CN109251973A - HLA-B*5801 genotype quick detection kit based on POCT mode - Google Patents
HLA-B*5801 genotype quick detection kit based on POCT mode Download PDFInfo
- Publication number
- CN109251973A CN109251973A CN201810152060.3A CN201810152060A CN109251973A CN 109251973 A CN109251973 A CN 109251973A CN 201810152060 A CN201810152060 A CN 201810152060A CN 109251973 A CN109251973 A CN 109251973A
- Authority
- CN
- China
- Prior art keywords
- probe
- primer
- kit
- hla
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of HLA-B*5801 genotype quick detection kit based on POCT mode, the kit at least contains fluorescence quantification PCR primer for detecting HLA-B*5801 (rs9263726) genotype and probe (SEQ ID NO:1-4) and cell pyrolysis liquid, furthermore may also include dNTPs, archaeal dna polymerase, Mg2+, reaction buffer, standard positive template, sampling rod, sample collection tube etc..This kit can realize instant detection, it is purified without DNA, sample can be directly added into progress PCR reaction in reagent, it is particularly suitable for quick, the accurate detection of the lower sample of DNA content (such as mouth desquamated cells), Detection accuracy is up to 99% or more, detection sensitivity is high, can accurately detect down to 0.125ng genomic DNA；Entire detection is time-consuming short, and testing result can be obtained in 1 hour, can provide medication foundation to doctor in first time, reduce patient medication risk.
Description
Technical field
The present invention relates to molecular biology fields, specifically, being related to a kind of HLA-B*5801 base based on POCT mode
Because of type quick detection kit.
Background technique
Human leucocyte antigen is one group of gene being located on No. 6 chromosome, is the genetic polymorphism of most complex human
Property system, polymorphism distribution there are apparent group's features.
Allopurinol can inhibit uric acid generation, and most often cause one of the drug of skin adverse reaction.According to statistics, about
Clinically there is the cutaneous anaphylaxis differed in weight in 2% patient for taking allopurinol, although the case less than 1% can turn
Become the serious skin including the high quick syndrome of drug, Stevens-Johnson syndrome and toxic epidermal necrolysis
Adverse reaction, but its death rate is up to 10%-40%.
The study found that the poisonous side effect of medicine with genetic specificity is often closely related with human leukocyte antigen gene.
HLA-B*5801 (rs9263726) gene and high blood hypoxanthine concentration are what allopurinol T lymphocyte specific reacted
Influence factor.Since, HLA-B gene is the most gene of pleomorphism in human genome, different allele codings
HLA-B molecule may affinity to allopurinol it is different, and the HLA-B molecule of high-affinity be easier in conjunction with allopurinol from
And it causes allergic reaction.
Chinese han population, which belongs to, carries the higher crowd of HLA-B*5801 gene frequency, wherein southern Chinese Han Population
Carrying HLA-B*5801 allele probability is 8.35%, and Han People of North carries HLA-B*5801 allele probability and is
5.53%.2008, the just issued instruction of department of TaiWan, China district administration must carry out HLA-B* before taking Allopurinol
5801 detections；American Society of Rheumatism also suggests that asian ancestry crowd examines before taking Allopurinol in gout diagnosis and treatment guide in 2012
Survey HLA-B*5801 gene.Therefore, fast and accurately the individuation for taking other purine patient is used in the detection of HLA-B Genotyping
Medicine has great clinical meaning.
Currently, the method for carrying out analysis detection to HLA-B*5801 allele both at home and abroad mainly has polymerase chain reaction-
Single-strand conformation polymorphism (PCR-SSCP), PCR sequencing PCR and fluorescence quantitative PCR method.PCR sequencing PCR has very high essence to testing result
Degree relies on Large-Scale Precision Instrument and Equipment, fixed laboratory and professional operator, and therefore, this detection method is at high cost,
Complex steps and time-consuming, are clinically difficult to be promoted.PCR-SSCP method is a kind of more classical method, by several right
HLA-B*5801 primer amplified DNA is simultaneously analyzed by electrophoresis result, and this method pollution risk is big, detection cycle is long,
It is also not suitable for clinical use.CN103805701A discloses a kind of fluorescent quantitative PCR detection method.Although this method has cost
Low, the time is short and the simple advantage of interpretation of result, but since the reaction system can only genomic DNA sample after amplification purification
This, it is necessary to it is operated using multi-step multitube, it is also undesirable on clinical expansion.Therefore these conventional detection techniques are all difficult to full
The domestic crowd for carrying HLA-B*5801 mutated gene of foot fast and accurately requires HLA-B*5801 genetic test.
Summary of the invention
The object of the present invention is to provide a set of for detecting the fluorescent quantitation of HLA-B*5801 (rs9263726) genotype
PCR primer and probe.
It is a further object of the present invention to provide a kind of, and HLA-B*5801 (rs9263726) genotype based on POCT mode is fast
Fast detection kit.
In order to achieve the object of the present invention, the present invention provides a set of for detecting HLA-B*5801 (rs9263726) genotype
Fluorescence quantification PCR primer and probe, including upstream primer, downstream primer, wild-type probe and saltant type probe, their core
Nucleotide sequence difference is following (SEQ ID NO:1-4):
Upstream primer: 5 '-GTGGGTTACACCTTGGCCC-3 '
Downstream primer: 5 '-CAGAAATGGTTTGCTGGCTCC-3 '
Wild-type probe: 5 '-F1-ACTCGTCCCCCCCA-Q-3 '
Saltant type probe: 5 '-F2-AGGAAACTCATCCCC-Q-3 '
Preferably, the probe is as follows:
Wild-type probe: 5 '-F1-ACTCGTCCCC+CCCA-Q-3 '
Saltant type probe: 5 '-F2-AGG+AAACTCATCCCC-Q-3 '
Wherein ,+indicate LNA modified base；F1 and F2 is different fluorescent reporter group, and Q is fluorescent quenching group.Example
Such as, F1 FAM, F2 are Texas Red, Q MGB.
The present invention also provides the detection reagents or kit that contain the primer and probe.
It is described anti-the present invention also provides a kind of reaction system for fluorescence quantitative PCR detection HLA-B*5801 genotype
Answering system includes primer and probe, archaeal dna polymerase, dNTPs, Mg shown in SEQ ID NO:1-42+, reaction buffer and cell split
Solve liquid；
Wherein, the cell pyrolysis liquid is made of lauryl sodium sulfate and Triton X-100.
Each component is final concentration of in the reaction system: 0.5-1.5 × PCR reaction buffer, archaeal dna polymerase 0.04-
0.1U/ μ L, dNTPs0.1-0.5mM, 0.2-0.7 μM of upstream primer, 0.2-0.7 μM of downstream primer, wild-type probe 0.2-0.7 μ
M, 0.2-0.7 μM of saltant type probe, Mg2+1-2.5mM and cell pyrolysis liquid；
Wherein, in the reaction system lauryl sodium sulfate and Triton X-100 it is final concentration of
0.0005-0.015%w/v and 0.001-0.03%w/v.
Preferably, the total volume of the reaction system is 23.5 μ L, the final concentration or dosage of each component are as follows: 1.1 × PCR is anti-
Buffer, Taq archaeal dna polymerase 1.25U, dNTPs 0.2mM, 0.3 μM of upstream primer, 0.3 μM of downstream primer, wild type is answered to visit
0.5 μM of needle, 0.4 μM of saltant type probe, Mg2+2.5mM and cell pyrolysis liquid；Lauryl sodium sulfate and poly- in the reaction system
The final concentration of 0.005%w/v and 0.01%w/v or 0.009%w/v and 0.01%w/v of ethylene glycol octyl phenyl ether, or
0.005%w/v and 0.02%w/v or 0.005%w/v and 0.001%w/v or 0.015%w/v and 0.003%w/v, preferably
0.005%w/v and 0.01%w/v.
The present invention also provides a kind of HLA-B*5801 genotype quick detection kit based on POCT mode, the reagent
Box at least contains primer and probe and cell pyrolysis liquid shown in SEQ ID NO:1-4；
Wherein, the cell pyrolysis liquid is made of lauryl sodium sulfate and Triton X-100.In preparation
In PCR reaction system the final concentration of 0.0005-0.015%w/v of lauryl sodium sulfate and Triton X-100 and
0.001-0.03%w/v.Preferably, lauryl sodium sulfate and polyethylene glycol octyl phenyl in the PCR reaction system of preparation
The final concentration of 0.005%w/v and 0.01%w/v or 0.009%w/v and 0.01%w/v or 0.005%w/v of ether and
0.02%w/v or 0.005%w/v and 0.001%w/v or 0.015%w/v and 0.003%w/v, preferably 0.005%w/v and
0.01%w/v.
It further include dNTPs, archaeal dna polymerase, Mg in kit of the present invention2+, reaction buffer, standard positive template,
At least one of sampling rod (for example, disposable oral cavity swab), sample collection tube etc..
Preferably, the archaeal dna polymerase is thermal starting Taq archaeal dna polymerase.
Each component is final concentration of in quantitative fluorescent PCR reaction system matched with kit of the present invention: 0.5-1.5
× PCR reaction buffer, Taq archaeal dna polymerase 0.04-0.1U/ μ L, dNTPs 0.1-0.5mM, 0.2-0.7 μM of upstream primer,
0.2-0.7 μM of downstream primer, 0.2-0.7 μM of wild-type probe, 0.2-0.7 μM of saltant type probe, Mg2+1-2.5mM being split with cell
Solve liquid.Wherein, in the reaction system lauryl sodium sulfate and Triton X-100 final concentration of 0.005%w/
V and 0.01%w/v.
Preferably, the total volume of the reaction system is 23.5 μ L, the final concentration or dosage of each component are as follows: 1.1 × PCR is anti-
Buffer, Taq archaeal dna polymerase 1.25U, dNTPs 0.2mM, 0.3 μM of upstream primer, 0.3 μM of downstream primer, wild type is answered to visit
0.5 μM of needle, 0.4 μM of saltant type probe, Mg2+2.5mM and cell pyrolysis liquid.Wherein, dodecyl sulphate in the reaction system
The final concentration of 0.005%w/v and 0.01%w/v or 0.009%w/v and 0.01%w/ of sodium and Triton X-100
V or 0.005%w/v and 0.02%w/v or 0.005%w/v and 0.001%w/v or 0.015%w/v and 0.003%w/v,
It is preferred that 0.005%w/v and 0.01%w/v.
Preferably, quantitative fluorescent PCR response procedures matched with kit of the present invention are as follows: 95 DEG C of 5min；95 DEG C of 8s,
58 DEG C of 35s, 50 circulations.
By kit of the invention applied to actual sample detect, the detection sample can come from oral cavity wall, tongue,
The positions such as palm, ear, the DNA that the cast-off cells from above-mentioned position release after lysate cracks are used equally for the reagent
The genetic test of box, since scraping oral cavity wall Sample Method is simple and efficient, and sample size is moderate, therefore chooses oral cavity sample and be
It is optimal.Sampling and load procedure can be completed in 20 seconds under normal circumstances.
(1) prepare before sampling
Patient must be gargled 2 times with clear water before sampling, and no less than 5 seconds every time, swallowed 2-3 times after gargling, avoided oral cavity as far as possible
Inner wall remains saliva.Sampling person must wearing gloves, mask.After above-mentioned be ready to complete, it can be sampled.
(2) sampling and sample-adding
Sampling tool is disposable oral cavity swab.Specific sampling process is as follows:
1) reaction solution and swab are taken out from kit and swab packaging bag respectively, then pulls out reagent plug (Fig. 1-a)；
2) swab end cap is removed, should pay attention to not contacting reagent plug (Fig. 1-b) in the process；
3) make cheek wall in the nearly 90 ° of contacts oral cavity of swab end, uniformly wipe 5 times (being up and down 1 time), dynamics is micro- prominent with cheek
Be advisable (Fig. 1-c)；
4) immediately by swab intercalation reaction liquid after sampling, pressing makes itself and the reagent seal of tube, is protected from light temporary (such as 1-d).
Analysis of test results: system intuitively and accurately can carry out analysis reconciliation to testing result by analysis after reaction
It reads, can produce following three kinds of results altogether.
1. Wild homozygous
The testing result has been shown as in analysis system and only green fluorescence curve is exponentially increased trend, and is had
And only (cycle threshold refers to that the fluorescence signal in each reaction tube reaches setting to green fluorescence channel generation Ct value
Recurring number experienced when threshold value).(Fig. 2)
2. mutated homozygous
The testing result has been shown as in analysis system and only red fluorescence curve is exponentially increased trend, and is had
And only red fluorescence channel generates Ct value.(Fig. 3)
3. heterozygous
The testing result shows as green fluorescence curve in analysis system and red fluorescence curve is exponentially increased
Gesture, and green fluorescence channel and red fluorescence channel generate Ct value.(Fig. 4)
By above-mentioned technical proposal, the present invention at least have following advantages and the utility model has the advantages that
(1) detection immediately can be achieved, purified without DNA, sample can be directly added into progress PCR reaction in reagent, 1 is small
When the interior detection information that corresponding gene loci can be obtained；Therefore medication foundation can be provided to doctor in first time, to avoid
Patient medication mistake.
(2) it joined cell pyrolysis liquid in reagent reaction system, Direct Pyrolysis cell and can release in nucleus
Sample is added in DNA, DNA extraction is reacted the stopped pipe in same branch Reagent Tube with PCR and carried out.
(3) this kit sample (DNA or Stomatocyte) Detection accuracy is up to 99% or more.
(4) detection method, sampling process is painless noninvasive, easy to operate, can be complete in single sampling sample-adding 20s
At.
(5) detection sensitivity is high, can accurately detect the genomic DNA down to 0.125ng.It is too long for the holding time
And the lower sample of the DNA contents such as buccal swab can be detected accurately.
(6) this kit can at least place 72h at normal temperature, and 2-8 DEG C can at least place 15 days, and -20 DEG C can at least place
12 months.
(7) present invention employs novel sample-addings to the mode of operation of one step of result, eliminates cumbersome intermediate ring
Section can go out testing result in 1 hour, solve emergency patients and treat urgent problems.Single step, single tube reagent, stopped pipe
A possibility that operating, considerably reducing environmental pollution.
(8) present invention has also matched intellectual analysis program, can directly automatically analyze to data, obtain at once
The genotype call results and medication guide of unbiasedness are reported, laboratory constraint is got rid of, to environment and operator without spy
It is different to require.
(9) common molecular beacon can be used in the probe that the present invention uses, and can also be used while having MGB
(minorgroovebinding) and the Taqman probe of LNA (locknucleicacid) dual modification, but Taqman probe compared with
Molecular beacon itself has greater advantages, and Taqman probe not only greatly reduces background signal intensity, and further increases
The specificity of probe, sensitivity and accuracy.
(10) present invention additionally uses thermal starting enzyme, by optimizing reagent system, can contain oral cavity impurity and ring
The risk that border temperature change is brought.
Detailed description of the invention
Fig. 1 is to carry out sampling and being loaded operational flowchart in detection process using kit of the present invention.
Fig. 2 is the wild homozygote testing result figure in the site HLA-B*5801rs9263726 of the present invention.
Fig. 3 is HLA-B*5801rs9263726 site mutation homozygote testing result figure of the present invention.
Fig. 4 is the site HLA-B*5801rs9263726 Heterozygote detation result figure of the present invention.
Fig. 5 is to add lysate in the embodiment of the present invention 1 and three kinds of genotype Ct Data-Statistics histograms of lysate are not added.
Fig. 6 is to add lysate in the embodiment of the present invention 1 and three kinds of genotype EPF Data-Statistics histograms of lysate are not added.
Fig. 7 is three kinds of genotype Ct Data-Statistics histograms that concentration one, two, three matches in the embodiment of the present invention 3.Number in figure
According to through multiple comparative test statistical difference, by the descending comparison of mean value, same letter indicate difference it is not significant (p≤
0.05), different letters indicate significant difference (P≤0.05).
Fig. 8 is that three kinds of genotype EPF count histogram in the embodiment of the present invention 3.Data are united through multiple comparative test in figure
Meter learns difference, and by the descending comparison of mean value, same letter indicates that difference is not significant (p >=0.05), and different letters indicate difference
Significantly (P≤0.05).
Fig. 9 is three kinds of genotype Ct Data-Statistics histograms in the embodiment of the present invention 3.Note: being that difference is not significant between each group
(P>0.05)。
Figure 10 is that three kinds of genotype end point fluorescence values (EPF) count histogram in the embodiment of the present invention 3.
Figure 11 A- Figure 11 C is three kinds of genotype Ct Data-Statistics figures of A, B, C group in the embodiment of the present invention 8
Figure 12 A- Figure 12 C is three kinds of genotype end point fluorescence value (EPF) statistical charts of A, B, C group in the embodiment of the present invention 8.
Figure 13 is the PCR amplification result of 8 pairs of primers in the embodiment of the present invention 9.
Figure 14 A- Figure 14 C is the qPCR testing result of 9 middle probe P1wp1m of the embodiment of the present invention；Wherein, A is wild homozygosis
Sub- testing result, B are no mutant homozygote testing result, and C is Heterozygote detation result.
Figure 15 A- Figure 15 C is the qPCR testing result of 9 middle probe P1wp2m of the embodiment of the present invention；Wherein, A is wild homozygosis
Sub- testing result, B are no mutant homozygote testing result, and C is Heterozygote detation result.
Figure 16 A- Figure 16 C is the qPCR testing result of 9 middle probe P1wp3m of the embodiment of the present invention；Wherein, A is wild homozygosis
Sub- testing result, B are no mutant homozygote testing result, and C is Heterozygote detation result.
In Fig. 5,6 and Figure 10-12, " * " is indicated compared with the control group, this group of data difference is significant (P≤0.05), " * * " table
Show that difference is extremely significant (P≤0.01)；Compared with the control group, this group of data difference be not significant (P > 0.05) for the expression not indicated.
" G " indicates that green fluorescence channel, " R " indicate red fluorescence channel.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
According to conventional laboratory conditions, such as Sambrook molecular cloning experiment handbook (Sambrook J&Russell DW,
Molecular Cloning:a Laboratory Manual, 2001), or according to the condition of manufacturer's specification suggestion.
HLA-B*5801 genotype quick detection kit used in the following embodiment based on POCT mode, at least contains
There are primer and probe and cell pyrolysis liquid shown in SEQ ID NO:1-4, furthermore may also include dNTPs, archaeal dna polymerase, Mg2+、
PCR reaction buffer, standard positive template, disposable oral cavity swab, sample collection tube etc..
In the present invention, the corresponding fluorescent reporter group of the wild-type probe being related to is FAM, quenching group MGB, saltant type
The corresponding fluorescent reporter group of probe is Texas Red, quenching group MGB.
1 cell pyrolysis liquid performance test of embodiment
PCR is a kind of extremely sensitive minim DNA detection technique.The main sample of current clinically painless non-invasive detection methods
Originally there are buccal swab, hair, nail, saliva of buccal cavity and coelomic fluid etc., these samples are both needed to professional to be made in specialized laboratory
With the instrument and equipment of profession, PCR reaction after DNA extraction purification contained therein, will can be just added by complicated operating process
System is reacted, and needs to expend a large amount of human and material resources, financial resources.In order to solve this problem, while in view of being directly added into
Expanding effect is undesirable after cell, is not suitable for clinical detection, and inventor attempts to joined certain density cell pyrolysis liquid.And
It carries out adding cell pyrolysis liquid and the comparative experiments that cell pyrolysis liquid is not added.(note: using cast-off cells as template)
Agent prescription is shown in Table 1-1, and 3 kinds of different phenotypes respectively prepare 100 repetitions, and response procedures are shown in Table 1.
Table 1-1 difference sample tests PCR and reacts total system formula table
| Composition | Concentration one | Concentration two |
| 5×Promega Colorless Reaction Buffer | 1.1× | 1.1× |
| dNTP(10mM) | 0.2mM | 0.2mM |
| MgCl2(25mM) | 2.5mM | 2.5mM |
| 200 × cell pyrolysis liquid | 1× | - |
| HLA-B*5801 upstream primer (100 μM) | 0.5μM | 0.5μM |
| HLA-B*5801 downstream primer (100 μM) | 0.5μM | 0.5μM |
| HLA-B*5801 wild-type probe | 0.5μM | 0.5μM |
| HLA-B*5801 saltant type probe | 0.5μM | 0.5μM |
| Archaeal dna polymerase (5U/ μ L) | 1.25U | 1.25U |
| Stomatocyte | + | + |
| Ultrapure water is added to total volume | 23.5μL | 23.5μL |
Final concentration of the 0.005% of lauryl sodium sulfate and Triton X-100 in above-mentioned PCR reaction system
W/v and 0.01%w/v.
1 two-step method response procedures of table
Experimental result:
(1) Ct Data-Statistics the results are shown in Table 1-2 and Fig. 5:
Table 1-2 Ct Data-Statistics table
(2) EPF Data-Statistics the results are shown in Table 1-3 and Fig. 6:
Tri- kinds of genotype end point fluorescence value (EPF) statistical forms of table 1-3
The statistics influenced whether lysate on three kinds of genotype detection accuracys rate is added to be shown in Table 1-4.
Table 1-4 adds the statistical form influenced whether lysate on three kinds of genotype detection accuracys rate
Compare plus cell pyrolysis liquid can be seen that with the Ct value that cell pyrolysis liquid is not added, the reagent that cell pyrolysis liquid is not added is positive
Channel C t value is extremely significant to be greater than the positive channel C t value (P≤0.01) that cell pyrolysis liquid is added；Compared by the two fluorescent value, it can
Find out be added cell pyrolysis liquid after fluorescent value it is extremely significant be higher than cell pyrolysis liquid fluorescent value (P≤0.01) is not added.Illustrate to be added thin
After cellular lysate liquid, cell pyrolysis liquid has cracked cell and it is made to release a large amount of DNA, so that Ct value significantly reduces, fluorescent value
It increases, Detection accuracy also greatly improves.
2 LNA of embodiment modifies probe and improves parting accuracy
LNA is a kind of oligonucleotide derivative, with DNA/RNA have similar structure, therefore can to DNA and RNA into
Row strong identification and combination.After LNA is for the modification of oligonucleotides, the thermal stability of primer or probe can be increased, improved
3~8 DEG C of its annealing temperature.The probe of this kit developing is modified using LNA, the wild-type probe through software prediction, after modification
4 DEG C or so are improved with Tm value of the saltant type probe in conjunction with template.In order to sufficiently show LNA modification probe and without LNA
The difference of probe is modified, following comparative's experiment is carried out, PCR system is shown in Table 2-1, detects wild homozygote, heterozygote respectively and dashes forward
Become homozygote, each genotype does three repetitions, and response procedures are shown in Table 1.
The primer and probe sequence are as follows:
Upstream primer: 5 '-GTGGGTTACACCTTGGCCC-3 '
Downstream primer: 5 '-CAGAAATGGTTTGCTGGCTCC-3 '
Wild type LNA modifies probe: 5 '-FAM-ACTCGTCCCC+CCCA-MGB-3’
Saltant type LNA modifies probe: 5 '-Texas Red-AGG+AAACTCATCCCC-MGB-3’
Wild type modifies probe: 5 '-FAM-ACTCGTCCCCCCCA-MGB-3 ' without LNA
Saltant type modifies probe: 5 '-Texas Red-AGGAAACTCATCCCC-MGB-3 ' without LNA
Wherein ,+indicate LNA modified base.
Table 2-1 PCR reaction system
| Formula 1 | Formula 2 | Reactive component is whole |
| 5×Promega Colorless Reaction Buffer | 5×Promega Colorless Reaction Buffer | 1.1× |
| dNTP(10mM) | dNTP(10mM) | 0.2mM |
| MgCl2(25mM) | MgCl2(25mM) | 2.5mM |
| Cell pyrolysis liquid (200 ×) | Cell pyrolysis liquid (200 ×) | 1× |
| HLA-B*5801 upstream primer (100 μM) | HLA-B*5801 upstream primer (100 μM) | 0.5μM |
| HLA-B*5801 downstream primer (100 μM) | HLA-B*5801 downstream primer (100 μM) | 0.5μM |
| HLA-B*5801 wild type LNA modifies probe | HLA-B*5801 wild type modifies probe without LNA | 0.5μM |
| HLA-B*5801 saltant type LNA modifies probe | HLA-B*5801 saltant type modifies probe without LNA | 0.5μM |
| Archaeal dna polymerase (5U/ μ L) | Archaeal dna polymerase (5U/ μ L) | 1.25U |
| DNA(10ng/μL) | DNA(10ng/μL) | 1μL |
| Ultrapure water is added to total volume | 23.5μL | 23.5μL |
Final concentration of the 0.005% of lauryl sodium sulfate and Triton X-100 in above-mentioned PCR reaction system
W/v and 0.01%w/v.
Experimental result:
(1) Ct Data-Statistics the results are shown in Table 2-2:
Tri- kinds of genotype Ct Data-Statistics of table 2-2
It can be seen that without the LNA wild homozygote for modifying probe groups and heterozygote from table 2-2 due to fluorescence increment mistake
It is low, so that software is determined as that parting fails the case where can not reading Ct value, and through LNA modification probe groups to three kinds of genotype
Ct value meet the requirements, Ct value can be read, software determines that result is correct.Therefore it can prove to modify when probe through LNA
Afterwards, the combination for being conducive to probe and target sequence improves the Stability and veracity of result.
The optimization experiment of 3 primed probe optimal proportion of embodiment
After special primer and probe screening confirmation, concentration of the primer and probe in PCR reaction system need to be carried out excellent
Change (using Stomatocyte as template).The corresponding PCR reaction system of primed probe concentration is as shown in table 3-1.
Table 3-1 primed probe concentration experiment PCR reacts total system formula table
Final concentration of the 0.005% of lauryl sodium sulfate and Triton X-100 in above-mentioned PCR reaction system
W/v and 0.01%w/v.
Experimental result:
(1) primer concentration grads experiment (concentration one, concentration two, concentration three)
A.Ct Data-Statistics the results are shown in Table 3-2 and Fig. 7:
The Ct Data-Statistics of tri- kinds of primer concentrations of table 3-2
B.EPF Data-Statistics the results are shown in Table 3-3 and Fig. 8:
Tri- kinds of genotype end point fluorescence value (EPF) statistical forms of table 3-3
C. ratio (G/Rratio) statistical result of the green tunnel end points fluorescent value of heterozygous and red tunnel end points fluorescent value is shown in
Table 3-4:
Table 3-4 heterozygous G/Rratio
| Final concentration | G/Rratio (heterozygous) |
| Concentration one | 0.84 |
| Concentration two | 0.94 |
| Concentration three | 0.87 |
(2) concentration and probe concentration gradient experiment
In view of heterozygous G/Rratio as far as possible close to 1 (heterozygous G/Rratio closer to 1, heterozygosis parting mistake
Chance it is lower), therefore concentration and probe concentration is adjusted.
A.Ct Data-Statistics the results are shown in Table 3-5 and Fig. 9:
Table 3-5 Ct Data-Statistics table
B. end point fluorescence value (EPF) statistical result is shown in Table 3-6 and Figure 10:
Tri- kinds of genotype end point fluorescence value (EPF) statistical forms of table 3-6
C. ratio (G/Rratio) statistical result of the green tunnel end points fluorescent value of heterozygous and red tunnel end points fluorescent value is shown in
Table 3-7:
Table 3-7 heterozygous G/Rratio
By three concentration gradients of primer prepare reagent C T value it was found that, concentration one and two Ct value difference of concentration are different not
Significantly (P > 0.05), three Ct value of concentration are noticeably greater than the Ct value (p≤0.05) of concentration one and concentration two, illustrate compared to concentration
For three, concentration two and one primer amplification of concentration are more efficient.
It can be seen that the end point fluorescence value of concentration two is significantly higher than by the reagent end point fluorescence value that three concentration gradients configure
The end point fluorescence value (p≤0.05) of concentration one and three.Illustrate under same probe concentration conditions, what concentration two expanded may participate in
Effective product amount highest of PCR reaction.Correctly matched amount is more for probe, and reagent is also more stable.
It can be seen that by green red tunnel end points fluorescent value ratio (G/R ratio), the green red tunnel end points fluorescent value of concentration two
Ratio (G/Rratio) is closer to 1, as a result more acurrate reliable when illustrating to detect heterozygote genotype.
The reagent end point fluorescence value prepared by two concentration gradients of probe and green red channel fluorescence ratio (G/Rratio)
It was found that the end point fluorescence value of concentration four is significantly higher than the end point fluorescence value (p≤0.05) of concentration five, the green red channel of concentration four
For fluorescence ratio (G/Rratio) closer to 1, testing result is accurate.
The test of 4 accuracy of embodiment
This kit uses mucous membrane of mouth cast-off cells as amplified sample, due to being detected personnel's living habit and individual
The diversity of gene order may cause reagent and be interfered in parting, in order to verify the accuracy of this kit parting, this
Experiment is tested using the mucous membrane of mouth cast-off cells of three genotype difference personnel, and (wherein the genotype of tester passes through
Cross PCR sequencing PCR confirmation), operating process, total sample number are 300 to operating method referring to Fig.1, and agent prescription is as shown in table 4-1.
Table 4-1 PCR reacts total system formula table
Final concentration of the 0.005% of lauryl sodium sulfate and Triton X-100 in above-mentioned PCR reaction system
W/v and 0.01%w/v.
Experimental result is shown in Table 4-2:
The accuracy of tri- kinds of genotype of table 4-2 counts
It can be seen that in 300 test samples from table 4-2, the Detection accuracy of this kit can achieve 99%.
Tentatively show in the case where being tested according to Fig. 1 operating process, which has certain accuracy, can achieve 95%
More than.
The test of 5 detection sensitivity of embodiment
Total amount is added in sample DNA (heterozygous) by the sensitivity for verifying HLA-B*5801 genotype quick detection kit
Respectively with: five concentration gradients of 1ng, 0.5ng, 0.25ng, 0.125ng and 0.1ng are detected according to the method described above, above every
Secondary detection is at least repeated more than twice, as a result as shown in Table 5-1:
Table 5-1 detects the testing result of different sample concentrations with HLA-B*5801 genotype quick detection kit
| DNA additional amount | 1ng | 0.5ng | 0.25ng | 0.125ng | 0.1ng | It is total |
| Testing number | 100 | 100 | 100 | 100 | 100 | 400 |
| Positive exact figures | 100 | 100 | 100 | 100 | 99 | 399 |
| Accuracy rate | 100% | 100% | 100% | 100% | 99% | 100% |
The above results show that sample DNA concentration is used respectively with tetra- concentration gradients of 1ng, 0.5ng, 0.25ng and 0.125ng
HLA-B*5801 genotype detection kit is detected, and accuracy rate reaches 100%, when DNA concentration is 0.1ng, just
True rate is 99%.Therefore it may determine that HLA-B*5801 genotype quick detection kit of the invention only needs 35 copy numbers
DNA profiling amount ensures that correct parting.
The detection of 6 anti-interference ability of embodiment
Since this kit is detected in such a way that mucous membrane of mouth cast-off cells directly expand, after the feed of oral cavity
Residue whether can interfere reagent testing result, urgent need is studied.This experiment is before sampling operation to being sampled personnel's (its
Genotype is confirmed through PCR sequencing PCR) it is required, sampling is as standard after 30min fasting before sampling, to eat sweet food, drink alkalinity
Tea eats acidic food, spicy food and drinks after Chinese medicine sampling immediately as processing group, with same a collection of reagent to all samples into
Row detects respectively, wild homozygote 120 in every group of sample, and heterozygote 120, no mutant homozygote 60, agent prescription such as table
Shown in 4-1, testing result is as shown in Table 6-1:
Table 6-1 reagent anti-interference ability accuracy test result
Result above can be seen that be compared with the detection accuracy of fasting sampling, is eaten sweet food, is drunk alkaline tea, eats acid food
Object, spicy food and the accuracy rate for drinking the later accuracy of Chinese medicine and having a reduction, and being detected after fasting can achieve 99% with
On.Compared with fasting group, other every group compared with it, accuracy difference be all larger than 9%, detect accuracy after taking acidic food
Difference up to 22% illustrates there is certain inhibiting effect to PCR reaction after eating the above food.Therefore it can be concluded that eating up these
It is larger to the interference of detection after food, sampling of gargling should be carried out after 30min after eating up these food.Since this experiment samples
It is limited, sample detection should be still carried out after fasting 30min when carrying out clinical detection.
Influence test of 7 environment of embodiment to detection kit
Since kit of the present invention is intended to apply to clinical detection, quickly examined to verify HLA-B*5801 genotype
Whether the testing result of test agent box is influenced by environmental factor, and in routine office work area, (gross area is 200 square metres, altogether respectively
50 people are accommodated, do not limit their activity (arbitrarily can walk about or speak), environment temperature is 27 DEG C, humidity 77%) and it is empty
The toilet that gas cleaniliness classs is 1,000,000 grades carries out grab sample to multiple subjects (its genotype is confirmed through PCR sequencing PCR),
Each subject carries out repeating to test twice respectively in two regions, and agent prescription is referring to table 4-1, testing result statistics such as table 7-
Shown in 1.
The genotype call results accuracy of two sampling areas of table 7-1 counts
Result above can be seen that Office Area and clean area sampling detection accuracy only differ 0.6%, show environment because
Element does not have larger impact to the result of detection.This time application portability for kit in hospital of test provides data, be with
Strong data supporting is provided in the popularization of hospital and use afterwards.
8 kit of the embodiment Detection of Stability that (room temperature, 2-8 DEG C, -20 DEG C) is placed under condition of different temperatures
This kit is based on POCT mode development, and the detection of hospital bed side, low-temperature storage and low-temperature operation are difficult to reality
It is existing, so after needing detection reagent to place certain time length at normal temperature, if adverse effect can be generated to testing result.It prepares large quantities of
Reagent is randomly divided into 3 temperature condition groups totally 24 processing groups, and grouping situation is shown in Table 8-1, wherein control group are as follows: vertical with postponing
That is upper machine testing (the sampling loading coded program of 108 samples is completed in 2-8 DEG C of preparation in 30min), each processing group totally 108
Branch reagent, every kind genotype detection 36.After reagent processing to be done, is operated according to SOP, acquire the person of being sampled (its HLA-B*
5801 genotype are confirmed through PCR sequencing PCR) buccal sample, wild homozygote, no mutant homozygote, heterozygote respectively take 36.Uniformly press
Fluorescence PCR is carried out according to table one.
Table 8-1 reagent, which places condition and places duration, is grouped situation table
Experimental result:
Ct value and end point fluorescence value (EPF) mean value statistical result are shown in Figure 11 (A-C) and Figure 12 (A-C) respectively.
Three kinds of genotyping accuracy statistical results are shown in Table 8-2.
Tri- kinds of genotyping accuracy statistical forms of table 8-2
By the Ct value of different disposal group it can be seen from Figure 11 and Figure 12, EPF value and control group respectively compared with, it is each to place
The time of condition, processing is longer, and it is more the case where significant difference occur.When proving room temperature, 2-8 DEG C of placement, -20 DEG C of placements
Between Ct value and EPF value can be had an impact too long.But it can be seen that each 108 number of cases evidence of processing group, A/B/C tri- from table Figure 11-B
1~7 component type accuracy of a temperature condition is 100%, when to the 8th group of tri- temperature conditions of A/B/C, parting mistake occurs
The case where.Illustrate to place reagent at least 7 days under normal temperature condition, will not influence the genotyping result of reagent；Examination is placed under the conditions of 2-8 DEG C
Agent at least 15 days, it will not influence the genotyping result of reagent；It is placed reagent at least 12 months under the conditions of -20 DEG C, will not influence reagent
Genotyping result.In conclusion the HLA-B*5801 reagent of provable kit has good stability, examined in hospital
It surveys in use, the non-cryogenic environment of of short duration (in room temperature 5 days) is placed, will not influence parting accuracy, can satisfy POCT completely
Mode.
The screening of embodiment 9 fluorescence quantification PCR primer and probe
1, primer screening
Nucleic acid sequence where the site rs9263726SNP announced according to GenBank designs following 8 pairs of primers:
Pair 1 F:412 GTGGGTTACACCTTGGCCC
R:541 CTCCATGTGGCAAAGTCGGT
Pair 2 F:412 GTGGGTTACACCTTGGCCC
R:544 TGGCTCCATGTGGCAAAGTC
Pair 3 F:456 AAGGACCCCAGCTCCTTAAC
R:580 AGAAGGTGCATTTGGCTCTCA
Pair 4 F:439 ACAGACCCCAGCTTTACAAGG
R:541CTCCATGTGGCAAAGTCGGT
Pair 5 F:439 ACAGACCCCAGCTTTACAAGG
R:544 TGGCTCCATGTGGCAAAGTC
Pair 6 F:439 ACAGACCCCAGCTTTACAAGG
R:558 CAGAAATGGTTTGCTGGCTCC
Pair 7 F:439 ACAGACCCCAGCTTTACAAGG
R:575GTGCATTTGGCTCTCACCAGA
Pair 8 F:412 GTGGGTTACACCTTGGCCC
R:558 CAGAAATGGTTTGCTGGCTCC
PCR reaction system:
Table 9-1 PCR reacts total system formula table
Final concentration of the 0.005% of lauryl sodium sulfate and Triton X-100 in above-mentioned PCR reaction system
W/v and 0.01%w/v.
PCR response procedures:
Table 9-2 response procedures table
Common PCR reaction is carried out according to the above reaction system and response procedures.PCR product carries out agarose gel electrophoresis,
Optimal primer is screened according to the brightness of 8 pairs of corresponding amplified product bands of primer, as a result as shown in figure 13.It can see
Out, 8 expanding effect of primer Pair is best.Therefore, the primer by Pair 8 as qPCR.
2, probe screens
With the Pair 8 of above-mentioned screening for qPCR primer, following 3 pairs of probes are separately designed:
P1WP1M: wild-type probe: 5 '-FAM-AGG+AAACTCGTCCCC-MGB-3 ' and saltant type probe: 5 '-Texas
Red-AAACTCATCCCCCCCA-MGB-3’
P2WP2M: wild-type probe: 5 '-FAM-ACTCGTCCCC+CCCA-MGB-3 ' and saltant type probe: 5 '-Texas
Red-AGG+AAACTCATCCCC-MGB-3’(SEQ ID NO:3-4)
P3WP3M: wild-type probe: 5 '-FAM-AG+G+AAACTCGTCCC-MGB-3 ' and saltant type probe: 5 '-Texas
Red-ACTCATCC+CCCCCA-MGB-3’
QPCR reaction system:
Table 9-3 preparation of reagents system
QPCR response procedures:
Table 9-4 response procedures table
QPCR reaction is carried out according to the above reaction system and response procedures.The corresponding testing result of 3 pairs of probes is respectively as schemed
Shown in 14-16.It can be seen from the figure that three groups of probes correct parting of energy, but P2WP2M curve smoothing, increment highest, and it is miscellaneous
The red green tunnel end points fluorescent value of mould assembly is close.In addition, reaction Tm value, intensified response can either be improved by carrying out LNA modification to probe
Specificity, and the formation of hairpin structure can be effectively prevented.Finally by primer Pair 8 and probe P2WP2M combination as detection
The qPCR primer and probe in the site rs9263726.
3, DNA profiling information based on the design of primer Pair 8 is as follows:
GTGGGTTACACCTTGGCCCCCAGGCACACAGACCCCAGCTTTACAAGGACCCCAGCTCCTTAACACAGATCCCAGCT
CCGAGGAAACTCTCCCCCCCACGTTAATCCTGACCGACTTTGCCACATGGAGCCAGCAAACCATTTCTG
Wherein, gray area is respectively upstream primer and downstream primer position, and the capitalization of G/A overstriking is to be measured
SNP site.The interference of side SNP will not be generated when not containing other SNP sites in the amplification region, therefore detecting.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be modified or is improved, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>Chongqing Jing Yin biotechnology Co., Ltd
<120>the HLA-B*5801 genotype quick detection kit based on POCT mode
<130> KHP181110938.2
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtgggttaca ccttggccc 19
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cagaaatggt ttgctggctc c 21
<210> 3
<211> 14
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
actcgtcccc ccca 14
<210> 4
<211> 15
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aggaaactca tcccc 15
Claims (10)
1. fluorescence quantification PCR primer and probe for detecting HLA-B*5801 genotype, which is characterized in that draw including upstream
Object, downstream primer, wild-type probe and saltant type probe, their nucleotide sequence difference are as follows:
Upstream primer: 5 '-GTGGGTTACACCTTGGCCC-3 '
Downstream primer: 5 '-CAGAAATGGTTTGCTGGCTCC-3 '
Wild-type probe: 5 '-F1-ACTCGTCCCCCCCA-Q-3 '
Saltant type probe: 5 '-F2-AGGAAACTCATCCCC-Q-3 '
Wherein, F1 and F2 is different fluorescent reporter group, and Q is fluorescent quenching group.
2. primer and probe according to claim 1, which is characterized in that the probe is as follows:
Wild-type probe: 5 '-F1-ACTCGTCCCC+CCCA-Q-3’
Saltant type probe: 5 '-F2-AGG+AAACTCATCCCC-Q-3’
Wherein ,+indicate LNA modified base.
3. containing the detection reagent or kit of primer and probe as claimed in claim 1 or 2.
4. being used for the reaction system of fluorescence quantitative PCR detection HLA-B*5801 genotype, which is characterized in that the reaction system packet
Include primer and probe as claimed in claim 1 or 2, archaeal dna polymerase, dNTPs, Mg2+, reaction buffer and cell pyrolysis liquid；
Wherein, the cell pyrolysis liquid is made of lauryl sodium sulfate and Triton X-100.
5. reaction system according to claim 4, which is characterized in that each component is final concentration of in the reaction system:
0.5-1.5 × PCR reaction buffer, archaeal dna polymerase 0.04-0.1U/ μ L, dNTPs 0.1-0.5mM, upstream primer 0.2-0.7 μ
M, 0.2-0.7 μM of downstream primer, 0.2-0.7 μM of wild-type probe, 0.2-0.7 μM of saltant type probe, Mg2+1-2.5mM and cell
Lysate；
Wherein, in the reaction system lauryl sodium sulfate and Triton X-100 final concentration of 0.0005-
0.015%w/v and 0.001-0.03%w/v.
6. reaction system according to claim 5, which is characterized in that the total volume of the reaction system is 23.5 μ L, respectively
The final concentration or dosage of component are as follows: 1.1 × PCR reaction buffer, Taq archaeal dna polymerase 1.25U, dNTPs 0.2mM, upstream are drawn
0.3 μM of object, 0.3 μM of downstream primer, 0.5 μM of wild-type probe, 0.4 μM of saltant type probe, Mg2+2.5mM and cell pyrolysis liquid；
In the reaction system the final concentration of 0.005%w/v of lauryl sodium sulfate and Triton X-100 and
0.01%w/v or 0.009%w/v and 0.01%w/v or 0.005%w/v and 0.02%w/v or 0.005%w/v and
0.001%w/v or 0.015%w/v and 0.003%w/v；It is preferred that 0.005%w/v and 0.01%w/v.
7. the HLA-B*5801 genotype quick detection kit based on POCT mode, which is characterized in that the kit is at least
Contain primer and probe as claimed in claim 1 or 2 and cell pyrolysis liquid；
Wherein, the cell pyrolysis liquid is made of lauryl sodium sulfate and Triton X-100, and in the PCR of preparation
In reaction system the final concentration of 0.0005-0.015%w/v of lauryl sodium sulfate and Triton X-100 and
0.001-0.03%w/v.
8. kit according to claim 7, which is characterized in that the kit further includes archaeal dna polymerase, dNTPs, Mg2 +, reaction buffer, standard positive template, sampling rod, at least one of sample collection tube.
9. kit according to claim 8, which is characterized in that the archaeal dna polymerase is thermal starting Taq DNA polymerization
Enzyme.
10. according to the described in any item kits of claim 7-9, which is characterized in that fluorescence matched with the kit is fixed
Measure PCR response procedures are as follows: 95 DEG C of 5min；95 DEG C of 8s, 58 DEG C of 35s, 50 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810152060.3A CN109251973A (en) | 2018-02-14 | 2018-02-14 | HLA-B*5801 genotype quick detection kit based on POCT mode |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810152060.3A CN109251973A (en) | 2018-02-14 | 2018-02-14 | HLA-B*5801 genotype quick detection kit based on POCT mode |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109251973A true CN109251973A (en) | 2019-01-22 |
Family
ID=65051338
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810152060.3A Pending CN109251973A (en) | 2018-02-14 | 2018-02-14 | HLA-B*5801 genotype quick detection kit based on POCT mode |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109251973A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113549708A (en) * | 2020-04-24 | 2021-10-26 | 首都医科大学附属北京天坛医院 | POCT mode-based novel coronavirus COVID-19 rapid detection kit |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103805701A (en) * | 2014-01-27 | 2014-05-21 | 希斯奇生物医药（上海）有限公司 | Detection method and kit of HLA (Human Leukocyte Antigen)-B*58:01 allele |
| CN107245527A (en) * | 2017-07-25 | 2017-10-13 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of MTRR gene pleiomorphism quick detections |
| CN109251975A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | The genotype quick detection kit of CYP2C19*2 or * 3 based on POCT mode |
| CN109251971A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | ADRB1 genotype quick detection kit based on POCT mode |
| CN109251972A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | CYP3A5*3 genotype quick detection kit based on POCT mode |
-
2018
- 2018-02-14 CN CN201810152060.3A patent/CN109251973A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103805701A (en) * | 2014-01-27 | 2014-05-21 | 希斯奇生物医药（上海）有限公司 | Detection method and kit of HLA (Human Leukocyte Antigen)-B*58:01 allele |
| CN107245527A (en) * | 2017-07-25 | 2017-10-13 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of MTRR gene pleiomorphism quick detections |
| CN109251975A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | The genotype quick detection kit of CYP2C19*2 or * 3 based on POCT mode |
| CN109251971A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | ADRB1 genotype quick detection kit based on POCT mode |
| CN109251972A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | CYP3A5*3 genotype quick detection kit based on POCT mode |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113549708A (en) * | 2020-04-24 | 2021-10-26 | 首都医科大学附属北京天坛医院 | POCT mode-based novel coronavirus COVID-19 rapid detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102534031B (en) | High-specificity kit for detecting deafness predisposing genes and uses | |
| CN101684497B (en) | Deafness susceptibility gene screen test kit | |
| JP6320041B2 (en) | Methods, kits and compositions for detection of MRSA | |
| CN104404164A (en) | Hereditary deafness gene mutation detection kit | |
| CN110452984A (en) | A kind of methylated genes combination for cervical carcinoma DNA methylation assay, primer and probe combination, kit and its application method | |
| CN102925562A (en) | Kit and method for detecting aminoglycoside drug-induced deafness-sensitive gene | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| CN109251975A (en) | The genotype quick detection kit of CYP2C19*2 or * 3 based on POCT mode | |
| CN115948532A (en) | SMA detection kit based on digital PCR technology | |
| CN109251972A (en) | CYP3A5*3 genotype quick detection kit based on POCT mode | |
| CN113337608A (en) | Combined marker for early diagnosis of liver cancer and application thereof | |
| CN109251973A (en) | HLA-B*5801 genotype quick detection kit based on POCT mode | |
| CN107904290A (en) | PDGFRA detection in gene mutation system and its kit | |
| Pichon et al. | Analysis and annotation of DNA methylation in two nonhuman primate species using the Infinium Human Methylation 450K and EPIC BeadChips | |
| CN102534030B (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN110878351A (en) | Method for detecting MTHFR gene polymorphism by fluorescent quantitative PCR | |
| CN109251974A (en) | APOE2 and APOE4 genotype quick detection kit based on POCT mode | |
| CN116064842A (en) | Composite amplification box for degradation material deducing biological geographical ancestor DIPs and sex identification | |
| CN109251981A (en) | ALDH2 genotype quick detection kit based on POCT mode | |
| CN110951857B (en) | Method and kit for noninvasively detecting fetal trisomy 21, 18 and 13 syndrome based on digital PCR (polymerase chain reaction) | |
| CN109251971A (en) | ADRB1 genotype quick detection kit based on POCT mode | |
| CN104450911B (en) | Kit for detecting related gene FMR1 of fragile X chromosome syndrome (FRAX) and application of kit | |
| CN107177688A (en) | The kit of the deaf susceptibility gene mutation of detection and its application | |
| CN109251977A (en) | SLCO1B1 genotype quick detection kit based on POCT mode | |
| CN113215241A (en) | Detection primer group for risk early warning of cardiovascular and cerebrovascular diseases and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190122 |
|
| RJ01 | Rejection of invention patent application after publication |