CN109355435A

CN109355435A - The nucleic acid compositions and H7N9 virus real-time fluorescence immue quantitative detection reagent box of H7N9 viral diagnosis and its application

Info

Publication number: CN109355435A
Application number: CN201811421482.2A
Authority: CN
Inventors: 罗成
Original assignee: Shenzhen City Of Gang Zhu Medical Science And Technology Co Ltd
Current assignee: Shenzhen City Of Gang Zhu Medical Science And Technology Co Ltd
Priority date: 2018-11-23
Filing date: 2018-11-23
Publication date: 2019-02-19

Abstract

The present invention relates to a kind of nucleic acid compositions of H7N9 viral diagnosis and H7N9 virus real-time fluorescence immue quantitative detection reagent box and its applications.The nucleic acid compositions include the first forward primer and the first reverse primer, first forward primer includes the first matching segment and the first junction fragment from 5 ' ends to 3 ' ends, first matching segment can be matched with hemagglutinin H7 gene fragment complementation to be amplified, and the both ends of the first forward primer are respectively in connection with having the first fluorophor and the first fluorescent quenching group；And/or, second forward primer and the second reverse primer, second forward primer includes the second matching segment and the second junction fragment from 5 ' ends to 3 ' ends, second matching segment can be matched with neuraminidase N9 gene fragment complementation to be amplified, and the both ends of the second forward primer are respectively in connection with having the second fluorophor and the second fluorescent quenching group.Requirement of the above-mentioned nucleic acid compositions to conservative region is lower, and detection sensitivity is higher.

Description

The nucleic acid compositions and H7N9 virus real-time fluorescence quantitative detection of H7N9 viral diagnosis Kit and its application

Technical field

The present invention relates to molecular diagnosis fields, more particularly to the nucleic acid compositions and H7N9 of a kind of H7N9 viral diagnosis Virus real-time fluorescence immue quantitative detection reagent box and its application.

Background technique

Influenza virus belongs to orthomyxoviridae family, and inhereditary material is ribonucleic acid (RNA) molecule of sub-thread, minus strand, multi-segmental. According to influenza nucleoprotein (nuclear protein, NP) antigenic specificity, influenza virus can be divided into tri- type of A, B, C, In, influenza A is the most common influenza virus, and host range is extensive, can infect most of mammals, poultry and open country Bird.According to influenza surface hemagglutinin (HA is to determine the most important albumen of virus virulence) and neuraminidase, (NA is to lead The glycoprotein for causing influenza furnace scattered can be catalyzed sialic acid hydrolysis, and mature influenza virus is assisted to be detached from host cell and infect new Cell) amino acid difference, and influenza A can be divided into 18 HA hypotypes and 11 NA hypotypes.

H7N9 virus is one of influenza virus, and there are hemagglutinin H7 hypotype and neuraminidase N9 hypotype in surface.People Infecting H7N9 bird flu is the Acute respiratory infectious disease as caused by influenza A virus H7N9 hypotype.Patient normally behaves as flowing Feel sample symptom, such as generate heat, cough, few phlegm can be with headache, DOMS and general malaise.Patient with severe symptoms's progression of the disease is rapid, Severe pneumonia is shown as, body temperature continues to have difficulty in breathing at 39 DEG C or more mostly, can be with hemoptysis phlegm；Can rapid progress go out Existing acute respiratory distress syndrome, mediastinal emphysema, pyemia, shock, the disturbance of consciousness and acute kidney injury etc..

2 months 2013, speaker infected H7N9 avian influenza virus epidemic situation, on March 31st, 2013, national health and meter for the first time The notification confirmation of the fertility committee is drawn, finds that 3 first time discovery someone infect H7N9 bird flu case in Shanghai and Anhui, before this This virus only has infection between birds.By 2 months 2017, China occurred 5 people and has infected H7N9 avian influenza virus epidemic situation, was It prevents epidemic situation to infect, takes and close the measures such as live-bird market, all kinds of live-birds transaction of pause, the transport of strict control live-bird, very greatly The development of relative region poultry farming is constrained in degree, and the production and living of the people are affected greatly.

The laboratory that people infects H7N9 bird flu diagnosis and treatment checks to include blood routine, blood biochemistry, etiological examination etc..Aetology Detection is that people infects the screening of H7N9 bird flu, confirms important link." goldstandard " of influenza virus detection is Virus culture, But Virus culture is complicated for operation, and laboratory hardware requirement is high, and the period is long, and positive rate is low, limits its application.In recent years, with The development of molecular diagnostic techniques, the advantages such as PCR fluorescent probe technique is simple and efficient with its, specific, sensibility, real-time quantitative and The screening and confirmation of H7N9 bird flu are infected, applied to people with the defect for overcoming traditional clinical to diagnose.However, traditional PCR is glimmering Light probe technology includes three nucleotide sequences, respectively forward primer, reverse primer and probe.The average length of primer is The average length of 20bp or so, probe are 35bp~30bp, then require the average length long enough of conservative region, and the technology Detection sensitivity it is lower, be not able to satisfy actual demand.

Summary of the invention

Based on this, it is necessary to provide a kind of nucleic acid compositions of H7N9 viral diagnosis, the core of the H7N9 viral diagnosis Acid composition is lower to the average length requirement of conservative region, and detection sensitivity is higher.

In addition, also providing a kind of H7N9 virus real-time fluorescence immue quantitative detection reagent box and its application.

A kind of nucleic acid compositions of H7N9 viral diagnosis, comprising:

For expanding the first forward primer and the first reverse primer of hemagglutinin H7 gene segment to be amplified, described first just It include the first matching segment and the first junction fragment to primer from 5 ' ends to 3 ' ends, the first matching segment can be with the blood Solidifying element H7 gene fragment complementation to be amplified matches, and the both ends of first forward primer are respectively in connection with having the first fluorophor and the One fluorescent quenching group；

And/or the second forward primer and the second reverse primer for expanding neuraminidase N9 gene segment to be amplified, Second forward primer includes the second matching segment and the second junction fragment from 5 ' ends to 3 ' ends, and described second matches segment energy Enough to match with neuraminidase N9 gene fragment complementation to be amplified, the both ends of second forward primer are respectively in connection with having the Two fluorophors and the second fluorescent quenching group.

The first forward primer includes the first matching from 5 ' ends to 3 ' ends in the nucleic acid compositions of above-mentioned H7N9 viral diagnosis Segment and the first junction fragment, the first matching segment can be matched with hemagglutinin H7 gene fragment complementation to be amplified, and first is positive The both ends of primer are respectively in connection with having the first fluorophor and the first fluorescent quenching group, so that the first forward primer can not only be made For primer, additionally it is possible to as probe, quantitative detection is carried out to provide fluorescence signal, to reduce the average length to conservative region The requirement of degree；Second forward primer includes the second matching segment and the second junction fragment from 5 ' ends to 3 ' ends, and second matches segment It can be matched with neuraminidase N9 gene fragment complementation to be amplified, the both ends of the second forward primer are respectively in connection with there is the second fluorescence Group and the second fluorescent quenching group, so that the second forward primer can not only be used as primer, additionally it is possible to as probe, to provide Fluorescence signal and carry out quantitative detection, to reduce the requirement to the average length of conservative region.Experiment proves that with using biography The detection that the PCR fluorescent probe technique of system carries out H7N9 virus is compared, using the nucleic acid compositions of above-mentioned H7N9 viral diagnosis Detection sensitivity it is higher.

First junction fragment is polyA segment in one of the embodiments,；

And/or second junction fragment is polyA segment.

First forward primer further includes the first fault-tolerant segment in one of the embodiments, and described first fault-tolerant Section is located between the first matching segment and first junction fragment, and the first fault-tolerant segment is directed to the hemagglutinin H7 The hypervariable region of gene segment to be amplified is designed, and the first fault-tolerant segment can be to be amplified in the hemagglutinin H7 gene It is cut off when the hypervariable region of segment morphs；

And/or second forward primer further includes the second fault-tolerant segment, the second fault-tolerant segment is located at described second It matches between segment and second junction fragment, the second fault-tolerant segment is to be amplified for the neuraminidase N9 gene The hypervariable region of segment is designed, and the second fault-tolerant segment can be in the neuraminidase N9 gene segment to be amplified It is cut off when hypervariable region morphs.

The described first fault-tolerant segment contains 2~4 bases in one of the embodiments,；

And/or the second fault-tolerant segment contains 2~4 bases.

The nucleotide sequence of first forward primer is described as shown in SEQ ID No.1 in one of the embodiments, The nucleotide sequence of first reverse primer is as shown in SEQ ID No.2；

And/or the nucleotide sequence of second forward primer is as shown in SEQ ID No.3, second reverse primer Nucleotide sequence as shown in SEQ ID No.4.

5 ' ends of first forward primer are combined with first fluorophor in one of the embodiments, described 3 ' ends of the first forward primer are combined with the first fluorescent quenching group；

And/or 5 ' ends of second forward primer are combined with second fluorophor, second forward primer 3 ' ends are combined with the second fluorescent quenching group.

First fluorophor is selected from one of FAM, HEX and VIC in one of the embodiments, and described first Fluorescent quenching group is selected from one of TAMARA and BHQ1.

Second fluorophor is selected from one of FAM, HEX and VIC in one of the embodiments, and described second Fluorescent quenching group is selected from one of TAMARA and BHQ1.

A kind of H7N9 virus real-time fluorescence immue quantitative detection reagent box, the Nucleic acid combinations including above-mentioned H7N9 viral diagnosis Object.

The nucleic acid compositions of above-mentioned H7N9 viral diagnosis are preparing the application in H7N9 virus detection reagent.

Detailed description of the invention

Fig. 1 is the amplification procedure schematic illustration of traditional fluorescent probe technique；

Fig. 2 is the H7N9 disease that the H7N9 virus real-time fluorescence immue quantitative detection reagent box detection of an embodiment is not morphed The schematic illustration of poison；

Fig. 3 is that the H7N9 virus real-time fluorescence immue quantitative detection reagent box detection of Fig. 2 illustrated embodiment is morphed The schematic illustration of H7N9 virus；

Fig. 4 is the amplification curve of the negative control of embodiment 1；

Fig. 5 is the amplification curve of the experimental group 1 of embodiment 1；

Fig. 6 is the amplification curve of the experimental group 2 of embodiment 1；

Fig. 7 is the amplification curve of the experimental group 3 of embodiment 1；

Fig. 8 is that the amplification curve after being detected using kit 1 and kit 2 to sample to be tested of embodiment 2 is compared Figure；

Fig. 9 is that the amplification curve after being detected using kit 1 and kit 2 to sample to be tested of embodiment 3 is compared Figure.

Specific embodiment

In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, combined with specific embodiments below and Specific embodiments of the present invention will be described in detail for attached drawing.Be explained in the following description many details in order to Fully understand the present invention.But the invention can be embodied in many other ways as described herein, art technology Personnel can do similar improvement without violating the connotation of the present invention, therefore the present invention is not by following public specific implementation Limitation.Not specified, the base sequence in sequence table is the sequence from 5 ' ends to 3 ' ends.

The H7N9 virus real-time fluorescence immue quantitative detection reagent box of one embodiment, the kit can treat H7N9 in test sample Virus is detected, and specificity is higher, and sensitivity is higher, and the accuracy of testing result is higher, and then can be used in preparing H7N9 Viral diagnosis device.Above-mentioned H7N9 virus real-time fluorescence immue quantitative detection reagent box includes reaction solution and reaction enzymes.

Sample to be tested is blood or saliva in one of the embodiments,.

Reaction solution includes the nucleic acid compositions of H7N9 viral diagnosis.The nucleic acid compositions of H7N9 viral diagnosis are to conservative The average length requirement in region is lower, and detection sensitivity is higher.Specifically, the nucleic acid compositions of H7N9 viral diagnosis include First forward primer, the first reaction primer, the second forward primer and the second reverse primer.

First forward primer reacts primer for expanding hemagglutinin H7 gene segment to be amplified with first.

Hemagglutinin refers to hemagglutinin (hemagglutinin, HA), is the glycoprotein on influenza virus envelopes surface, It is also the albumen for determining virus virulence.Hemagglutination is known as 18 (H1~H18) kind form.The wherein surface avian influenza virus H7N9 Hemagglutinin be hemagglutinin H7.

The first forward primer includes that the first matching segment and first connect from 5 ' ends to 3 ' ends in one of the embodiments, Segment.First matching segment can be matched with hemagglutinin H7 gene fragment complementation to be amplified.Distinguish at the both ends of first forward primer It is combined with the first fluorophor and the first fluorescent quenching group.Such setting is drawn so that the first forward primer can not only be used as Object, additionally it is possible to as probe, achieve the purpose that quantitative detection to provide fluorescence signal, thus to the average length of conservative region It is required that it is lower, and detection sensitivity is higher.

In a wherein specific example, the first junction fragment is polyA segment.Further, the first junction fragment contains There are 4~6 A bases.

The first fluorophor is selected from one of FAM, HEX and VIC in one of the embodiments,.First fluorescent quenching Group is selected from one of TAMARA and BHQ1.

5 ' ends of the first forward primer are combined with the first fluorophor, the first forward primer in one of the embodiments, 3 ' end be combined with the first fluorescent quenching group.First fluorescent quenching group is connected to the first junction fragment by such setting 3 ' ends, so that first fluorescent quenching group can be with the first connection during amplification hemagglutinin H7 gene segment to be amplified Segment is cut off, so that amplified reaction be made to can continue to.

The first forward primer further includes the first fault-tolerant segment in one of the embodiments,.First fault-tolerant segment is located at the Between one matching segment and the first junction fragment.First fault-tolerant segment for hemagglutinin H7 gene segment to be amplified hypervariable region into Row design.And first fault-tolerant segment can be cut off when the hypervariable region of hemagglutinin H7 gene segment to be amplified morphs.

Such setting, so that during amplification hemagglutinin H7 gene segment to be amplified, if encountering hemagglutinin H7 gene The hypervariable region of segment to be amplified morphs, and the first fault-tolerant segment can not then be matched with the locations complementary to morph, at this point, energy Enough positions corresponding with variable position from the first fault-tolerant segment cut off the first fault-tolerant segment, so that amplified reaction continues and detects Hemagglutinin H7 gene forms missing inspection to avoid due to the segment variation to be amplified of hemagglutinin H7 gene can not continue amplification, detection Accuracy is higher.Optionally, the first fault-tolerant segment can be when the hypervariable region of hemagglutinin H7 gene segment to be amplified morphs Broken by pfu digestion.

It should be noted that the hypervariable region of hemagglutinin H7 gene segment to be amplified, which morphs, to be the prominent of single base Become, can be the mutation of multiple bases.When the variation is the mutation of a base, the first fault-tolerant segment then can not be with the variation Base pair complementarity.It can be continuous multiple base mutations, or multiple when the variation is the mutation of multiple bases The base mutation at interval.When the variation is the mutation of multiple bases, the first fault-tolerant segment then can not be with the alkali of multiple variation Base complementary pairing.

It morphs it should be noted that if encountering a base in the hypervariable region of hemagglutinin H7 gene segment to be amplified When, the first fault-tolerant segment can be cut off in position corresponding with variation base from the first fault-tolerant segment.If encountering hemagglutinin H7 base Because of the change that when multiple bases morph in the hypervariable region of segment to be amplified, can be held from the first fault-tolerant segment and near 5 ' The corresponding position of isobase cuts off the first fault-tolerant segment.

The first forward primer includes sequentially connected first matching piece from 5 ' ends to 3 ' ends in one of the embodiments, Section, the first fault-tolerant segment and the first junction fragment.

Further, the first fault-tolerant segment contains 2~4 bases.At this point, the first fault-tolerant segment can be in hemagglutinin H7 base Because being cut off when at least one in 2~4 bases of corresponding position morphs in the hypervariable region of segment to be amplified.

The first forward primer and the first reverse primer are according to H7N9 subtype avian influenza virus in one of the embodiments, Haemagglutinin antigen (HA) gene order (GenBank:KC853766) design.

Second forward primer and the second reverse primer are for expanding neuraminidase N9 gene segment to be amplified.

Neuraminidase is also known as sialidase (neuraminidase, NA), the one kind being distributed across on influenza virus envelope Glycoprotein has antigenicity, can be catalyzed sialic acid hydrolysis, and mature influenza virus is assisted to be detached from new thin of host cell infected Born of the same parents.At present it is known that influenza A virus in share 11 kinds of different neuraminidase antigen types (i.e. N1~N11).Wherein, fowl The neuraminidase on the surface influenza virus H7N9 is neuraminidase N9.

The second forward primer includes that the second matching segment and second connect from 5 ' ends to 3 ' ends in one of the embodiments, Segment.Second matching segment can be matched with neuraminidase N9 gene fragment complementation to be amplified.The both ends of second forward primer Respectively in connection with having the second fluorophor and the second fluorescent quenching group.Such setting, so that the second forward primer can not only be made For primer, additionally it is possible to as probe, achieve the purpose that quantitative detection to provide fluorescence signal, to be averaged to conservative region Length requirement is lower, and detection sensitivity is higher.

In a wherein specific example, the second junction fragment is polyA segment.Further, the second junction fragment contains There are 4~6 A bases.

The second fluorophor is selected from one of FAM, HEX and VIC in one of the embodiments,.Second fluorescent quenching Group is selected from one of TAMARA and BHQ1.

5 ' ends of the second forward primer are combined with the second fluorophor, the second forward primer in one of the embodiments, 3 ' end be combined with the second fluorescent quenching group.Second fluorescent quenching group is connected to the second junction fragment by such setting 3 ' ends, so that second fluorescent quenching group can be with second during amplification neuraminidase N9 gene segment to be amplified Junction fragment is cut off, so that amplified reaction be made to can continue to.

The second forward primer further includes the second fault-tolerant segment in one of the embodiments,.Second fault-tolerant segment is located at the Between two matching segments and the second junction fragment.Second fault-tolerant segment becomes for the high of neuraminidase N9 gene segment to be amplified Area is designed.And second fault-tolerant segment can when the hypervariable region of neuraminidase N9 gene segment to be amplified morphs quilt Cutting.

Such setting, so that during amplification neuraminidase N9 gene segment to be amplified, if encountering neuraminidase The hypervariable region of N9 gene segment to be amplified morphs, and the second fault-tolerant segment can not then be matched with the locations complementary to morph, At this point, position corresponding with variable position can be cut off by the second fault-tolerant segment from the second fault-tolerant segment, continue amplified reaction To detect neuraminidase N9 gene, to avoid the segment to be amplified variation of detection neuraminidase N9 gene can not continue amplification Missing inspection is formed, the accuracy of detection is higher.Optionally, the second fault-tolerant segment can be in neuraminidase N9 gene segment to be amplified Hypervariable region broken when morphing by pfu digestion.

It should be noted that it can be single base that the hypervariable region of neuraminidase N9 gene segment to be amplified, which morphs, Mutation, can be multiple bases mutation.When the variation is the mutation of a base, the second fault-tolerant segment then can not be with this The base pair complementarity of variation.It can be continuous multiple base mutations when the variation is the mutation of multiple bases, or The base mutation at multiple intervals.When the variation is the mutation of multiple bases, the second fault-tolerant segment then can not be with multiple variation Base pair complementarity.

Become it should be noted that if encountering a base in the hypervariable region of neuraminidase N9 gene segment to be amplified Different time can cut off the second fault-tolerant segment in position corresponding with variation base from the second fault-tolerant segment.If encountering neuraminic acid It, can be from the second fault-tolerant segment and near 5 ' when multiple bases morph in the hypervariable region of enzyme N9 gene segment to be amplified The corresponding position of the variation base at end cuts off the second fault-tolerant segment.

The second forward primer includes sequentially connected second matching piece from 5 ' ends to 3 ' ends in one of the embodiments, Section, the second fault-tolerant segment and the second junction fragment.

Further, the second fault-tolerant segment contains 2~4 bases.At this point, the second fault-tolerant segment can be in neuraminidase It is cut off when at least one in 2~4 bases of corresponding position morphs in the hypervariable region of N9 gene segment to be amplified.

The second forward primer and the second reverse primer are according to H7N9 subtype avian influenza virus in one of the embodiments, Neuraminidase antigen (NA) gene order (GenBank:KC853765) design.

In a wherein specific example, for the nucleotide sequence of the first forward primer as shown in SEQ ID No.1, first is anti- To primer nucleotide sequence as shown in SEQ ID No.2；The nucleotide sequence of second forward primer such as SEQ ID No.3 institute Show, the nucleotide sequence of the second reverse primer is as shown in SEQ ID No.4.Using the nucleic acid compositions of this H7N9 viral diagnosis H7N9 viral diagnosis is carried out, specificity, sensitivity and accuracy are higher.

Specifically, the nucleotide series as shown in SEQ ID No.1 are 5 '-AAACCCGGTCAAACTAAGCAGCGGCTA CAAAA-3 ', wherein first matching segment be AAACCCGGTCAAACTAAGCAGCGG, the first fault-tolerant segment be CTAC, first Junction fragment is AAAA；

The nucleic acid sequence as shown in SEQ ID No.2 is 5 '-CCGAAGCTAAACCARAGTATCACA-3 '；

The nucleotides sequence as shown in SEQ ID No.3 is classified as 5 '-AAATCACCGCCCACAGTGTACAATAGCAAAA-3 ', Wherein, the second matching segment is AAATCACCGCCCACAGTGTACAA, and the second fault-tolerant segment is TAGC, and the second junction fragment is AAAA；

The nucleotides sequence as shown in SEQ ID No.4 is classified as 5 '-ACTAGTACTTGACCAMCCAATGCA-3 '.

Further, 5 ' ends of the first forward primer are combined with the first fluorophor, and 3 ' ends of the first forward primer combine There is the first fluorescent quenching group, the first fluorophor is FAM, and the first fluorescent quenching group is TAMARA.Second forward primer 5 ' ends are combined with the second fluorophor, and 3 ' ends of the second forward primer are combined with the second fluorescent quenching group, the second fluorophor For HEX, the second fluorescent quenching group is TAMARA.

Reaction solution includes 10 μM~20 μM of the first forward primer, the of 10 μM~20 μM in one of the embodiments, One reverse primer, 10 μM~20 μM of the second forward primer, 10 μM~20 μM of the second reverse primer.

Further, reaction solution further includes Tris-HCl, Mg²⁺, the common quantitative fluorescent PCR reaction reagent such as dNTP.Tool Body, reaction solution further includes Tris-HCl, 30mM~50mM (NH of 60mM~150mM₄)₂SO₄, 6mM~10mM MgSO₄、 Bovine serum albumin(BSA) (i.e. BSA) that glycerol that volumn concentration is 5%~10%, volumn concentration are 0.66%~1%, Nonidet P40 (i.e. NP-40) that volumn concentration is 0.12%~0.5%, volumn concentration be 0.1%~ KCl, 4mM~6mM MgCl of 0.2% polysorbas20,100mM~150mM₂, 1mM~2mM dithiothreitol (DTT) (i.e. DTT), The BT of DMSO and 80 μ of μ g/mL~100 g/mL that volumn concentration is 3%~6%.Wherein, BT is thrombin of beef.More into one Step ground, reaction solution further includes the dNTPs of 0.4mM~0.8mM.

H7N9 virus real-time fluorescence immue quantitative detection reagent box further includes reaction enzymes, reaction enzymes in one of the embodiments, Including pfu enzyme.

Pfu enzyme is Pfu archaeal dna polymerase (Pfu DNA polymerase), is in thermophilic ancient core biology Pyrococcus Interior discovery, a kind of enzyme that can in vivo carry out DNA replication dna.The enzyme has 5 ' -3 ' polymerase activities and 3 ' -5 ' circumscribed simultaneously Nuclease therefore in the polymerization can be by the base of cutting mistake incorporation to correct mispairing.By in H7N9 disease Pfu enzyme is added in malicious real time fluorescent quantitative detection kit, so that in gene amplification process, it, can if encountering gene mutation Continue amplified reaction by cutting first fault-tolerant or the second fault-tolerant segment, to reach the purpose of detection H7N9 virus, mentions The accuracy of high detection.

Reaction enzymes include the pfu enzyme of 2U/ μ L~5U/ μ L in one of the embodiments,.Further, pfu enzyme is NEB Company and article No. are the pfu enzyme of E0555 or the pfu enzyme of Qiagen company.

Further, reaction enzymes further include the reverse transcriptase of 10U/ μ L~20U/ μ L.It can be by H7N9 by reverse transcriptase The RNA reverse transcription of virus is at cDNA.

Reaction enzymes and the volume ratio of reaction solution are 15:5~19:1 in one of the embodiments,.

H7N9 virus real-time fluorescence immue quantitative detection reagent box further includes that RNA extracts reagent in one of the embodiments,. RNA extracts the RNA that reagent is used to extract H7N9 virus.Further, it is virus RNA extraction kit that RNA, which extracts reagent,.More into One step, RNA extracts the viral RNA that the article No. that reagent is Gang Zhu medical science and technology Co., Ltd of Shenzhen is RV010-50 and extracts examination Agent box.It should be noted that RNA, which extracts reagent, is not limited to the virus RNA extraction kit pointed out, or other producers Virus RNA extraction kit.

In one of the embodiments, H7N9 virus real-time fluorescence immue quantitative detection reagent box further include H7N9 positive control and H7N9 negative control.Further, positive reference substance is the plasmid containing positive nucleotide sequence.Further, the hylon Nucleotide sequence is identical as the sequence of H7N9 viral DNA.H7N9 negative control is seedless sour water.

The design principle of first forward primer and the second forward primer in the nucleic acid compositions of above-mentioned H7N9 viral diagnosis It is as follows:

Select and determine the hypervariable region of segment to be amplified；Fault-tolerant segment position is designed according to the hypervariable region, fault-tolerant The reference sequences matching of Duan Yuwei variation；Direction design matching segment from 3 ' ends of fault-tolerant segment to 5 ' ends again, matches segment It is matched with the upstream region of reference sequences；3 ' the ends then at fault-tolerant segment add junction fragment, for connecting fluorescent quenching group, To obtain forward primer.

The operating principle of above-mentioned H7N9 virus real-time fluorescence immue quantitative detection reagent box is as follows:

It will be seen from figure 1 that traditional PCR fluorescent probe technique include three nucleotide sequences, respectively forward primer, Reverse primer and probe.Forward primer and reverse primer are used for the amplification of template strand, and probe is for providing fluorescence source.When probe is complete When whole, the fluorescence signal of fluorophor transmitting is quenched group absorptions.When being expanded, probe is digested degradation and makes fluorescence Group and fluorescent quenching group separation, at this point, fluorescence monitoring system can receive fluorescence signal and realize fluorescence detection.

Figure it is seen that using above-mentioned H7N9 virus real-time fluorescence immue quantitative detection reagent box to not mutating When H7N9 virus is detected, forward primer is used as primer, and as probe.When forward primer is complete, fluorophor hair The fluorescence signal penetrated is quenched group absorptions.And in amplification procedure, the junction fragment of the forward primer is polymerize by high-fidelity DNA Digestion is disconnected, so that fluorescent quenching group is separated with fluorophor, and can continue to amplified reaction, and realizes real time fluorescent quantitative Detection.

From figure 3, it can be seen that using above-mentioned H7N9 virus real-time fluorescence immue quantitative detection reagent box to the H7N9 of mutation When virus is detected, forward primer is used as primer, and as probe.When forward primer is complete, fluorophor transmitting Fluorescence signal is quenched group absorptions.And in amplification procedure, if the hypervariable region of segment to be amplified morphs, the forward primer Fault-tolerant segment in cut off with position corresponding at variation by high-fidelity DNA polymerase so that fluorescent quenching group and fluorescent base Group's separation, and can continue to amplified reaction, and realize real time fluorescent quantitative and detect.

Above-mentioned H7N9 virus real-time fluorescence immue quantitative detection reagent box at least has the advantages that

The first forward primer includes to 3 ' ends from 5 ' ends in the nucleic acid compositions of above-mentioned H7N9 viral diagnosis first With segment and the first junction fragment, the first matching segment can be matched with hemagglutinin H7 gene fragment complementation to be amplified, and first just To the both ends of primer respectively in connection with having the first fluorophor and the first fluorescent quenching group, so that the first forward primer can not only As primer, additionally it is possible to as probe, carry out quantitative detection to provide fluorescence signal, be averaged to reduce to conservative region The requirement of length；Second forward primer includes the second matching segment and the second junction fragment from 5 ' ends to 3 ' ends, and second matches piece Section can be matched with neuraminidase N9 gene fragment complementation to be amplified, and the both ends of the second forward primer are second glimmering respectively in connection with having Light group and the second fluorescent quenching group, so that the second forward primer can not only be used as primer, additionally it is possible to as probe, to mention Quantitative detection is carried out for fluorescence signal, to reduce the requirement to the average length of conservative region.Experiment proves that with use The detection that traditional PCR fluorescent probe technique carries out H7N9 virus is compared, using the Nucleic acid combinations of above-mentioned H7N9 viral diagnosis The detection sensitivity of object is higher.

Furthermore traditional PCR fluorescent probe technique includes three nucleotide sequences, respectively forward primer, reversely draw Object and probe.The average length of primer is 20bp or so, and the average length of probe is 35bp~30bp.It is therefore desirable to conserved region Minimum 80bp~the 100bp of the average length in domain, in the genome of virus, if the region that selection is especially conservative, is easy Others gene magnifications come out, cause intersect expand or non-specific amplification, if selection hypervariable region, be easy have it is prominent Signal is weak in the case where change or missing inspection.Meanwhile the genome conservative region of H7N9 virus is longer, but the higher region of discrimination It is less, it is suitble to the DNA sequence dna for doing design of primers region very limited.In the nucleic acid compositions of above-mentioned H7N9 viral diagnosis, pass through Make the first forward primer and the second forward primer primer is used as to be used as probe again so that by shorter conservative region and Above-mentioned four nucleotide sequences can carry out the detection of H7N9 virus, reduce the requirement to the sequence length of conservative region, detection Sensitivity is higher.

Finally, the nucleic acid compositions of above-mentioned H7N9 viral diagnosis include the first fault-tolerant segment and the second fault-tolerant segment, expand During increasing hemagglutinin H7 gene segment to be amplified or neuraminidase N9 gene segment to be amplified, if encountering hemagglutinin H7 base Because of segment to be amplified mutation or the segment to be amplified mutation of neuraminidase N9 gene, the first fault-tolerant segment of cutting or the can be passed through Two fault-tolerant segments and continue amplified reaction with detect H7N9 virus, to avoid because gene mutation can not continue amplification due to form leakage Inspection, can not only accurately detect normal H7N9 virus, additionally it is possible to accurately be examined to the H7N9 virus of gene mutation It surveys, the accuracy of detection is higher, and detection range is bigger.

The following are specific embodiment parts:

It in embodiment if not otherwise indicated using reagent and instrument, is this field conventional selection.It is not specified in embodiment The experimental method of actual conditions, usually according to normal condition, such as condition described in document, books or kit factory The method that family is recommended is realized.Reagent used in embodiment is commercially available.

If not otherwise specified, in following embodiment, reverse transcriptase is the reverse that the article No. of invtrogen company is C28025 Record enzyme；Pfu enzyme is the pfu enzyme of Qiagen company.First forward primer and the first reverse primer are according to H7N9 subtype avian influenza disease Haemagglutinin antigen (HA) gene order (GenBank:KC853766) design of poison.Second forward primer and the second reverse primer root It is designed according to neuraminidase antigen (NA) gene order (GenBank:KC853765) of H7N9 subtype avian influenza virus.

If not otherwise specified, in following embodiment, kit 1 be include: reaction enzymes and reaction solution.Reaction enzymes include 2U/ μ The pfu enzyme of L and the reverse transcriptase of 10U/ μ L.Reaction solution includes 10 μM of the first forward primer, 10 μM of the first reverse primer, 10 μM the second forward primer, 10 μM of the second reverse primer, 120mM Tris-HCl, 33.2mM (NH₄)₂SO₄, 6mM MgSO₄, volumn concentration be 10% glycerol, volumn concentration be 0.66% bovine serum albumin(BSA) (i.e. BSA), volume Nonidet P40 (i.e. NP-40) that percentage composition is 0.12%, the polysorbas20 that volumn concentration is 0.1%, 100mM KCl, 4mM MgCl₂, the dithiothreitol (DTT) (i.e. DTT) of 1mM, the DMSO that volumn concentration is 3%, 80 μ g/mLmL BT And the dNTPs of 0.8mM；The nucleotide sequence of first forward primer is as shown in SEQ ID No.1, the nucleotide of the first reverse primer Sequence is as shown in SEQ ID No.2；The nucleotide sequence of second forward primer is as shown in SEQ ID No.3, the second reverse primer Nucleotide sequence as shown in SEQ ID No.4.5 ' ends of the first forward primer are combined with FAM, 3 ' ends of the first forward primer It is combined with TAMARA；5 ' ends of the second forward primer are combined with HEX, and 3 ' ends of the second forward primer are combined with TAMARA.

Kit 2 is roughly the same with kit 1, the difference is that, the reaction solution of kit 2 include 10 μM first just To primer, 10 μM of the first reverse primer and 10 μM of the first probe, the first forward primer nucleotide sequence such as SEQ ID (as 5 '-GAGGCAATGCAAATAGAATACAGAT-3 ') shown in No.5, the nucleotide sequence of the first reverse primer such as SEQ (as 5 '-CCGAAGCTAAACCAGAGTATCACA-3 ') shown in ID No.6, the nucleotide sequence of the first probe such as SEQ ID (as 5 '-ACCCGGTCAAACTAAGCAGCGGCTAYAA-3 ') shown in No.7；Annex base Y be C base or T base, first 5 ' ends of probe are combined with FAM, and 3 ' ends of the first probe are combined with BHQ2.

Embodiment 1

(1) using universal virus RNA extraction kit (being purchased from Gang Zhu medical science and technology Co., Ltd of Shenzhen) and according to Its operating instruction extracts the viral RNA in sample to be tested, and the viral RNA of extraction is stored in -80 DEG C.Wherein, sample to be tested Including sample 1~3, sample 1 is the H7N9 inactivation of viruses of Wuhan institute of viruses collection, and sample 2 is Wuhan virus research The H7 inactivation of viruses of institute's collection, sample 3 are the N9 inactivation of viruses of Wuhan institute of viruses collection.Positive reference substance is Plasmid containing positive nucleotide sequence, sample 1~3 are respectively provided with corresponding positive reference substance.Positive reference substance thaws, and in making 20s is centrifuged in 2000rpm with preceding.Negative controls are seedless sour water.

(2) prepare kit 1.Reaction solution and reaction enzymes are taken out from kit 1, are melted on ice.Using it is preceding in It is spare that 2000rpm is centrifuged 10s.

(3) sterilized 1.5mL centrifuge tube is taken, the reaction enzymes of 19 μ L are added into each centrifuge tube, adds the anti-of 1 μ L Liquid is answered, of short duration centrifugation (i.e. 2000rpm is centrifuged 20s) after mixing.Experimental group is that experimental group 1~3, positive controls and feminine gender are right According to group, every group of three centrifuge tubes in experimental group 1~3, positive controls and each 1 centrifuge tube of negative control group.To experimental group 1 The viral RNA of the sample 1 of 5 μ L is added in every pipe, the viral RNA of the sample 2 of 5 μ L is added to every pipe of experimental group 2, to experimental group 3 Every pipe be added 5 μ L sample 3 viral RNA, the centrifuge tube of positive controls and negative control group is separately added into the positive of 5 μ L The negative controls of reference substance and 5 μ L, and quantitative fluorescent PCR reaction is carried out according to the reaction condition of table 1.Fluorescence signal acquisition is set It is scheduled on annealing temperature, the reporter fluorescence of H7 gene is FAM, and quenching group selects None；The reporter fluorescence of N9 gene is JOE, is quenched Group selects None.

1 quantitative fluorescent PCR reaction condition of table

(4) testing result is analyzed.Specifically, analysis condition is arranged: according to image adjustment baseline after analysis (Baseline) the Value value of Start value, Stop value and threshold value (Threshold) (can be adjusted voluntarily according to the actual situation Whole, the amplification curve that Start value 5~20, can adjust negative control in 3~15, end value is straight or is lower than threshold value Line), so that instrument is provided correct result.

The standard of quality control are as follows: after the detection of (a) negative controls, the channel FAM/channel JOE is without amplification curve, Ct value It is shown as Undet or No Ct；(b) after positive reference substance detection, there is an amplification curve in the channel FAM and the channel JOE, Ct value≤ 30；Two above require meet simultaneously in same primary experiment, testing result is effective, otherwise, this test testing result without Effect, needs to re-start experiment.

As a result interpretation standard are as follows:

When there is an amplification curve in the channel FAM and the channel JOE, and Ct value is ≤35, can determine that the H7N9 positive；

When the channel FAM and the channel JOE are without amplification curve, H7N9 feminine gender can determine that；

When there are amplification curve, and value≤35 Ct in the channel FAM, and the channel JOE can determine that H7 gene masculine without amplification curve；

When there are amplification curve, and value≤35 Ct in the channel JOE, and the channel FAM can determine that N9 gene masculine without amplification curve.

Wherein, testing result is detailed in Fig. 4~7.Fig. 4 is the amplification curve of negative controls；Fig. 5 is the amplification of experimental group 1 Curve；Fig. 6 is the amplification curve of experimental group 2；Fig. 7 is the amplification curve of experimental group 3.

From Fig. 4~7 as can be seen that negative controls do not have amplification curve, the H7 gene and N9 gene of experimental group 1 have expansion Increase curve, illustrates to sample 1 to be H7N9 positive-virus.The H7 gene of experimental group 2 has amplification curve, and N9 gene does not expand song Line illustrates that sample 2 is H7 positive-virus.The N9 gene of experimental group 3 has amplification curve, and H7 gene does not have amplification curve, explanation Sample 3 is N9 positive-virus.

Embodiment 2

(1) experimental group is divided into two groups, and every group three are parallel, is specifically grouped as follows table 2:

The experimental group of 2 embodiment 2 of table

Grouping	Kit
		Experimental group 1	Kit 1
Experimental group 2	Kit 2

Wherein, the sample to be tested of experimental group 1~2 is the H7N9 inactivation of viruses of Wuhan institute of viruses collection.It should Virus is A/shanghai/1/2013 (H7N9) strain.

(2) real-time fluorescence quantitative PCR detection is carried out to above-mentioned each group sample according to the operation of embodiment 1, using kit 1 Experimental group 1 is detected, experimental group 2 is detected using kit 2.Measurement result is detailed in Fig. 8.Fig. 8 is using reagent Box 1 and kit 2 sample to be tested is detected after amplification curve comparison diagram.

From figure 8, it is seen that the high sensitivity detected using kit 1 illustrates above embodiment in kit 2 The sensitivity with higher of the nucleic acid compositions of H7N9 viral diagnosis.

Embodiment 3

(1) experimental group is divided into two groups, and every group three are parallel, is specifically grouped as follows table 3:

The experimental group of 3 embodiment 3 of table

Grouping	Kit
		Experimental group 1	Kit 1
Experimental group 2	Kit 2

Wherein, the sample to be tested of experimental group 1~2 is the H7N9 inactivation of viruses of Wuhan institute of viruses collection.It should Virus is A/shanghai/2/2013 (H7N9) strain.

(2) real-time fluorescence quantitative PCR detection is carried out to above-mentioned each group sample according to the operation of embodiment 1, using kit 1 Experimental group 1 is detected, experimental group 2 is detected using kit 2.Measurement result is detailed in Fig. 9.Fig. 9 is using reagent Box 1 and kit 2 sample to be tested is detected after amplification curve comparison diagram.

From fig. 9, it can be seen that above-mentioned sample to be tested can be expanded using kit 1, and cannot be expanded using kit 2 Sample to be tested is stated, illustrates that the nucleic acid compositions of the H7N9 viral diagnosis of above embodiment can be to the H7N9 disease of gene mutation Poison is accurately detected, and the accuracy of detection is higher, and detection range is bigger.

Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to above-mentioned reality It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited In contradiction, all should be considered as described in this specification.

The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention Range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.

Sequence table

<110>Shenzhen Gang Zhu medical science and technology Co., Ltd

<120>nucleic acid compositions of H7N9 viral diagnosis and H7N9 virus real-time fluorescence immue quantitative detection reagent box and its application

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 32

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

aaacccggtc aaactaagca gcggctacaa aa 32

<210> 2

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

ccgaagctaa accaragtat caca 24

<210> 3

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

aaatcaccgc ccacagtgta caatagcaaa a 31

<210> 4

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

actagtactt gaccamccaa tgca 24

<210> 5

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gaggcaatgc aaatagaata cagat 25

<210> 6

<211> 24

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

ccgaagctaa accagagtat caca 24

<210> 7

<211> 28

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

acccggtcaa actaagcagc ggctayaa 28

Claims

1. a kind of nucleic acid compositions of H7N9 viral diagnosis characterized by comprising

For expanding the first forward primer and the first reverse primer of hemagglutinin H7 gene segment to be amplified, first forward direction is drawn Object includes the first matching segment and the first junction fragment from 5 ' ends to 3 ' ends, and the first matching segment can be with the hemagglutinin The fragment complementation to be amplified pairing of H7 gene, the both ends of first forward primer are respectively in connection with there is the first fluorophor and first glimmering Optical quenching group；

And/or the second forward primer and the second reverse primer for expanding neuraminidase N9 gene segment to be amplified, it is described Second forward primer includes the second matching segment and the second junction fragment from 5 ' ends to 3 ' ends, and the second matching segment can be with Neuraminidase N9 gene fragment complementation pairing to be amplified, the both ends of second forward primer are second glimmering respectively in connection with having Light group and the second fluorescent quenching group.

2. the nucleic acid compositions of H7N9 viral diagnosis according to claim 1, which is characterized in that first connection sheet Section is polyA segment；

And/or second junction fragment is polyA segment.

3. the nucleic acid compositions of H7N9 viral diagnosis according to claim 1, which is characterized in that first forward direction is drawn Object further includes the first fault-tolerant segment, the first fault-tolerant segment be located at it is described first matching segment and first junction fragment it Between, the first fault-tolerant segment is designed for the hypervariable region of the hemagglutinin H7 gene segment to be amplified, and described first Fault-tolerant segment can be cut off when the hypervariable region of the hemagglutinin H7 gene segment to be amplified morphs；

And/or second forward primer further includes the second fault-tolerant segment, the second fault-tolerant segment is located at second matching Between segment and second junction fragment, the second fault-tolerant segment is directed to the neuraminidase N9 gene segment to be amplified Hypervariable region be designed, and the second fault-tolerant segment can the neuraminidase N9 gene segment to be amplified height become It is cut off when area morphs.

4. the nucleic acid compositions of H7N9 viral diagnosis according to claim 3, which is characterized in that described first fault-tolerant 2~4 bases of Duan Hanyou；

And/or the second fault-tolerant segment contains 2~4 bases.

5. the nucleic acid compositions of H7N9 viral diagnosis according to claim 4, which is characterized in that first forward direction is drawn The nucleotide sequence of object is as shown in SEQ ID No.1, the nucleotide sequence of first reverse primer such as SEQ ID No.2 institute Show；

And/or the nucleotide sequence of second forward primer is as shown in SEQ ID No.3, the core of second reverse primer Nucleotide sequence is as shown in SEQ ID No.4.

6. the nucleic acid compositions of H7N9 viral diagnosis according to any one of claims 1 to 5, which is characterized in that institute 5 ' the ends for stating the first forward primer are combined with first fluorophor, and 3 ' ends of first forward primer are combined with described the One fluorescent quenching group；

And/or 5 ' ends of second forward primer are combined with second fluorophor, 3 ' ends of second forward primer It is combined with the second fluorescent quenching group.

7. the nucleic acid compositions of H7N9 viral diagnosis according to claim 6, which is characterized in that first fluorescent base Group is selected from one of TAMARA and BHQ1 selected from one of FAM, HEX and VIC, the first fluorescent quenching group.

8. the nucleic acid compositions of H7N9 viral diagnosis according to claim 6, which is characterized in that second fluorescent base Group is selected from one of TAMARA and BHQ1 selected from one of FAM, HEX and VIC, the second fluorescent quenching group.

9. a kind of H7N9 virus real-time fluorescence immue quantitative detection reagent box, which is characterized in that including any one of claim 1~8 institute The nucleic acid compositions for the H7N9 viral diagnosis stated.

10. the nucleic acid compositions of any one of the claim 1~8 H7N9 viral diagnosis are in preparation H7N9 virus detection reagent In application.