ULP1 protease and digestion is handled, obtain sDSS1 egg White and digestion products (Strepavidin-SMT3) is used for subsequent polishing purification.

Fig. 7 multicopy is inserted into yeast expressed plasmid construction.It is inserted into target fragment by continuous several times, 6 copies is obtained and inserts The yeast expressed plasmid entered.It constructs the plasmid completed and carries out digestion identification respectively with double restriction endonuclease BglII and BamHI.

Fig. 8 identifies recombinant yeast.The saccharomycete completed is constructed through methanol induction, can detecte the table of destination protein Up to up-regulation (HIS-sDSS1).

Yeast Growth curve in Fig. 9 fermentation process.During the fermentation, 30 hours and cell life of Yeast Growth Length is initially added into methanol after meeting the requirements and is induced.

Figure 10 A. anion-exchange chromatography DEAE Fast Flow column purification process.Arrows sDSS1 albumen wash-out peak.

Figure 10 B. is detected through cation exchange chromatography protein sample.After purification by DEAE Fast Flow, obtain compared with The sDSS1 albumen of high-purity.

Figure 11 A. Histrap excel column affinitive layer purification process.Arrows sDSS1 albumen wash-out peak.

Figure 11 B. is detected through affinitive layer purification protein sample.After Histrap excel affinitive layer purification, obtain The sDSS1 albumen of higher degree.

Figure 12 A. Hitrap Octyl Fast Flow column hydrophobic chromatography purification process.Arrows sDSS1 albumen is washed De- peak.

Figure 12 B. is detected through hydrophobic chromatography purified protein samples.It is pure by Hitrap Octyl Fast Flow hydrophobic chromatography After change, the sDSS1 albumen of higher degree is obtained.

Figure 13 A. Capto adhere column multi-mode chromatographic purifying process.Arrows sDSS1 albumen wash-out peak.

Figure 13 B. is detected through multi-mode chromatographic purifying protein sample.After Capto adhere multi-mode chromatographic purifying, Obtain the sDSS1 albumen of higher degree.

Figure 14 A. 4.6/100 column reverse phase chromatography process of Source 15RPC ST.Arrows sDSS1 albumen is washed De- peak.

Figure 14 B. detects inverted chromatographic purifying protein sample.By 4.6/100 column inversion layer of Source 15RPC ST Analysis after purification, obtains the sDSS1 albumen of higher degree.

Figure 15 Ni-NTA agarose Gel column affinitive layer purification His-sDSS1 albumen.It is detected with SDS-PAGE different The eluting peak in stage, it can be seen that His-sDSS1 purity of protein is higher and higher.

Specific embodiment

The following contents will be illustrated and verify to the preferred embodiment in the present invention in conjunction with example, not be to model of the invention It encloses and is defined.All ranges of the invention limit the restriction being subject in claims.

Experimental method used in following case study on implementation is routine experiment method unless otherwise specified.

Material and reagent can be obtained by commercial sources in following case study on implementation.

Embodiment 1 produces sDSS1 albumen using Escherichia coli fermentation.

1. colibacillus expression plasmid constructs

Nucleotide sequence modification is carried out on the basis of the gene order of people's sDSS1 albumen, it can be in Escherichia coli to obtain The nucleotide sequence of middle normal encoding sDSS1 albumen, and add Strepavidin label (imperfect Strepavidin albumen Segment), restriction enzyme site SMT3, nucleotide sequence such as SEQ ID NO.15.Sangon Biotech (Shanghai) Co., Ltd. is entrusted to close At nucleotide fragments, the sequential structure Strepavidin-SMT3-sDSS1 (942bp) of segment.In restriction enzyme site NcoI PET28a (+) plasmid is cut between (R0193L is purchased from New England Biolabs) and BamHI (R0136L is purchased from NEB), Nucleotide fragments are inserted into plasmid, construct complete recombinant plasmid vector.The verifying of recombinant plasmid vector such as Fig. 1.

2. E. coli recombinant stain constructs

The solution and culture medium prescription that this stage uses:

SOC culture medium (100mL): 2% peptone (is purchased from Angel Yeast Co., Ltd), 0.5% yeast extract (being purchased from Angel Yeast Co., Ltd), 0.05%NaCl, 2.5mM KCl, 10mM MgCl₂, 20mM glucose.

LB culture medium (1L): 10g peptone, 5g yeast extract, 10gNaCl, pH7.2.

5 X SDS sample-loading buffers: 250mM Tris-HCl (pH6.8), 10%SDS, 0.5% bromophenol blue, 50% glycerol, 5% beta -mercaptoethanol, 4 DEG C of packing save after mixing.

IPTG solution: IPTG powder (I6758 is purchased from Sigma-Aldrich) is dissolved in water into 23.83mg/mL (100mM) Aqueous solution, after filtration sterilization 4 DEG C preservation.

E. coli recombinant stain building process:

1. competent cell converts 100 μ L BL21 (DE3) competent cells, (CD601-01 is purchased from the full Shi Jinsheng in Beijing Object Technology Co., Ltd.) from -80 DEG C take out after be put on ice for 30 minutes, take 100ng plasmid (about 1 μ L) be added competence it is thin Cell lysis liquid, gently EP pipe mixes plasmid with competence to knocking three times.EP pipe is put on ice for being incubated for 5 minutes again, then will EP pipe is placed in 42 DEG C of water heat shock 90 seconds, is then rapidly inserted in pipe and is incubated for 15 minutes on ice.Take 1000 μ L SOC culture mediums Centrifuge tube is put into shaking table by suspension cell, and re-suspension liquid is moved in a new 15mL centrifuge tube, and 37 DEG C, 180 rpms (rpm) shaken cultivation 1 hour.

2. monoclonal select take 50 μ L transformed cells to be coated on LB agar plate containing kanamycin (kanamycins is dense 0.005%), 37 DEG C are incubated overnight degree.Second day, random picking 5 to 6 clones were inoculated in 2mL LB culture medium respectively and (contain 0.005% kanamycins concentration), 250rpm shaken cultivation 3 hours in 37 DEG C of environment.

3. verifying purpose protein expression takes 1.5mL inoculum to move in a new sterile test tube, IPTG is added extremely Final concentration 1mM continues shaken cultivation, induction destination protein expression.After 2 hours, culture that is that 200 μ L are induced and not inducing is taken Liquid is respectively placed in 1.5mL centrifuge tube, is centrifuged 15000g, is obtained the cell precipitation of bacterium within 5 minutes.Supernatant is removed, with 200 μ L Cell is resuspended in 1XSDS sample-loading buffer, and 100 DEG C are incubated for 10 minutes, then with sodium dodecyl sulfate-polypropylene acrylamide gel electricity Swimming (SDS-PAGE) (10% pre-prepared colloid, C#NP0321BOX are purchased from Life technology company) testing goal protein expression Situation (Fig. 2), it is final to determine positive monoclonal cell, as recombinant escherichia coli strain.

3. recombination bacillus coli ferments

The solution and culture medium prescription that this stage uses:

Primary-seed medium: yeast extract 5g/L, peptone 10g/L, kanamycin sulfate 50mg/L, glucose 8g/ 7.2,121 DEG C of L, pH sterilize 20 minutes.

Secondary seed medium: yeast extract 5g/L, peptone 10g/L, kanamycin sulfate 50mg/L, glucose 8g/ 7.2,121 DEG C of L, pH sterilize 20 minutes.

Fermentation medium components include: yeast extract 24g/L, peptone 12g/L, ammonium sulfate 5g/L, sodium chloride 5g/L, phosphorus Acid dihydride potassium 5g/L, defoaming agent 0.05% (v/v).

The supplemented medium main component includes: yeast extract 100g/L, peptone 200g/L.

Recombination bacillus coli fermentation process:

1. prepared by first order seed, cryopreservation tube strain is seeded to sterile first order seed according to 0.05% (v/v) inoculum concentration Culture medium, 30 DEG C, 200rpm shaking table shake culture 16 hours is first order seed.；

2. prepared by secondary seed, primary seed solution is seeded to sterile secondary seed according to 5% (v/v) inoculum concentration and is trained Base is supported, 37 DEG C, 250rpm shaking table shake culture 3 hours is secondary seed.

3. fermenting and producing, the fermentation medium fermentation after secondary seed solution is linked into according to 5% inoculum concentration containing sterilizing In tank, fermentation temperature be 37 DEG C, with ammonium hydroxide or sodium hydroxide control pH6.5-7.5 between, dissolved oxygen (DO) be set in 10-30% it Between, revolving speed 100-700rpm, ventilation quantity 1.5vvm, tank press 0.05MPa.

4. the monitoring of fermentation process and feed supplement, periodically sampling carries out OD600 measurement so that it is determined that bacterium produces after fermentation starts Level is drawn growth curve (Fig. 3).Periodically sampling carries out the measurement of concentration of glucose to control concentration of glucose in 35- 45mM.Fermentation once adds asepsis feeding culture medium after starting 3 hours.

5. inducing expression, the IPTG that fermentation starts to be added for 3 hours final concentration of 1.0mM in post-fermentation tank is carried out at 37 DEG C Inducing expression, different periods sampling carry out the destination protein expression (Fig. 4) of SDS-PAGE research and application induction.

6. tunning is collected, terminate fermentation after inducing expression 5 hours, harvest fermentation liquid, 15000g is centrifuged 30 minutes and receives Collect thallus.

4. inclusion body is handled

The solution and culture medium prescription that this stage uses:

Disruption buffer: 20mM Tis-HCL, 1mM EDTA, 5mM DTT, pH7.5.

Washing buffer: 20mM Tis-HCL, 1mM EDTA, 5mM DTT, 4%TritonX-100；

Dissolve buffer: 8M urea, 1mM EDTA, 20mM Tris-HCl, 5mM DTT, pH7.5.

Renaturation buffer: 1mM EDTA, 20mM Tris-HCl, pH8.0.

Inclusion body treatment process:

1. harvests inclusion body 15000g high speed centrifugation and collects thallus, disruption buffer is added in volume ratio 1:10 by weight, high Inclusion body precipitating is collected by centrifugation in twice of homogenizer pressure breaking of pressure.

2., which dissolves inclusion body, precipitates the addition washing buffer of volume ratio 1:10 by weight, room temperature magnetic agitation 1 for inclusion body Hour, the precipitating being collected by centrifugation is washed twice with washing buffer.It is pressed again with solubilization of inclusion bodies buffer after ultrafiltration removal impurity W/v 1:10 dissolution is overnight.After centrifugation removes impurity, protein solution is separated dissolved inclusion body with SDS-PAGE And with coomassie brilliant blue staining (Fig. 5).

3. obtains sDSS1 albumen, slightly pure solution is diluted to protein concentration 25g/L, in renaturation buffer, room temperature renaturation 10 Minute.In the protein solution of renaturation according to 1:3000-1:20000 ratio (according to enzyme activity determine actual ratio) (quality ratio, W/w SUMO protease (Ubiquitin-like-specific protease 1, ULP1)) is added, after mixing in room temperature Lower enzymatic hydrolysis 0.5 hour obtains including sDSS1 albumen slightly pure solution.Protein sample before and after digestion is separated and is passed through through SDS-PAGE Coomassie brilliant blue staining (Fig. 6).

Embodiment 2. produces sDSS1 albumen using saccharomycetes to make fermentation.

1. yeast expressed plasmid construction

Nucleotide sequence modification is carried out on the basis of the gene order of people's sDSS1 albumen, it can be in saccharomycete to obtain The nucleotide sequence of normal encoding sDSS1 albumen, and add 6 X His labels, nucleotide sequence such as SEQ ID NO.16.Committee Tuo Jinsirui Biotechnology Co., Ltd synthesizes genetic fragment, the sequential structure His-sDSS1 (285bp) of segment.

The His-sDSS1 genetic fragment of synthesis is inserted into the α of pPICZ α A plasmid using general Protocols in Molecular Biology It behind the factor, merges the gene of the α factor with His-sDSS1 genetic fragment, obtains plasmid pPICZ α A-His-sDSS1.Below Operating procedure may be implemented in the sequence copy in single pPICZ α A plasmid between the multiple BglII and BamHI of insertion:

1. amplifies the DNA sequence dna on plasmid between BglII and BamHI using round pcr, (this segment includes AOX1promoter, α-factor secretion signal and His-sDSS1 segment, referred to as expression unit), primer is Primerforward:gtctgacgctcagtggaacg, DNA sequence dna such as SEQ ID NO.17 and Primer backward: Cggagtccgagaaaatctggaagag, DNA sequence dna such as SEQ ID NO.18.

2. utilizes agarose gel electrophoresis, product (the Plus DNA Clean/ that glue purification goes out PCR reaction is cut Extraction Kit,GeneMark).Double digestion is carried out to PCR product after purification with restriction endonuclease BglII and BamHI-HF, Go out digestion products (Plus DNA Clean/Extraction Kit, GeneMark) using PCR product Purification Kit.

3. BamHI-HF single endonuclease digestion pPICZ α A-His-sDSS1 purifies digestion products (Plus DNA Clean/ Extraction Kit,GeneMark)。

4. connection above step 2. and 3. products therefrom (Quick ligase kit, NEB), and connection product is direct It is transferred in Top10 competent cell, the cell after conversion is coated on the LB agar plate containing Zeocin, be placed in 37 DEG C and be incubated for Night.

5. picking 10 clones are seeded in respectively in the test tube of the culture medium containing 5mLLB, and 37 DEG C, 250rpm, shaken cultivation mistake Night.

6. harvests the cell being incubated overnight, respectively plasmid purification (Plasmid minutes iprep purification kit II,GeneMark)

7. takes 100ng from every part of step 6. gained plasmid, double enzymes are carried out respectively using restriction endonuclease BglII and BamHI It cuts, the product after digestion is observed with agarose electrophoretic analysis, produces 2000bp (plasmid enzyme restriction segment) and 4000bp DNA piece The clone of section (expression unit endonuclease bamhi) is exactly (i.e. containing two end to end expression units) that expression unit is double copies Clone.Continue repeat step 1. -7., until obtain insertion 6 copy recombination pPICZ α A plasmids.The 2-6 copy that building is completed Plasmid is through digestion identification genetic fragment insertion situation (Fig. 7)

2. recombinant yeast constructs

Pichia yeast (GS115 is purchased from TIANGEN Biotech (Beijing) Co., Ltd.) is fabricated to competent cell first, Then it is mixed with recombinant plasmid, carries out electroporated method building restructuring yeast strains, process is as follows:

Culture medium used in this stage and solution formula:

YPD culture medium (1L): 10g yeast extract, 20g peptone are dissolved in 700mL water, after be settled to 900mL, high pressure is gone out It is cooled to room temperature after bacterium；Add 20% glucose solution 100mL of filtration sterilization, mixes, room temperature or 4 DEG C of preservations.

1M sorbierite (sorbitol) (1L): 182.2g sorbierite is dissolved in 900mL water, is settled to 1L, after high pressure sterilization, 4 DEG C save.

YPD/HEPES (120mL): 100mL YPD culture medium, 20mL1M HEPES (PH8.0), after high pressure sterilization room temperature or 4 DEG C of preservations.

YPD/sorbitol (1L): 10g yeast extract, 20g peptone, 182.2g sorbierite are dissolved in 700mL water, constant volume To 900mL, 100mL20% glucose solution, 4 DEG C of preservations are added after high pressure sterilization.

YPD/sobitol/ antibiotic plate (100mL): 1g yeast extract, 2g peptone, 18.2g sorbierite, constant volume To 90mL, add 1.5 grams of agar, high pressure sterilization.70~80 degree of taking-ups are cooled to, 10mL20% glucose solution, then plus 100 μ L are added (1000X) bleomycin.All solution are quickly poured into the culture plate of diameter 10cm after mixing, room temperature is cooling, after solidification, cover, 4 DEG C are inverted to save backup.

Make competent cell

1. seed is incubated for, 10mL YPD culture medium accesses yeast starter, and 30 DEG C in 100mL triangular flask, 250rpm shook Night.

2. Yeast Cultivation, second day survey triangular flask in bacterium solution OD value, calculate additive amount, be inoculated in 50mL or In 100mLYPD culture medium, culture is to OD value between 0.8 to 1 in 1~2 250mL triangular flask.

3. collects thallus, bacterium solution is shifted into sterile centrifugation tube, and 4 DEG C of 3000g are centrifuged 5 minutes, are discarded supernatant.

4. thallus pre-processes, every 50mL centrifuge tube adds 10mLYPD/HEPES, and oscillation is resuspended；Add 1.25mL 1M DTT, Overturning mixes several times.30 degree are incubated for 15 minutes.

5. thallus is handled, each tube is added 40mL and 1M sorbitol solution, 4 DEG C of 3000g after mixing is pre-chilled after pretreatment Supernatant is abandoned in centrifugation 5 minutes.

6. thallus is handled, the thallus in precipitating continues that the oscillation of 1M sorbierite is pre-chilled with 50mL, then 4 DEG C of 3000g centrifugations 5 Minute, abandon supernatant.Repeated washing three times, that is, obtains competence yeast cells.

Electroporated process

1. draws the 1.5mL EP that 100 μ L competence are added in the pPICZ α A plasmid (most 10ug) containing 6 expression units Guan Zhong, it is soft to mix, it sets on ice.

2. competent cell is transferred in electric revolving cup by, cup injects electroporation, and electroporation sets program, starts electricity Hit conversion.

3. after is electroporated, taking out electric revolving cup rapidly, the cold YPD/sorbitol of 1mL is added, then be sucked out and be put into EP Pipe, 30 degree incubation 1-2 hours (not vibrate).

Select positive colony

1. discarding half supernatant, remaining bacterium solution is uniformly coated on containing bleomycin after mild centrifugation is enriched with thallus The YPD/sobitol plate of (1%, in order to obtain the bacterial strain for being transferred to multicopy, antibiotic concentration improves 20 times).Plate is in 30 DEG C It is incubated for 72-96 hours.

2. selects positive colony, (zeocin+) 30 DEG C of overnight incubations (250rpm) in 50mLYPD culture medium are added.

3. second day, detection bacterium solution OD value about took 10mL bacterium solution as the control sample before induction, centrifugation at 1.5 Collect supernatant.Methanol induction 72 hours of 0.5% are added in remaining culture solution.After the completion of induction, all bacterium solutions are collected, 4 DEG C 3000g is centrifuged 30 minutes, takes supernatant sample preparation.

4. obtain positive colony, SDS-PAGE protein isolate and use coomassie brilliant blue staining, detect successfully induce target egg The positive colony (Fig. 8) of white expression.

3. saccharomycetes to make fermentation

Culture medium used in this stage and solution formula:

PTM1 solution: CuSO₄·5H₂O 6g/L, NaCI 0.08g/L, MnSO₄·H₂O 3g/L, Na₂MoO₄0.2g/L, H₃BO₃0.02g/L, CoCl₂0.5g/L, ZnCl₂20g/L, FeSO₄·7H₂O 65g/L, H₂SO₄5mL/L, biotin 0.2g/ L, filtration sterilization.

BSM inorganic medium: 85%H₃PO₄26.7mL/L CaSO₄·2H₂O 0.93g/L, K₂SO₄18.2g/L, MgSO₄·2H₂O 14.9g/L, KOH 4.13g/L, glycerol 40g/L, PMT14.0mL/L (cannot sterilize, use preceding addition), 25% ammonium hydroxide tune pH5.0 or 10g/L ammonium sulfate tune pH5.0,

Saccharomycetes to make fermentation process

1. the preparation of first order seed takes a glycerol tube genetically engineered cell, 500 μ L access 50mL YPD training is drawn after thawing Base is supported, 220rpm, 30 DEG C are cultivated 18 hours.Detecting cell density (OD600) is about 1-2, and microscopy is without living contaminants, as level-one Seed liquor.

2. primary seed solution 20mL is accessed 500mL YPD culture medium, 220rpm, 30 DEG C of cultures 10 by the preparation of secondary seed Hour.Cell density (OD600) is detected of about for 2-4.Microscopy is without living contaminants, as secondary seed solution.

It sterilizes in the fermenter 3. fermentor prepares 16L BSM inorganic medium (no PTM1), sterilising conditions 121 DEG C, 20 minutes, after being cooled to 30 DEG C, sterile 64mL PTM1 is added.

4. fermentor inoculation secondary seed solution is inoculated in the culture medium of fermentor with 5% ratio.Fermentation temperature is 30.0 ± 0.5 DEG C, initial pH5.00 ± 0.05, initial speed 200rpm is cultivated, and ventilatory capacity 0.5vvm makes dissolved oxygen by revolving speed and air quantity Control is 20%.

5. ferment tank ferments 24 hours or so, when carbon source is exhausted, dissolved oxygen is risen rapidly, at this time thallus weight in wet base Reach about 80g/L.The rate of subsequent 200mL/h per hour adds glycerite (every liter of addition 10mL of percent by volume 50% PTM1).Dissolved oxygen level is set to maintain 30% or more by adjusting speed of agitator, air mass flow, tank pressure.Add glycerol about 6 hours Afterwards, when thallus weight in wet base about 150g/L, stop feed supplement.

6. induces destination protein expression when dissolved oxygen rises, pH value control is adjusted to 6.20 ± 0.05, is initially added into methanol (every liter of addition 12mL PTM1) induction.Initial 2 hours methanol (100141190, be purchased from Sinopharm Chemical Reagent Co., Ltd.) Induce additional amount control in 25mL/h.Gradually methanol speed is improved to 80mL/h in subsequent 6 hours.Maintain oxygen dissolving value 30%.60 hours post-fermentations of methanol induction terminate.Yeast Growth curve is as shown in Figure 9.

4. fermentation liquor treatment

The solution formula used in this step

100mM PMSF solution (100mL): weighing 0.174g crystal PMSF (10837091001, it is purchased from Sigma- Aldrich it) is dissolved in 100mL ethyl alcohol, 4 DEG C of preservations after mixed dissolution.

Tris base solution: 121.14g tris salt is dissolved into 1L distilled water, and it is molten that 1M Tris base is made after dissolution Liquid, 4 DEG C of preservations.

Tunning treatment process

1. collects all fermentation culture mediums of supernatant collection, protease inhibitors is added according to 0.1% ratio immediately PMSF, 4 DEG C of 3000g are centrifuged 30 minutes after mixing, take the supernatant containing destination protein.

2. Tris base adjusts supernatant pH value to 8.0,4 DEG C of 10000g 15 minutes removal insoluble matters of centrifugation, gained Clarified solution is used for subsequent purification.

Not sDSS1 protein purification procedures of tape label after 3. digestion of embodiment.

1. anion exchange purification condition:

Buffer used in this step

Buffer solution A: 20mM Tris-HCl, 1mM EDTA, 5mM DTT, 110mM NaCl, 8M urea, pH8.0.

Buffer solution B: 20mM Tris-HCl, 1mM EDTA, 5mM DTT, 0.5M NaCl, 5% glycerol, pH8.0.

Buffer C:20mM Tris-HCl, 1mM EDTA, 5mM DTT, pH8.0.

DEAE anion exchange purification process

A. it balances, buffer solution A is balanced by DEAE Sepharose Fast Flow anion column with linear velocity 300cm/h (17-0709-01 is purchased from GE life science) 5CV；

B. loading, the protein liquid upper prop that will be handled well with linear velocity 150cm/h；

C. it cleans, pillar 10CV is cleaned with buffer C with linear velocity 300cm/h

D. it eluting, albumen 5CV is eluted with linear velocity 300cm/h buffer solution B, 10mAu, 100mAu/min start to collect, 50mAu, 75mAu/min terminate to collect (Figure 10 A).

E. it detects, collects the albumen of purifying, carry out SDS-PAGE detection, purity assay (Figure 10 B).

2. affinitive layer purification condition:

Buffer used in this step

Buffer solution A: 20mM Tris-HCl, 1mMEDTA, 5mM DTT, 8M urea, pH8.0.

Buffer solution B: 20mM Tris-HCl, 1mMEDTA, 5mM DTT, 0.5M imidazoles, 5% glycerol, 8M urea, pH8.0.

Histrap excel affinitive layer purification process

A. it balances, buffer solution A is balanced by Histrap excel column (17-3712-06, purchased from GE with linear velocity 300cm/h Life science) 5CV；

C. it cleans, pillar 10CV is cleaned with buffer solution A with linear velocity 300cm/h；

D. it eluting, albumen 5CV is eluted with linear velocity 300cm/h buffer solution B, 10mAu, 100mAu/min start to collect, 50mAu, 75mAu/min terminate to collect (Figure 11 A).

E. it detects, collects the albumen of purifying, carry out SDS-PAGE detection, purity assay (Figure 11 B).

3. hydrophobic chromatography purification condition:

Buffer used in this step

Buffer solution A: 20mM Tris-HCl, 1mMEDTA, 5mM DTT, 8M urea, 1M ammonium sulfate, pH8.0.

Buffer solution B: 20mM Tris-HCl, 1mMEDTA, 5mM DTT, 5% glycerol, 8M urea, pH8.0.

Hydrophobic chromatography purification process

A. it balances, buffer solution A is balanced by Octyl Sepharose 4Fast Flow column (17- with linear velocity 300cm/h 0946-02 is purchased from GE life science) 5CV；

D. it eluting, albumen 5CV is eluted with linear velocity 300cm/h buffer solution B, 10mAu, 100mAu/min start to collect, 50mAu, 75mAu/min terminate to collect (Figure 12 A).

E. it detects, collects the albumen of purifying, carry out SDS-PAGE detection, purity assay (Figure 12 B).

4. multi-mode chromatographs Capto adhere purification condition:

Buffer used in this step

Buffer solution A: 20mM Tris-HCl, 1mMEDTA, 5mM DTT, 8M urea, pH8.0.

Buffer solution B: 20mM Tris-HCl, 1mMEDTA, 5mM DTT, 5% glycerol, 8M urea, 1M NaCl, pH8.0.

Multi-mode chromatographs Capto adhere purification process

A. it balances, buffer solution A is balanced by Capto adhere column (28-4058-44, purchased from GE life with linear velocity 300cm/h Life science) 5CV；

D. it eluting, albumen 5CV is eluted with linear velocity 300cm/h buffer solution B, 10mAu, 100mAu/min start to collect, 50mAu, 75mAu/min terminate to collect (Figure 13 A).

E. it detects, collects the albumen of purifying, carry out SDS-PAGE detection, purity assay (Figure 13 B).

5. the purification condition of reverse phase purifying:

Buffer used in this step

Buffer solution A: 10mM Tris HCl, pH7.5

Buffer solution B: 60% acetonitrile, 10mM Tris HCl, pH7.5

Reverse phase purification process

A. it balances, buffer solution A is balanced by 4.6/100 column of Source 15RPC ST with linear velocity 300cm/h

(17506801, be purchased from GE life science) 5CV；

D. it eluting, albumen 5CV is eluted with linear velocity 300cm/h buffer solution B, 10mAu, 100mAu/min start to collect, 50mAu, 75mAu/min terminate to collect (Figure 14 A).

E. it detects, collects the albumen of purifying, carry out SDS-PAGE detection, purity assay (Figure 14 B).

SDSS1 protein expression and purification of the embodiment 4. with HIS label.

The solution formula used in this step

Equilibration buffer (50mL): 50mLTris-HCl, pH7.5,20mM imidazoles, 300mM NaCl, 5mM 2- sulfydryl second Alcohol.

Washing buffer (50mL): 50mLTris-HCl, pH7.5,40mM imidazoles, 300mM NaCl, 5mM 2- sulfydryl second Alcohol.

Low salt buffer (50mL): 50mLTris-HCl, pH7.5,40mM imidazoles, 5mM 2 mercapto ethanol.

Elution buffer is washed (50mL): Tris-HCl, pH7.5,350mM imidazoles, 5mM 2 mercapto ethanol.

Protein purification operating procedure

1. pillar balances, with 15mL balance 5mL Ni-NTA agarose Gel column (30210, be purchased from Qiagen).

2. albumen hanging column, clear Yeast Cultivation supernatant upper prop.

3. pillar washs, pillar is washed with 100mL washing buffer.

4. pillar desalination, cleans pillar with 10mL low salt buffer and desalts.

5. albumen wash-out elutes destination protein with 50mL elution buffer, fraction collection elutes component, uses SDS-PAGE Albumen (Figure 15) in detected components.

6. protein concentration, detect purifying destination protein solution with 3K concentration tube, (UFC900508 is purchased from Millipore protein concentration) is carried out.

Sequence table

<110>Shanghai clear stream biological medicine Science and Technology Ltd.

<120>a kind of fermentation manufacturing technique of protein drug

<130> 2017

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Leu Val Cys Glu Thr Pro Tyr Gly Cys Tyr Val Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 2

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 2

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Leu Val Cys Glu Thr Pro Tyr Gly Cys Tyr Val Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 3

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 3

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Leu Val Cys Glu Thr Pro Tyr Gly Cys Tyr Val Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 4

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 4

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Val

50 55 60

Leu Val Cys Glu Thr Pro Tyr Gly Cys Tyr Val Leu His Gln Lys Glu

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 5

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 5

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Val Thr Val Leu Leu Met Ile

50 55 60

Leu Val Cys Glu Thr Leu Tyr Gly Cys Tyr Val Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 6

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 6

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Ile Leu Leu Met Ile

50 55 60

Leu Val Cys Glu Thr Pro Tyr Gly Cys Tyr Val Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 7

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 7

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 8

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 8

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 9

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 9

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ile Ala Phe Leu Cys Cys

85

<210> 10

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 10

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Lys

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 11

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 11

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 12

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 12

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 13

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 13

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 14

<211> 89

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 14

Met Ser Glu Lys Lys Gln Pro Val Asp Leu Gly Leu Leu Glu Glu Asp

1 5 10 15

Asp Glu Phe Glu Glu Phe Pro Ala Glu Asp Trp Ala Gly Leu Asp Glu

20 25 30

Asp Glu Asp Ala His Val Trp Glu Asp Asn Trp Asp Asp Asp Asn Val

35 40 45

Glu Asp Asp Phe Ser Asn Gln Leu Arg Ala Thr Val Leu Leu Met Ile

50 55 60

Lys Val Tyr Glu Thr Pro Tyr Gly Cys Tyr Ile Leu His Gln Lys Gly

65 70 75 80

Arg Met Cys Ser Ala Phe Leu Cys Cys

85

<210> 15

<211> 942

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

atgggtaacc aactgggcag caccttcatt gttaccgcgg gtgcggacgg tgcgctgacc 60

ggtacctatg aaagcgcggt gggtaacgcg gagagccgtt acgttctgac cggtcgttat 120

gacagcgcgc cggcgaccga tggtagcggt accgcgctgg gctggaccgt ggcgtggaaa 180

aacaactacc gtaacgcgca cagcgcgacc acctggagcg gccagtatgt tggtggcgcg 240

gaagcgcgta tcaacaccca atggctgctg accagcggta ccaccgaggc gaacgcgtgg 300

aagagcaccc tggtgggcca cgataccttc accaaggtta aaccgagcgc ggcgagcggt 360

agcagcggcc acatggcgag catgagcgac agcgaggtga accaggaagc gaagccggaa 420

gtgaaaccgg aagttaagcc ggagacccac atcaacctga aagttagcga tggtagcagc 480

gaaatcttct ttaagattaa gaaaaccacc ccgctgcgtc gtctgatgga agcgttcgcg 540

aaacgtcaag gcaaggagat ggacagcctg cgttttctgt acgatggcat ccgtattcag 600

gcggaccaaa ccccggaaga cctggatatg gaggacaacg atatcattga agcgcaccgt 660

gagcagatcg gtggcagcga gaagaaacaa ccggtggacc tgggtctgct ggaggaagac 720

gatgaattcg aggaatttcc ggcggaggat tgggcgggtc tggacgagga tgaagacgcg 780

cacgtgtggg aagacaactg ggacgatgac aacgttgagg atgacttcag caaccagctg 840

cgtgcgaccg tgctgctgat gattctggtt tgcgaaaccc cgtacggttg ctatgttctg 900

caccagaaag gccgtatgtg cagcgcgttt ctgtgctgct aa 942

<210> 16

<211> 285

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

caccatcacc atcaccatat gagtgagaag aagcagccag ttgacttggg attgttggag 60

gaggacgatg agtttgaaga atttccagcc gaagattggg caggattgga cgaagatgag 120

gacgctcatg tttgggaaga taactgggat gacgataatg tcgaggacga tttttctaac 180

caattgagag ccactgtttt gcttatgatt cttgtctgtg aaaccccata cggatgttac 240

gtcttgcacc agaagggtag aatgtgttca gcctttttgt gttgt 285

<210> 17

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

gtctgacgct cagtggaacg 20

<210> 18

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

cggagtccga gaaaatctgg aagag 25

Claims

1. a kind of recombinant vector of sDSS1 albumen, which is characterized in that comprising sDSS1 albumen can be encoded in the recombinant vector Genetic fragment.

2. the recombinant vector of sDSS1 albumen according to claim 1, which is characterized in that the sDSS1 albumen includes People, chimpanzee, bonobo, gorilla, red hair orangutan, Hylobates leucogenys, Rhinopithecus roxellana, rhesus macaque, Rhinopithecus bieti, East Africa baboon Baboon, Angola, white top white-browed monkey, drill, bruh any sDSS1 protein sequence, the wherein amino acid sequence of people sDSS1 It arranges such as SEQ ID NO:1, the amino acid sequence of chimpanzee sDSS1 such as SEQ ID NO:2, the amino acid sequence of bonobo sDSS1 It arranges such as SEQ ID NO:3, the amino acid sequence of gorilla sDSS1 such as SEQ ID NO:4, the amino acid sequence of red hair orangutan sDSS1 It arranges such as SEQ ID NO:5, the amino acid sequence of Hylobates leucogenys sDSS1 such as SEQ ID NO:6, the amino of Rhinopithecus roxellana sDSS1 Acid sequence such as SEQ ID NO:7, the amino acid sequence of rhesus macaque sDSS1 such as SEQ ID NO:8, the amino of Rhinopithecus bieti sDSS1 Acid sequence such as SEQ ID NO:9, the amino acid sequence of East Africa baboon sDSS1 such as SEQ ID NO:10, Angola sDSS1's Amino acid sequence such as SEQ ID NO:11, the amino acid sequence such as SEQ ID NO:12, drill sDSS1 of white top white-browed monkey sDSS1 Amino acid sequence such as SEQ ID NO:13, the amino acid sequence of bruh sDSS1 such as SEQ ID NO:14.

3. the recombinant vector of sDSS1 albumen according to claim 2, which is characterized in that the sDSS1 albumen is any Reach 70% or more albumen with the sDSS1 albumen similarity.

4. the recombinant vector of sDSS1 albumen according to claim 2, which is characterized in that the sDSS1 albumen is any Based on described 58 amino acid of sDSS1 albumen nitrogen end, other polypeptide fragments are merged in nitrogen end or carbon teminal, for fusion The structure feature or amino acid sequence feature of polypeptide fragment and described 31 the same or similar eggs of sequence of sDSS1 albumen carbon teminal It is white.

5. the recombinant vector of sDSS1 albumen according to claim 2, which is characterized in that the sDSS1 albumen is any Based on described 58 amino acid of sDSS1 albumen nitrogen end, other polypeptide fragments, fused egg are merged in nitrogen end or carbon teminal The white albumen for being able to achieve transmembrane transport function.

6. the recombinant vector of sDSS1 albumen according to claim 1, which is characterized in that the recombinant vector is large intestine bar The expression plasmid of bacterium, bacillus subtilis or streptomycete, or the weight for Escherichia coli, bacillus subtilis or streptomycete Group DNA fragmentation.

7. the recombinant vector of sDSS1 albumen according to claim 1, which is characterized in that the carrier is yeast expressed Plasmid, or the recombinant dna fragment for saccharomycete.

8. the recombinant vector of sDSS1 albumen according to claim 1, which is characterized in that the carrier is dynamic for lactation Plasmid, slow virus, adenovirus, adeno-associated virus, retrovirus or the baculoviral of object cell expression.

9. a kind of recombined engineering cell, which is characterized in that the engineering cell is any sDSS1 of claim 1-8 The recombinant vector of albumen imported into the recombined engineering that can express the sDSS1 albumen that building in corresponding host cell obtains Cell.

10. recombined engineering cell according to claim 9, which is characterized in that the recombined engineering cell be Escherichia coli, Bacillus subtilis or streptomycete, or Escherichia coli, the bacillus of unnatural amino acid can be mixed in expression product Or the engineered cells of streptomycete.

11. recombined engineering cell according to claim 9, which is characterized in that the recombined engineering cell is saccharomycete, or Person is the engineered cells that the saccharomycete of unnatural amino acid can be mixed in expression product.

12. recombined engineering cell according to claim 9, which is characterized in that the recombined engineering cell is on human embryo kidney (HEK) Chrotoplast, Chinese hamster ovary cell, small hamster kidney cell, MK cells or insect cell, or can be in expression product Human embryonic kidney epithelial cells, Chinese hamster ovary cell, small hamster kidney cell, MK cells or the elder brother of middle incorporation unnatural amino acid The engineered cells of worm cell.

13. according to any recombined engineering cell of claim 9-12, which is characterized in that the protein expression form is Inclusion body.

14. according to any recombined engineering cell of claim 9-12, which is characterized in that the protein expression form is Plasmosin.

15. according to any recombined engineering cell of claim 9-12, which is characterized in that the protein expression form is Secretory protein.

16. a kind of recombined engineering cell, which is characterized in that the engineering cell is any sDSS1 of claim 1-8 The cell that the sDSS1 albumen can be expressed in the recombinant vector of albumen merges the hybridoma to be formed with tumour cell.

17. a kind of recombined engineering cell fermentation production technology for expressing sDSS1 albumen, which is characterized in that refer to claim Any recombined engineering cell of 9-16 carries out fermenting and producing, including fermentation, the thick pure and albumen polishing purification of destination protein walk Suddenly.

18. recombined engineering cell fermentation production technology according to claim 17, which is characterized in that in the fermentation process Fermentation medium optimization of C/C composites for Escherichia coli is: yeast extract 10-50g/L, peptone 10-30g/L, ammonium sulfate 2- 10g/L, sodium chloride 2-10g/L, potassium dihydrogen phosphate 0-10g/L, dipotassium hydrogen phosphate 2-15g/L, defoaming agent 0.01-0.1% (v/ v)、FeSO₄·7H₂O 0-0.1g/L、ZnSO₄·7H₂O 0-0.02g/L、CuSO₄·5H₂O 0-0.1g/L、MnSO₄·5H₂O 0-0.05g/L、CaCl₂·7H₂O 0-0.01g/L、CoCl₂·6H₂O 0-0.01g/L、Na₂MoO₄·2H₂O 0-0.01g/L、 H₃BO₃ 0-0.0005g/L、Biotin 0-0.005g/L。

19. any recombined engineering cell fermentation production technology of 7-18 according to claim 1, which is characterized in that purpose egg It is white it is thick it is pure be that the culture that fermentation process is generated carries out preliminary treatment, its step are as follows:

1., collect all cells, after smudge cells, isolate inclusion body protein；

20. any recombined engineering cell fermentation production technology of 7-18 according to claim 1, which is characterized in that purpose egg It is white it is thick it is pure be that the culture that fermentation process generates carries out preliminary treatment, its step are as follows:

1., collect all cells, after smudge cells, isolate plasmosin；

21. any recombined engineering cell fermentation production technology of 7-18 according to claim 1, which is characterized in that purpose egg It is white it is thick it is pure be that the culture that fermentation process is generated carries out preliminary treatment, its step are as follows:

22. any recombined engineering cell fermentation production technology of 7-21 according to claim 1, which is characterized in that extract of protein Thin purifying is that thick pure destination protein is carried out chromatogram purification, obtains the sDSS1 albumen of high-purity.

23. recombined engineering cell fermentation production technology according to claim 22, which is characterized in that the chromatogram purification It is any one in the following chromatography method of selection or any combination:

Ion exchange layer is carried out with strong anion exchange resin, weak anion exchange resin or multi-mode anion exchange resin Analysis, affinity chromatography carry out reversed phase chromatography with reverse phase filler, carry out sieve chromatography with molecular exclusion filler and use dewatering filling Carry out hydrophobic chromatography.

24. a kind of application, which is characterized in that the recombinant vector of any sDSS1 albumen of claim 1-8, right are wanted Seek any recombined engineering cell fermentation production work of 9-16 any the recombined engineering cell and claim 17-22 Skill is applied to industrial large scale fermentation and produces and purify sDSS1 albumen.