CN109081709B - Urban domestic garbage treatment method - Google Patents
Urban domestic garbage treatment method Download PDFInfo
- Publication number
- CN109081709B CN109081709B CN201810740920.5A CN201810740920A CN109081709B CN 109081709 B CN109081709 B CN 109081709B CN 201810740920 A CN201810740920 A CN 201810740920A CN 109081709 B CN109081709 B CN 109081709B
- Authority
- CN
- China
- Prior art keywords
- treatment
- composting
- waste
- lactobacillus
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F9/00—Fertilisers from household or town refuse
- C05F9/04—Biological compost
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F17/00—Preparation of fertilisers characterised by biological or biochemical treatment steps, e.g. composting or fermentation
- C05F17/20—Preparation of fertilisers characterised by biological or biochemical treatment steps, e.g. composting or fermentation using specific microorganisms or substances, e.g. enzymes, for activating or stimulating the treatment
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/20—Fertilizers of biological origin, e.g. guano or fertilizers made from animal corpses
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Abstract
The invention relates to a treatment method for treating municipal domestic waste, which comprises the steps of removing solid waste, sorting to obtain an organic matter mixture, and further comprises the steps of chemically treating organic matters, composting, adding beneficial bacteria, and then preparing farmyard manure. The method adopts a method combining chemical treatment and bacterial liquid fermentation to treat the municipal domestic waste, has simple and convenient fermentation and low cost, belongs to nontoxic strains, does not need to add extra substances in the fermentation process, realizes the maximized utilization of the waste, saves energy and materials, has obvious aerobic treatment effect on the kitchen waste, reduces the treatment cost, and has great practical and popularization values.
Description
Technical Field
The invention relates to the field of household garbage treatment, in particular to a municipal household garbage treatment method.
Background
With the continuous development of national economy, the living standard of people is continuously improved, the consumption habits of people are changed, and the quantity of urban and rural domestic garbage is continuously increased. These increasing urban and rural domestic garbage have seriously plagued the further development of cities and also seriously affect the lives of people.
How to treat the municipal solid waste becomes a great problem in the urbanization development process of China and even the whole world. At present, the treatment mode aiming at the household garbage mainly comprises the following modes:
the refuse landfill method comprises the following steps: landfill is an extremely passive and universal garbage disposal method. Although the treatment method has the advantages of low investment, simple process and large treatment capacity, and better realizes the harmlessness of the earth surface. However, the landfill garbage is not subjected to harmless treatment, and a large amount of bacterial viruses remain; therefore, the method has potential great hidden danger and brings endless future troubles to descendants. The method not only does not realize the reclamation of the garbage, but also occupies a large amount of land. At present, the sanitary landfill method introduced in some areas only partially solves the problems of preventing and treating the pollution of underground water and recovering the generated methane, and has a great distance for thoroughly solving the defects of the project. Landfill is banned by many developed countries.
Secondly, a garbage incineration and incineration power generation method comprises the following steps: its advantages are high effect and high effect on reclaiming garbage. However, the generation and treatment of the harmful gas "dioxin" bring about a great disadvantage to the method. The air can be polluted by pure burning; if hazardous gases are treated, the capital and operating costs can be quite expensive. In addition, the municipal solid waste in China has complex components and low heat value at present, and a large amount of auxiliary fuel needs to be added, so that factories built in many regions cannot be started up, and the operation cannot be stopped. And the method is also limited by the processing capacity, so that the common middle and small cities in China have no way to build the technical project. The method is not suitable for the situation of China.
Thirdly, composting: the method has the advantages of low investment and easy operation. At present, the stabilization treatment of organic solid wastes such as domestic garbage and the like at home and abroad adopts a long-term compost fermentation method for 20 to 30 days; the result reaches the stabilization in the traditional sense, does not produce heat by secondary fermentation, and kills a large amount of ova and disease bacteria; but negative effects are also evident; because of long-term compost fermentation, a large amount of greenhouse gases and volatile toxic and harmful gases are generated; especially, malodorous gas has serious environmental pollution, is parasitic to mosquitoes and flies, and is easy to generate epidemic diseases. Because more than 70% of nutrient substances are exhausted in long-term compost fermentation, a large amount of inhibitory substances are accumulated; namely microbial toxin; harmful heavy metals cannot be decomposed and volatilized by microorganisms.
In the prior art, aiming at the treatment of urban domestic garbage by adopting a plurality of composite microbial agents, the effect is good, CN1724480B discloses a process for treating urban domestic garbage by using a high-efficiency microbial composite microbial agent, which treats the domestic garbage by inoculating the microbial composite microbial agent under an aerobic dynamic fermentation condition, and not only sorts, crushes and inoculates the domestic garbage sequentially, but also ferments the domestic garbage under the dynamic aerobic condition; the high-efficiency microbial compound preparation is prepared by mixing 40-60% of normal-temperature microbial compound agent M and 40-60% of cellulose degrading bacteria. The application patent of patent application No. 00119262.0, the added bacterial in the garbage is purchased from Chinese academy of sciences, the enzyme activity is very high under the condition of pure culture (see page 2 of the specification of application No. 00119262.0), but after the bacterial is added into the garbage, the effect of the inoculated bacterial is difficult to be ensured due to the complex microbial system existing in the garbage, so the bacterial still needs 2-3 days to reach 70 ℃ under the condition of adding energy.
The technology disclosed in patent application No. 03118137.6 adopts a secondary microorganism inoculation method, but the operation process is static composting, which is not favorable for ventilation and oxygenation in the garbage, affects the efficiency of garbage fermentation, has long fermentation period, requires 25 days in the composting process (see page 4 of the specification of application No. 03118137.6), occupies large area, is easy to generate secondary pollution, is not favorable for building plants in the suburbs, and increases the transportation cost of domestic garbage treatment.
Aiming at the defects of urban domestic garbage treatment in the prior art, the invention provides a garbage treatment method which can be used for rapidly, efficiently and at low cost, so that energy and resources are saved for the country and the society, and the convenience of people's life is improved.
Disclosure of Invention
The invention provides a method for treating municipal domestic waste, which comprises the steps of removing solid waste, sorting to obtain an organic matter mixture, and further comprises the steps of chemically treating organic matters, composting, adding beneficial bacteria, and then preparing farmyard manure.
The solid waste removing method comprises the steps of breaking bags, sorting, removing impurities, recycling resources, removing some solid and parts which cannot be decomposed, sorting bamboo and wood, waste batteries, plastics, glass, lighters, metals, fabrics and the like, and recycling inorganic materials such as bricks, tiles and stones and the like for manufacturing novel building materials.
The invention also provides a step of organic matter chemical treatment, which comprises the steps of crushing the purified organic matter, then putting the crushed organic matter into a catalytic tank for catalytic reaction, wherein the catalyst comprises concentrated sulfuric acid (98%) and phosphate rock powder (containing more than P20530%), the adding amount of the catalyst is 1 ton of pure organic matter, 10kg of concentrated sulfuric acid and 20kg of phosphate rock powder are added, a boiler high-temperature high-pressure steam electric regulating valve is opened, superheated steam is introduced, the temperature is 250 ℃, the pressure is 1.4MPa, and the reaction time is 2 hours.
The invention also provides a composting method, which comprises the step of carrying out composting reaction on the organic matters obtained by the previous step, in particular to the organic matters obtained after chemical treatment, wherein the ratio of the organic matters to the organic matters is 100: 1-10 of composting accelerant, wherein the composting accelerant is formed by mixing fly ash, wheat straw, human and animal excreta and magnesium chloride; the weight ratio of the fly ash, the wheat straw, the human and animal excreta and the magnesium chloride is 100-200:20-40:10-20: 1-2. The specific composting step is that organic matters added with the composting accelerant are added into a composting reaction barrel, composting is carried out at the temperature of 20-35 ℃, the composting is turned over for 1 time every day, the composting reaction lasts for 10-15 days, the stable state is reached, and solid compost materials are taken for subsequent fermentation.
The invention also provides a kitchen waste reduction type microbial compound inoculant which comprises the following components in percentage by weight: 60% of lactic acid bacteria, 20% of saccharomycetes and 20% of bacillus subtilis; the colony content of the microbial inoculum is 1-5 × 109 cfu/g.
Wherein the lactobacillus is kitchen waste reduction type lactobacillus HBS-RS (pediococcus acidilactici), and the preservation number is CGMCC No. 5959; the yeast is China general microbiological culture Collection center (CGMCC), Saccharomyces cerevisiae (CGMCC 2.168); the Bacillus subtilis adopts Bacillus subtilis (number 10066) preserved by China center for culture Collection of Industrial microorganisms (CICC).
The invention also provides a transgenic lactic acid bacterium, wherein the introduced gene is a synergistic degradation gene, and the sequence of the gene is shown as SEQ ID NO: 1 is shown. After the gene is introduced into the lactobacillus, the degradation effect of the lactobacillus can be obviously improved.
The microbial inoculum consists of lactobacillus introduced with degradation genes, saccharomycetes and bacillus subtilis.
The preparation method of the compound microbial inoculum comprises the following steps of independently culturing the three microbial inocula according to the ratio of 2: 1: 1 volume ratio, and preparing into liquid microbial inoculum or dry microbial inoculum.
The culture method of the single bacterial liquid can be obtained by amplification culture according to the conventional culture method in the field, and a special culture step is not needed.
The invention also provides a method for preparing farmyard manure after adding beneficial bacteria to treat compost, which is characterized in that mixed strains are diluted by water according to the volume ratio of 1:50, the diluted mixed strains are added according to 0.5 percent (V/W) of the weight of garbage, ventilation and oxygen supply are carried out for 5 days, the temperature is controlled to be not more than 40 ℃, percolating water generated by biological treatment enters a sewage treatment system through a bottom pipeline of a fermentation tank, and generated waste gas enters a waste gas treatment system through a pipeline on the upper part of the fermentation tank; and taking the fermented product as an organic fertilizer for subsequent utilization.
The invention has the beneficial effects that:
the method adopts a method combining chemical treatment and bacterial liquid fermentation to treat the municipal domestic waste, has simple and convenient fermentation and low cost, belongs to nontoxic strains, does not need to add extra substances in the fermentation process, realizes the maximized utilization of the waste, saves energy and materials, has obvious aerobic treatment effect on the kitchen waste, reduces the treatment cost, and has great practical and popularization values.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. It is intended that all modifications or alterations to the methods, procedures or conditions of the present invention be made without departing from the spirit and substance of the invention.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1 Pre-treatment of municipal solid waste and chemical and composting
Removing solid wastes from municipal solid wastes, comprising bag breaking, sorting, impurity removing, resource recycling, removing some solid and undecomposed parts, sorting bamboo and wood, waste batteries, plastics, glass, lighters, metals, fabrics and the like for recycling, and using inorganic materials such as bricks, tiles and stones and the like for manufacturing novel building materials. Crushing the organic matter mixed with organic matter obtained by sorting, and then putting the crushed organic matter into a catalytic tank for catalytic reaction, wherein the catalyst is concentrated sulfuric acid (98%) and phosphate rock powder (containing P)205More than 30 percent), adding 10kg of concentrated sulfuric acid and 20kg of ground phosphate rock into 1 ton of pure organic matter, opening a boiler high-temperature high-pressure steam electric regulating valve, passing through superheated steam, controlling the temperature to be 250 ℃, controlling the pressure to be 1.4MPa, and controlling the reaction time to be 2 hours. After chemical treatment is obtainedOf (4) is an organic substance. And (3) chemically treating the organic matters, wherein the ratio of the organic matters to the organic matters is 100: 1-10 of composting accelerant, wherein the composting accelerant is formed by mixing fly ash, wheat straw, human and animal excreta and magnesium chloride; the weight ratio of the fly ash to the wheat straw to the human and animal excreta to the magnesium chloride is 200:30:10: 1. The specific composting step is to add organic matters added with the composting accelerant into a composting reaction barrel, perform composting at the temperature of 20-35 ℃, turn over the compost 1 time every day, keep the composting reaction for 10 days to reach a stable state, and take solid compost materials for subsequent fermentation.
Example 2 cloning of degradative genes and chromosomal integration
a. An amplification primer is designed according to Jar gene (shown as SEQ ID NO: 1) of the bacillus amyloliquefaciens, and an upstream primer is F1: atgttaaaacttaccgcgga, the downstream primer is R1: tcaataattcaccagatata are provided.
b. Cloning of Jar Gene of Bacillus amyloliquefaciens
(1) PCR amplification is carried out by using primers F1 and R1 and bacillus amyloliquefaciens liquid as a template. The PCR amplification reaction system is as follows: TaKaRa Ex Taq (5U)0.5 uL, 10XEx Taq Buffer 5 uL, dNTP mix (2.5 mM each) 4 uL, F2(10pmol)1.5 uL, R1(10pmol)1.5 uL, bacterial liquid template 0.5 uL, purified water 37 uL, total 50 uL system, in Eppendorf centrifuge tube.
(2) The PCR cycling parameters were:
95℃ 5min,lX(94℃ 30s,65℃ 30s,72℃ 50s),35X(94℃ 30s,56℃ 30s,72℃ 50s),72℃ 8min。
(3) and (3) detecting a PCR reaction product: and (3) after the reaction is finished, taking the PCR amplification product, carrying out electrophoresis by using 0.8% agarose gel, carrying out photographing inspection by using a gel imaging system to obtain a target fragment with an expected size, recovering the PCR fragment by using a gel recovery kit, and linking the PMD-18T vector.
c. Integration of exogenous gene into lactobacillus chromosome
The chromosomal integration method is a method which is conventional in the art, and the following steps can also be employed:
firstly, constructing an insertion fragment, wherein the insertion fragment is designed as follows, a 1000bp DNA fragment-Jar gene expression frame-Lox locus sequence-chloramphenicol resistance gene-Lox locus sequence-a 1000bp DNA fragment from the downstream of lactobacillus chromosome thyA gene is from the upstream of lactobacillus chromosome thyA gene, and then the insertion fragment is inserted into the position of the thyA gene of lactobacillus CGMCC No.5959 chromosome through site-specific recombination to replace the thyA gene; the chloramphenicol resistance gene was then removed using Cre enzyme.
Specifically, the 1000bpDNA fragment from the upstream and downstream of the thyA gene of the lactobacillus CGMCC No.5959 chromosome is obtained by PCR by taking the lactobacillus CGMCC No.5959 genomic DNA as a template. And (b) introducing 1x site sequences at two ends of the target gene by PCR by using the PMD-18T vector connected with the target gene in the step a as a template. The 3 PCR fragments overlap each other end to end by 25bp and are joined by overlap extension PCR to form a full-length DNA insert. Connecting the DNA insert with pNZ plasmid, transforming Escherichia coli TopIO competent cells, screening positive recombinants on a BHI solid culture medium plate containing 5 micrograms/ml chloramphenicol, further expanding propagation in a BHI liquid culture medium containing 5 micrograms/ml chloramphenicol, extracting a large amount of plasmid DNA and sequencing for verification. The extracted plasmid is transformed into lactic acid bacteria CGMCC No.5959 through electric shock, colonies growing only on a chloramphenicol plate but not an erythromycin plate are screened through parallel plate coating, and colony PCR verification is further carried out to obtain double-exchange recombinants.
The plasmid containing Cre recombinase coding genes is transformed into the verified double-exchange recombinant (which needs to be prepared into competent cells in advance), the recombinant is cultured on an MRS plate containing 10 micrograms/ml of erythromycin at 37 ℃, after bacterial colonies appear, the plate is coated in parallel on culture media respectively containing 30 micrograms/ml of erythromycin and 10 micrograms/ml of chloramphenicol, the recombinant sensitive to chloramphenicol but resistant to erythromycin is screened, and the excision of chloramphenicol resistance genes is verified by using a colony PCR method.
The recombinants were cultured in 1Oml MRS medium without antibiotics overnight at 37 ℃ to lose the plasmid containing the Cre recombinase-encoding gene. And (3) coating the culture solution on an MRS plate, carrying out overnight culture at 37 ℃, taking colonies, coating the colonies on the MRS plate containing 30 micrograms/milliliter of erythromycin and the MRS plate without any antibiotic in parallel to screen the recombinants sensitive to the erythromycin, and verifying the loss of the plasmid containing the Cre recombinase coding gene through colony PCR. After 30 generations of subculture, the Jar gene in the lactobacillus is stably expressed on the chromosome of the lactobacillus, is not lost and can be stably expressed.
Example 3 fermentation experiments
a. Preparation of bacterial liquid
The lactobacillus is the kitchen waste reduction type lactobacillus HBS-RS (pediococcus acidilactici), and the preservation number is CGMCC No. 5959; the yeast is China general microbiological culture Collection center (CGMCC), Saccharomyces cerevisiae (CGMCC 2.168); the Bacillus subtilis adopts Bacillus subtilis (number 10066) preserved by China center for culture Collection of Industrial microorganisms (CICC).
(1) Preparation of Bacillus subtilis liquid
Selecting a bacillus subtilis strain with the preservation number of CICC 10066, inoculating the bacillus subtilis strain to a solid slant culture medium, placing the solid slant culture medium in an incubator for culture at the culture temperature of 37 ℃ for 24 hours, then inoculating a grown slant bacterial colony to a liquid culture medium for shaking table oscillation culture, wherein the rotating speed of the shaking table is l60r/min, the culture temperature is 37 ℃, the culture time is 24-36 hours, and when the bacterial colony number reaches 1X109cfu/ml, the preparation of the bacterial liquid is finished; the bacillus subtilis solid slant culture medium is prepared by mixing the following raw materials, by weight, 5g of glucose, lg of beef extract, 0g of peptone l, 5g of sodium chloride, 15g of agar and 1000ml of distilled water, wherein the pH value is 7.0; the liquid culture medium is prepared by mixing the following raw materials, by weight, 5g of glucose, 5g of beef extract, 0g of peptone l, 5g of sodium chloride and distilled water, wherein the constant volume is 1000mL, and the pH value is 7.0; both the solid slant medium and the liquid medium were passed through 121 ℃: sterilizing at high temperature for 30min, and cooling.
(2) Preparation of yeast liquid
Selecting CGMCC2.168 Saccharomyces cerevisiae strain, inoculating to solid slant culture medium, culturing in incubator at 25-30 deg.C for 16-24 hr, inoculating to liquid culture medium, and shaking culturing at shaking table rotation speed of 160r/min and 25-30 deg.C; the culture time is 24-48 hours, and when the colony count reaches 1 × 109cfu/ml, the preparation of the bacterial liquid is finished; the yeast solid slant culture medium is prepared by mixing the following raw materials in parts by weight: 5g of yeast extract, 0.2g of urea, 2g of dipotassium hydrogen phosphate, 0.02g of calcium chloride, 15g of agar, 12brxi, constant volume of 1000ml of wort and natural pH value; the liquid culture medium is prepared by mixing the following raw materials in parts by weight: 5g of yeast extract, 0.2g of urea, 2g of dipotassium phosphate and 0.02g of calcium chloride, wherein the volume of malt wort is constant to 1000ml, and the pH value is natural; the solid slant culture medium and the liquid culture medium are sterilized at 121 deg.C for 30min and then cooled for use.
(3) The preparation of the CGMCC No.5959 lactic acid bacteria liquid is as follows:
selecting CGMCC No.5959 lactic acid bacteria and the transgenic lactobacillus prepared in the embodiment 2, respectively inoculating the lactic acid bacteria and the transgenic lactobacillus to a solid slant culture medium, placing the culture medium in an incubator for culture at the culture temperature of 35-37 ℃ for 24-36h, then inoculating the grown slant bacterial colony to a liquid culture medium for shaking table oscillation culture at the shaking table rotation speed of l60r/min at the culture temperature of 35-37 ℃ for 48-72 h, and completing the preparation of bacterial liquid when the bacterial colony number reaches 1x109 cfu/ml; the lactobacillus solid slant culture medium is prepared by mixing the following raw materials in parts by weight: 10g of glucose, 5g of lactose, 5g of beef extract, l0g of yeast extract, 10g of peptone, 2g of diammonium hydrogen citrate, 801.0g of Twenn, 5g of sodium acetate, 2g of dipotassium hydrogen phosphate, O.lg of magnesium sulfate, 0.05g of manganese sulfate, 10g of calcium carbonate, 15g of agar and 1000ml of distilled water with constant volume and pH value of 5.8-6.8; the liquid culture medium is prepared by mixing the following raw materials in parts by weight: 0g parts of glucose l, 5 parts of lactose, 5 parts of beef extract, 10 parts of yeast extract, 10 parts of peptone, 2 parts of diammonium hydrogen citrate, 801.0g parts of Twenn, 5 parts of sodium acetate, 2 parts of dipotassium hydrogen phosphate, 0.05 part of manganese sulfate, 10 parts of calcium carbonate and 1000mL of distilled water in fixed amount, wherein the pH value of the distilled water is 5.8-6.8.
B. Preparation of microbial inoculum
Adjusting the bacterial concentration of each of the three bacterial liquids to 1x109cfu/ml, then as 2: 1: 1 volume ratio, and preparing intoLiquid microbial inoculum.
C. Garbage treatment of microbial inoculum
The compost material prepared in example 1 is added with mixed microbial inoculum, wherein the microbial inoculum adopts various combination forms for effect verification, and the specific forms are shown in the following table 1. Diluting the mixed strain with water according to the volume ratio of 1:50, adding the diluted mixed strain according to 0.5% (V/W) of the weight of the garbage, ventilating, supplying oxygen, fermenting for 5 days, controlling the temperature to be not more than 40 ℃, allowing percolating water generated by biological treatment to enter a sewage treatment system through a bottom pipeline of a fermentation tank, and allowing generated waste gas to enter a waste gas treatment system through a pipeline at the upper part of the fermentation tank; and taking the fermented product as an organic fertilizer for subsequent utilization.
And detecting the fat content and the protein content in the treated garbage sample. The fat content determination method comprises the following steps: according to a Soxhlet extraction method in the GB/T5009.6-2003 method, diethyl ether of a SZC-C fat tester is used as an extracting agent to measure the fat content in the treated garbage. The crude protein content determination method comprises determining the crude protein content in the treated garbage by using a KDY-9820 Kjeldahl apparatus according to the GB/T6432-94 method. The weight reduction ratio of the waste (weight of solid before treatment-weight after treatment)/weight before treatment is 100%. By measurement, the results are as follows:
the results show that the combination of the three bactericides can obviously reduce the weight of the garbage, and the analysis shows that most of the solid weight is dissipated in the form of heat energy through strain fermentation, and a part of the solid weight is dissipated in the form of gas and liquid percolate, so that the effect of reducing the weight of the garbage is well achieved. Particularly, the invention discovers that after Jar gene (shown as SEQ ID NO: 1 in sequence) cloned from bacillus amyloliquefaciens is introduced into the kitchen waste reduction type lactobacillus, the waste degradation rate and the protein fat rate can be remarkable, and more degradation products capable of being absorbed by organisms can be generated.
Example 4 organic fertilizer effect verification
Will be described in example 3Drying and pulverizing the fermented product per m2Applying 5kg of fermented organic fertilizer to corn seedling field, respectively applying the organic fertilizer prepared by the invention, after applying, not applying other fertilizers, having the same row spacing and plant spacing, culturing l00d from germination, and measuring lm2The biomass of the inner plant is as follows:
from the results, the oil and fat and other organic substances of the organic fertilizer prepared by the invention can be better digested into micromolecular substances to be utilized by plants, and the utilization efficiency of the plants is improved.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Yangjianhua
<120> urban domestic garbage treatment method
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 819
<212> DNA
<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)
<400> 1
atgttaaaac ttaccgcgga gcgtgttggg tcatatgaaa gggaaaatat catttatttc 60
aatgcgggtc gggatgatca agtatttatt gtgtcggtgc acgatcacaa agtaatattg 120
gaggttatga aaggcagctc tcttttaatc aaaaaagagt tacacggatt ttctgaagat 180
gcccatttct atctgattga ttcgtatgat gacactatcg tgatcgttta cctggagaat 240
catacgtgtc aattggctgc atactgcgta aacagtaata aaatcaatcc gatttgttct 300
tttctattaa gcgccaatgt atttcatctg ggtgaggatg gattattatg gatcggatta 360
acggacgagg gtatgtatga tgagagaaat cctcaaggaa aagcgatatt tgcttttcat 420
gcagaagaca gaacgtttta ttttgaagac gattttaaag aaatgatgca cgaatgctat 480
gccgtacaat cgatcaaatc tgatttgtat gtatgtttcg agggagagga ttgctgtgtc 540
atcggtcatt atcagattgg acgggacaga attcgtactg ttgcagaata tgtgctaaac 600
ggcgatcaat actcctattg tgatcagcta tccgtttcga aaaaaagggt gctgctgatt 660
cagagtcacg atgataccct atttgcattt catgaagagc acaaagagac tgacgtcatg 720
atacacggta ttgatagaaa aggagaaaca acgtacagag ccgtacagga tcgcatgttt 780
atctttagtg ataacgattt atatctggtg aattattga 819
<210> 2
<211> 20
<212> DNA
<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)
<400> 2
atgttaaaac ttaccgcgga 20
<210> 3
<211> 20
<212> DNA
<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)
<400> 3
tcaataattc accagatata 20
Claims (1)
1. A municipal solid waste treatment method sequentially comprises the following steps:
(1) removing solid waste: the method comprises the steps of breaking bags, sorting, removing impurities, recycling resources, removing some solid and non-decomposable parts, sorting bamboo and wood, waste batteries, plastics, glass, lighters, metals and fabrics for recycling, and using the inorganic materials of the brick, tile and stone blocks for manufacturing novel building materials; separating to obtain organic matters for subsequent steps;
(2) organic matter chemical treatment: comprises crushing purified organic matter, and then placing into a catalytic tank for catalytic reaction, wherein the catalyst is 98% concentrated sulfuric acid and P-containing205Adding more than 30 percent of phosphate rock powder, adding 10kg of concentrated sulfuric acid and 20kg of phosphate rock powder into 1 ton of pure organic matter, opening a high-temperature high-pressure steam electric regulating valve of a boiler, introducing superheated steam, controlling the temperature to be 250 ℃, controlling the pressure to be 1.4MPa, and controlling the reaction time to be 2 hours;
(3) composting after chemical treatment: the method comprises the step of carrying out composting reaction on the organic matters obtained by the treatment in the previous step, specifically, carrying out chemical treatment on the organic matters, wherein the weight ratio of the organic matters to the organic matters is 100: 1-10 of composting accelerant, wherein the composting accelerant is formed by mixing fly ash, wheat straw, human and animal excreta and magnesium chloride; the weight ratio of the fly ash, the wheat straws, the human and animal excreta and the magnesium chloride is 100-;
(4) providing a microbial inoculum for composting fermentation: firstly, a kitchen waste reduction type microbial compound inoculant is provided, which comprises the following components in percentage by weight: 60% of lactic acid bacteria, 20% of saccharomycetes and 20% of bacillus subtilis, wherein the bacterial colony content of the microbial inoculum is (1-5) multiplied by 109cfu/g; wherein the lactobacillus is a lactobacillus strain obtained by converting SEQ ID NO: 1, introducing the gene into kitchen waste reduction type lactobacillus CGMCC No.5959 to obtain lactobacillus; the yeast is CGMCC 2.168; bacillus subtilis CICC 10066;
diluting the microbial inoculum with water according to the volume ratio of 1:50, adding the diluted mixed strain according to 0.5% (V/W) of the weight of the garbage, ventilating, supplying oxygen, fermenting for 5 days, controlling the temperature to be not more than 40 ℃, allowing percolating water generated by biological treatment to enter a sewage treatment system through a pipeline at the bottom of a fermentation tank, allowing generated waste gas to enter a waste gas treatment system through a pipeline at the upper part of the fermentation tank, and allowing a fermented product to be used as an organic fertilizer for subsequent utilization.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810740920.5A CN109081709B (en) | 2018-07-08 | 2018-07-08 | Urban domestic garbage treatment method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810740920.5A CN109081709B (en) | 2018-07-08 | 2018-07-08 | Urban domestic garbage treatment method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109081709A CN109081709A (en) | 2018-12-25 |
| CN109081709B true CN109081709B (en) | 2021-05-14 |
Family
ID=64837180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810740920.5A Active CN109081709B (en) | 2018-07-08 | 2018-07-08 | Urban domestic garbage treatment method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109081709B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111423256A (en) * | 2020-04-23 | 2020-07-17 | 上海国璨环境科技有限公司 | Organic garbage pyrolysis method |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1587217A (en) * | 2004-07-28 | 2005-03-02 | 北京顺天东方绿色环保科技开发有限公司广西分公司 | Process for quick converting garbage organic into mirobial bacterial manure at large batch |
| CN1686624A (en) * | 2005-04-29 | 2005-10-26 | 刘文治 | Household gabbage chemical stability treatment technology |
| CN101274331A (en) * | 2007-03-30 | 2008-10-01 | 杨计明 | House refuse treatment method |
| CN102766588A (en) * | 2012-04-13 | 2012-11-07 | 轻工业环境保护研究所 | Kitchen waste destructive compound microbial bactericide, its preparation method and application thereof |
| CN103183541A (en) * | 2013-04-12 | 2013-07-03 | 路德环境科技股份有限公司 | Method for preparing ecological organic fertilizer from organic waste |
| CN106085929A (en) * | 2016-08-28 | 2016-11-09 | 窦欣童 | A kind for the treatment of method for urban garbage |
| CN106631225A (en) * | 2015-10-29 | 2017-05-10 | 林青云 | High-nutrient compound fertilizer and production method thereof |
-
2018
- 2018-07-08 CN CN201810740920.5A patent/CN109081709B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1587217A (en) * | 2004-07-28 | 2005-03-02 | 北京顺天东方绿色环保科技开发有限公司广西分公司 | Process for quick converting garbage organic into mirobial bacterial manure at large batch |
| CN1686624A (en) * | 2005-04-29 | 2005-10-26 | 刘文治 | Household gabbage chemical stability treatment technology |
| CN101274331A (en) * | 2007-03-30 | 2008-10-01 | 杨计明 | House refuse treatment method |
| CN102766588A (en) * | 2012-04-13 | 2012-11-07 | 轻工业环境保护研究所 | Kitchen waste destructive compound microbial bactericide, its preparation method and application thereof |
| CN103183541A (en) * | 2013-04-12 | 2013-07-03 | 路德环境科技股份有限公司 | Method for preparing ecological organic fertilizer from organic waste |
| CN106631225A (en) * | 2015-10-29 | 2017-05-10 | 林青云 | High-nutrient compound fertilizer and production method thereof |
| CN106085929A (en) * | 2016-08-28 | 2016-11-09 | 窦欣童 | A kind for the treatment of method for urban garbage |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109081709A (en) | 2018-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103602616B (en) | Bacillus amyloliquefaciens Y10 and application thereof | |
| CN101333510B (en) | Method for processing sludge and preparing bio organic fertilizer and special leaven thereof | |
| CN106190927B (en) | A kind of bacterial strain and its application for sludge high temperature compost | |
| CN107988099B (en) | Microbial agent for rapid degradation and reduction of organic garbage and application thereof | |
| CN109852557A (en) | A kind of composite bacteria agent and the preparation method and application thereof for the processing of cities and towns storage waste stabilisation | |
| CN101597532A (en) | A kind of sludge fuel and preparation method thereof | |
| CN114574383A (en) | Efficient compound microbial agent for degrading kitchen garbage as well as preparation method and application thereof | |
| CN108929162B (en) | Treatment method for degrading and removing heavy metal from municipal domestic waste | |
| CN109809840B (en) | Municipal refuse treatment method | |
| CN100542703C (en) | A kind of town refuse biology pretreatment method | |
| CN108277187B (en) | Microbial agent for efficient biological drying of municipal sludge | |
| CN112625921B (en) | Bacterium preparation for treating waste with high lignin content | |
| CN109081709B (en) | Urban domestic garbage treatment method | |
| CN110819554B (en) | Extreme thermophilic bacteria and application thereof in high-temperature compost fermentation | |
| CN111004748B (en) | Microbial strengthening microbial inoculum capable of remarkably promoting fermentation effect before household garbage incineration and application thereof | |
| CN103497925B (en) | The genetic engineering bacterium KT-puts2 of one strain degraded sulfonylurea herbicide and application thereof | |
| CN109609412A (en) | A kind of Thermophilic Bacteria Bacillus smithii Ths1 and its application | |
| CN102897983A (en) | Method for comprehensively utilizing residual sludge | |
| CN112479391A (en) | Preparation method of degradation product of well site environment-friendly toilet and method for treating water-based solid waste | |
| Liang et al. | Optimization and process analysis of biodrying of low organic matter content municipal sludge | |
| KR102599313B1 (en) | Mixed microorganism strain for decomposing food waste | |
| Ma et al. | Changes in Enzyme Activity and Bacterial Succession During Sewage Sludge Composting. | |
| CN109097146A (en) | House refuse biological coal qualitative method | |
| CN114806926B (en) | Kitchen waste decomposing degradation microbial inoculum and application thereof | |
| KR102654124B1 (en) | Bacillus subtils YBK-1 strain for decomposing organic waste and processing method using thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Xiaomin Inventor after: Yang Jianhua Inventor before: Yang Jianhua |
|
| CB03 | Change of inventor or designer information | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210428 Address after: 5006, business building, 21 Ganjiakou, Haidian District, Beijing Applicant after: Zhang Xiaomin Address before: 100085 Key Laboratory of Environmental Biotechnology, Center for Ecological Environment Research, Chinese Academy of Sciences, No. 18 Shuangqing Road, Haidian District, Beijing Applicant before: Yang Jianhua |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |