CN108586591A - Purposes of the CYP71A1 genes in resistance to inverse genetic engineering - Google Patents

Abstract

The invention discloses the relevant gene of a plant stress tolerance and its coding albumen and applications.Resistance to inverse gene provided by the invention is the CYP71A1 of cytochrome P450 gene family, the PcCYP71A1 especially obtained from Qinghai cool-zone turfgrasses (Poa crymophila Keng.Cv.Qinghai).Coding albumen, the recombinant vector containing the gene order, expression cassette, transgenic cell line or the recombinant bacterium of resistance to inverse gene C YP71A1 disclosed by the invention, the gene are used equally for regulation and control plant stress tolerance or cultivate plant with adverse resistance, and application prospect is good.

Description

Purposes of the CYP71A1 genes in resistance to inverse genetic engineering

Technical field

The invention belongs to biotechnologies, and in particular to purposes of the CYP71A1 genes in resistance to inverse genetic engineering.

Background technology

Known new function discover and use and the functional study of unknown gene, genetic resources library and have to expand Effect provides important foundation using genetic resources, is one of important directions of gene functional research.Arid and soil salt damage are prestige It coerces Global Agriculture and produces the most important adverse circumstance factor.In addition climate change, environmental disruption make the poles such as arid cryogenic freezing in recent years Weather aggravation is held, makes constantly to be expanded by arid, salt damage area, crop production is by great threat.The training of adversity resistant plant new material It is a persistently permanent project to educate, and the excavation and utilization of adversity gene are of great significance.

Cytochrome P450 (Cytochrome P450, abbreviation CYP450, P450) is a kind of blood red with multiple functions Plain oxidative system can be combined with organelles films such as endoplasmic reticulum, mitochondria, plastid, golgiosomes, because its reduced form is combined with CO There is maximum absorption band at wavelength 450nm afterwards and gains the name.Cut-off 2017, has identified a P450 albumen more than 50000 【http://en.wikipedia.org/wiki/Cytochrome_P450】.CYP450 encodes a huge supergene man It is intracellular to be widely present in animal, plant, bacterium, fungi etc. for race.In plant, about 1% protein coding gene is P450 genes【Review, Ghosh S, 2017】, it is maximum zymoprotein family in higher plant.Cytochrome P450 gene work( It can mainly be classified as two major classes：1) biosynthesis pathway is participated in；2) biologic detoxication approach is participated in.They are widely catalyzed single add Oxygen/hydroxylating synthesizes a variety of primary and secondary metabolite such as phenylpropyl alcohol alkanes, alkaloid, terpene, aliphatic acid, raw cyanogen sugar Glycosides, sulphur glucoside and plant hormone etc. have weight in the native compound of plant disease and pest resistance and the important medical value of production It acts on.They also assist in the biological oxidation that many exogenous materials include herbicide, pesticide etc., decompose these noxious materials, Plant is set to be effective against the stress of toxic adverse circumstance.

In the application of plant genetic engineering P450 genes, still focus mostly on has important pharmaceutical value at present in production Native compound【Villa-Ruano, et al., 2015；Takemura T, et al., 2010】, plant is improved to pathogen Resistance【Xu et al,2015；Griebel T＆Zeier J, 2010】, plant detoxification ability is improved as cultivated antiweed green wood Material【Xia XJ et al, 2009；Busi R,et al 2010】, and cultivate the rehabilitation plant that can remove pollution environment【Van Aken B,2009】Etc..One P450 gene Cs YP710A11 from tomato is imported into purpose plant by we, can be shown The anti-adversity ability for improving transfer-gen plant is write, and is applied patented【ZL201010514729.2】.

It is still not fully aware of about the function of CYP71 family genes at present.Member CYP71A1 genes are earliest from avocado It clones and obtains in the pericarp of (Persea americana), the gene is related with the maturation of tissue【Bozak et al.1990】. So far, there are no whether there is the report for adjusting Plant Tolerance environment stress function about CYP71A1 genes, also plant is not being improved The report applied in the anti-environment stress of object.

Invention content

The object of the present invention is to provide a kind of plant stress tolerance related gene, albumen and applications.

The present invention provides purposes of the following any substance in regulation and control plant stress tolerance or in cultivating plant with adverse resistance；

1) CYP71A1 genes；

2) the coding albumen of CYP71A1 genes；

3) recombinant vector, expression cassette, transgenic cell line containing CYP71A1 gene orders or recombinant bacterium.

Wherein, described resistance to inverse for drought-resistant, Thief zone, salt and/or low temperature.

Low temperature is with 10 DEG C in present invention experiment；NaCl concentration 200mmol/L with high salt；Thief zone mannitol 200mmol/ L；Drought condition behaviour industry control water 20d or artificial control water 30d.

It is please directed to low temperature, with high salt, Thief zone, arid respectively, provides the range that CYP71A1 genes may be effectively resistant to.

Wherein, the plant is dicotyledonous or monocotyledon；Further, the plant is tobacco.

Wherein, the CYP71A1 genes are from grass family (Poaceae) Poa L. (Poa) cool-zone turfgrasses Poa It expands and obtains in crymophila Keng.Cv Qinghai.

Wherein, the nucleotide sequence of the CYP71A1 genes is precocious from the cold ground in Qinghai as shown in SEQ ID No.1 Standing grain (Poa crymophila Keng.Cv.Qinghai), is named as PcCYP71A1；Encode the amino acid sequence such as SEQ of albumen Shown in ID No.2.

The present invention also provides a kind of nucleotide sequences, and sequence is as shown in SEQ ID No.1.

The present invention also provides the coding albumen of nucleotide sequence shown in SEQ ID No.1；Further, sequence such as SEQ Shown in ID No.2.

The present invention also provides the recombinant vector, expression cassette of sequence shown in ID containing SEQ No.1 or SEQ ID No.2, turn Gene cell system or recombinant bacterium, including Escherichia coli, Agrobacterium, plant cell etc..

The present invention also provides a kind of methods improving plant stress tolerance, by the recombinant vector of the gene order containing CYP71A1 It imports plant or plant tissue and makes the gene expression.Further, the CYP71A1 gene orders such as SEQ ID No.1 It is shown.

The present invention also provides a kind of methods for cultivating plant with adverse resistance, and the recombinant vector of the gene order containing CYP71A1 is led Enter plant or plant tissue and make the gene expression, obtains the genetically modified plants that resistance of reverse improves.Further, described CYP71A1 gene orders are as shown in SEQ ID No.1.

Method provided by the invention is then will to be turned channel genes purpose plant tissue, cell or the organ Plant cell, tissue or the organ of change are cultivated into plant, improve plant stress tolerance by transgenosis.

The CYP71A1 genes of the present invention are imported by construction of expression vector in purpose plant, and recombinant expression carrier sets out Carrier be it is a kind of can be used for Agrobacterium tumefaciems or agrobacterium rhizogenes conversion plant binary vector, or can be used for plant particles bombardment Carrier, or the carrier that can be replicated in prokaryotes.For example, the recombinant vector can be pCAMBIA serial carriers； Preferably, the carrier is pCAMBIA2301 or p2355 carriers.

CYP71A1 genes can add any one when being building up in plant expression vector before its transcription initiation nucleotide Enhanced, composing type, organizing specific type or inducible promoter are planted to drive its expression.For the ease of to transgenic plant cells Or plant is identified and is screened, and can be processed to used carrier, such as be added plant selectable marker (gus gene, GFP genes etc.) or gene (aminoglycoside resistant gene npt II, hygromycin gene hpt with antibiotic resistance Deng) or anti-chemical reagent marker gene etc. (such as herbicide resistant bar gene).

The plant host being converted can be monocotyledon, can also be dicotyledon, as rice, wheat, corn, Rye grass, tobacco, tomato, cucumber, turfgrass, clover etc..Carrying the PcCYP71A1 expression vectors of the present invention can pass through Use the standard biologics such as Ti-plasmids, Ri plasmids, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated Technical transform plant cell or tissue, and by the plant of conversion through tissue cultures at plant.

Specifically, the present invention provides a CYP71A1 gene, it is conducted into overexpression in purpose plant so that Transfer-gen plant clearly enhances the tolerance to cold, with high salt, arid and Thief zone stress than WT lines.Show CYP71A1 genes have the function of resisting abiotic adverse circumstance, can significantly improve the ability of Plant Tolerance environment stress, in a variety of environment It shields to plant under condition stress.Therefore, CYP71A1 genes can be used as an effective target gene for cultivating Other low temperature resistant either drought-resistant or halophilic genetically modified plants.

Description of the drawings

The invention will be further described with reference to the accompanying drawings and examples, but these pictures and specific experiment are examples Property, limitation of the present invention cannot be treated them as.

Under Fig. 1 (NaCl, 200mmol/L) with high salt stress, the upgrowth situation of tobacco in the medium.Wherein WT is control Wild type；O1, O2, O3 are respectively 3 and turn PcCYP71A1 gene strains.Culture measures fresh weight after 30 days, variance analysis and significantly Property examine show the extremely notable P of difference<0.01.Transfer-gen plant root system is extremely flourishing, and growing state is substantially better than wild type.

Specific implementation mode

The invention will be further described for following example, but these specific experiments are exemplary, cannot be by them It is considered as limitation of the present invention.

Method used in embodiment is unless otherwise specified conventional method.

Material used in embodiment, reagent etc., are commercially available unless otherwise specified.

The separation of embodiment 1PcCYP71A1 genes is cloned

Qinghai cool-zone turfgrasses kind (Poa crymophila Keng.Cv.Qinghai) seed (it is same to be collected in Qinghai Province The pastures De Xian), it sows in basin alms bowl, is cultivated in greenhouse, material is tested with 3 weeks or so plant leafs of growth.Use Trizol Kit (Invitrogen) extracts total serum IgE from annual bluegrass blade, and cDNA is synthesized with Reverse Transcriptase kit (TaKaRa).

According to transcript profile sequencing data, clone obtains the complete open reading frames sequence of a P450 gene, analytical sequence Restriction enzyme site, using 5.0 software Design primers of Primer and synthesize.Add in initiation codon and terminator codon both ends Upper corresponding restriction enzyme site, to carry out vector construction.

Amplimer is as follows：

Sense primer：(EcoR I)5’GAATTCATGGCTTCTCTTCTTCAGCTCGATT 3’

Downstream primer：(Kpn I)5’GGTACCTTACTCCATCTTTTTACATAGGTGT 3’

PCR amplification is carried out with high-fidelity Tag enzymes (TaKaRa), obtains target fragment about 1500bp, recycling segment is cloned into In pMD19-T carriers (TaKaRa) and (Shanghai life work) is sequenced.The complete opening code-reading frame of the gene cDNA is obtained, altogether 1545bp。

Sequence alignment is carried out using GenBank BLAST, amino acid sequence homology analysis is carried out with DNAMAN softwares, is tied Fruit shows and the CYP71A1 of Uralensis Fisch (Triticum urartu) (GenBank accession number EMS50169.1) homology Up to 72%, the CYP71A1-like gene orders (XP_ with Triticum tauschii (Aegilops tauschii subsp.tauschii) 020182992.1) homology reaches 81%, therefore is PcCYP71A1 by the unnamed gene, and code length is 514 amino acid Protein.Nucleotide sequence and amino acid sequence are shown in SEQ ID No.1 and No.2.PMD19-T carriers life containing the gene Entitled pMD19-T-PcCYP71A1.

2 Qinghai cool-zone turfgrasses PcCYP71A1 gene plant over-express vectors structure of embodiment

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.The plant expression vector Including double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.The present embodiment is with plant expression vector p2355 For intermediate carrier, it is illustrated.

The carrier pMD19-T-PcCYP71A1 containing PcCYP71A1 genes that will be obtained in embodiment 1, by EcoR I With Kpn I double digestions, T4 ligases (NEB) connection is building up to plant expression vector p2355【The structure of the carrier is shown in：Heart-to-heart talk, M Sc thesis, 2008, Chengdu Inst. of Biology, Chinese Academy of Sciences】In, it is named as p23-PcCYP71A1.Plasmid p2355 It is built on the basis of pCAMBIA2301 (obtain CAMBIA and use license) by this laboratory, length is 12577 bp, and having card, that is mould Plain resistant gene and GUS marker gene；Containing 1 promoter, terminate subelement, be multiple cloning sites area therebetween, exogenous sequences by This is inserted into.The carrier p23-PcCYP71A1 freeze-thaw methods of structure are imported in Agrobacterium tumefaciems EHA105, Liquid nitrogen storage.

Embodiment 3 cultivates the genetically modified plants of anti-adversity ability enhancing

By taking tobacco as an example, by PcCYP71A1 channel genes purpose plants, in conversion process using to culture medium be shown in Table 1。

1. tobacco genetic transformation

Full tobacco mature seed is taken, 1min is cleaned with 70% ethyl alcohol, is then soaked in the secondary chlorine of active chlorine content 2% 10min is vibrated in acid sodium solution, with sterile water wash 4-5 times；It is inoculated in the culture dish of the culture medium containing MS, 25 DEG C, light culture 3 After d, optical culture is carried out, the photoperiod is that 16h light/8h is dark；20-30 days, germination and growth went out after aseptic seedling for use；Aseptic seedling is connected to It is grown in the culture bottle of the culture medium containing MS, changes within every 30 days a subculture, aseptic seedling can be bred and be preserved by test tube seedling.

The agrobacterium strains EHA p23-PcCYP71A1 for carrying purpose plasmid frozen are taken out from liquid nitrogen container, dip bacterium Liquid is in the flat lining out culture of LB+ rifampins (Rif) 25mg/L+ kanamycins (Kan) 50mg/L, 28 DEG C, 3 days；From tablet Upper picking Agrobacterium single bacterium colony is inoculated into the fluid nutrient medium of LB+ rifampins (Rif) 25mg/L+ kanamycins (Kan) 50mg/L In, 28 DEG C, shaking table 200rpm overnight incubations；The bacterium solution for taking overnight incubation is transferred to the nonreactive newly prepared in the ratio of 1%-2% The liquid of raw element co-cultures in base (COM)+200 μm of ol/L acetosyringones (AS).28 DEG C, 200rpm cultivates 5h or so, OD₆₀₀ It can be used to convert for 0.4-0.6.

Blade is cut into the fritter of about 0.5cm square and draws pattern cracking by the tobacco leaf for taking sterile culture；By Agrobacterium Bacterium solution and blade mixing take out blade after impregnating 10min, are placed on aseptic filter paper and suck extra bacterium solution, tobacco leaf is set In co-culturing in base (COM), 3d is co-cultured.Tobacco leaf after co-cultivation is placed on aseptic filter paper, sucks extra Agrobacterium； Tobacco leaf is gone in selective differentiation culture medium (SR) and is cultivated, 25 DEG C, 16h illumination/8h is dark, grows and grows thickly after about 2 weeks Bud, then move into squamous subculture 2 weeks in new Selective agar medium.Seedling is removed later, is placed into Selective agar medium of taking root (RM) Middle culture, 25 DEG C, 16h illumination/8h is dark, cultivates 30 days, during which replaces a subculture.After plant to be planted is taken root, plant height about 5- When 10cm, culture bottle is removed, is cultivated in basin alms bowl.And carry out transfer-gen plant detection.

The culture medium used during 1. tobacco genetic transformation of table

2. the detection of transfer-gen plant and T1 are for the acquisition of seed

Transfer-gen plant is identified in GUS histochemical stains.Choose the resistance transplant survival screened through kanamycins (Kan) Plant takes root 1-2cm and blade about 0.5cm square, is placed in GUS dye liquors【Jefferson RA, 1987】, 37 DEG C overnight.Turn The root and Ye Junneng of gene plant dye blue, and nontransgenic plants cannot.

PCR Testing and appraisal transfer-gen plants.Resistant plant and wild type gene group DNA are extracted, using the CTAB methods of improvement 【Wang Guanlin, 2002】It carries out.Using the e. coli jm109 of the p23-PcCYP71A1 containing plasmid as positive control, wild-type tobacco base Because group DNA is negative control, PCR amplification is carried out, CYP71A1 genetic fragments are detected.Sense primer is expanded in promoter region, downstream For primer in PcCYP71A1 gene ends, amplified fragments are about 1600bp.

Sense primer：5’ATGGCTTCTCTTCTTCAGCTCGATT 3’

Downstream primer：5’TTACTCCATCTTTTTACATAGGTGT 3’

PCR reaction systems are 25 μ L.Amplification condition is：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 45s, 72 DEG C of extension 45s, 35 cycles；Last 72 DEG C of extensions 5min.Amplified production is detected through 1% agarose gel electrophoresis.It can expand Increase and the plant of size about 1600bp segments for transfer-gen plant.

PCR testing results are consistent with GUS detections.16 plants of independent transfer-gen plants are obtained altogether.Transfer-gen plant is grown just Often, phenotype and WT lines are without the difference observed.

By transgenosis and control wild-type tobacco plants kind in basin alms bowl, it is placed in greenhouse and grows, bagging of blooming, after bearing seeds, Single plant collects seed, obtains T1 for seed, is preserved in 4 DEG C.

3. transgene tobacco low temperature stress is tested

It chooses the different transgenic lines (O1, O2 and O3) of T1 generations 3 and control seed, surface sterilization is placed on MS and trains substantially Hair seedling 7 days in base are supported, the seedling for taking growth consistent is placed on MS tablets and (puts 20 plants per ware), is then respectively placed in 10 DEG C, 25 DEG C The fresh weight of whole strain seedling, Mei Gechong are taken a picture and measure in lower culture, 3 repetitions, condition of culture 16h illumination/8h light cultures after 30d Repetition measurement determines 10 plants of rice shoots, is repeated 3 times.

The results show that under Different hypothermia stress, the growth of transgene tobacco root and cauline leaf is significantly better than that wild type.

The fresh weight of rice shoot is measured after 30d, the increment of transfer-gen plant rice shoot is all remarkably higher than wild type, and difference is extremely notable (P<0.01) (table 2).

Table 2. at low temperature on MS tablets transgenosis and wild type rice shoot fresh weight

Therefore, it is transferred to the low temperature stress tolerance that Qinghai cool-zone turfgrasses PcCYP71A1 genes are remarkably improved tobacco.

4. transgene tobacco high-salt stress is tested

It chooses the different transgenic lines (O1, O2 and O3) of T1 generations 3 and control seed, surface sterilization is placed on MS and trains substantially Hair seedling 7 days in base is supported, is taken and is grown consistent seedling and (put 20 plants per ware) on the MS tablets containing NaCl (0,200mmol/L), Each 3 repetitions of concentration for the treatment of take a picture after 25 DEG C of tissue culture room, 16h illumination/8h light cultures, 30d and measure root and seedling is fresh Weight, 10 plants of rice shoots of each replication are repeated 3 times.

The results show that under NaCl (200mmol/L) stress of high concentration, the growth of transgene tobacco root and cauline leaf is bright It is aobvious to be better than wild type.The fresh weight of rice shoot is measured after 30d, the increment of transfer-gen plant rice shoot is all remarkably higher than wild type, difference Extremely significantly (P<0.01) 3 are shown in Table.

The fresh weight of table 3. transgenosis and wild type rice shoot on various concentration NaCl MS tablets

Therefore, it is transferred to the high-salt stress tolerance that Qinghai cool-zone turfgrasses PcCYP71A1 genes are remarkably improved tobacco.

5. transgene tobacco Thief zone is tested

It chooses the different transgenic lines (O1, O2 and O3) of T1 generations 3 and control seed, surface sterilization is placed on MS and trains substantially Hair seedling 7 days in base is supported, is taken and is grown consistent seedling and (put 20 per ware on the MS tablets containing mannitol (0,200mmol/L) Strain), 3 repetitions of each concentration for the treatment of are taken a picture after 25 DEG C of tissue culture room, 16h illumination/8h light cultures, 30d, measure root and seedling Fresh weight, 10 plants of rice shoots of each replication, is repeated 3 times.

The results show that under the processing of mannitol 200mmol/L, the growth of transgene tobacco root and cauline leaf is substantially better than open country Raw type.The fresh weight of root and cauline leaf is measured after 30d, transfer-gen plant increment is all remarkably higher than wild type (P<0.01) 4, are shown in Table.

The fresh weight of table 4. transgenosis and wild type rice shoot on various concentration PEARLITOL 50C S tablets

Therefore, it is transferred to the osmotic pressure stress tolerance that Qinghai cool-zone turfgrasses PcCYP71A1 genes are remarkably improved tobacco Property.

6. transgene tobacco drought stress is tested

Artificial control water drought tests：Choose the different transgenic lines (O1, O2 and O3) of T1 generations 3 and control seed, sowing In basin alms bowl, hot-house culture carries out Osmotic treatment when growth of seedling is to 4 leaf periods.Artificial control water 20d manually controls water After 30d, rehydration observes the survival rate and growing state of plant.It tests and carries out 3 batches altogether, at least 10 plants of each strain in every batch of Seedling.

Potted orchard is manually controlled water drought tests and is shown, rehydration after arid 20d, adjoining tree only has 35% survival, and turns base Because n plant survival rate reaches 85%；Rehydration after arid 30d, transfer-gen plant only have 10% survival, and transfer-gen plant survival rate Reach 65%.Significant difference (P<0.01), and transgene tobacco growth is significantly better than wild type.

Therefore, it is transferred to the drought stress tolerance that Qinghai cool-zone turfgrasses PcCYP71A1 genes are remarkably improved tobacco.

In conclusion after plant is transferred to Qinghai cool-zone turfgrasses PcCYP71A1 genes, tolerance is cold, arid, with high salt and high The ability of the abiotic stresses such as osmotic stress significantly improves.CYP71A1 genes are in regulation and control plant stress tolerance, cultivation plant with adverse resistance side Face has a good application prospect.

Sequence table

The Qinghai SEQ ID No.1 cool-zone turfgrasses (Poa crymophila Keng.Cv.Qinghai) PcCYP71A1 bases Because of cDNA sequence, 1545bp, DNA

The Qinghai SEQ ID No.2 cool-zone turfgrasses (Poa crymophila Keng.Cv.Qinghai) CYP71A1 genes The protein sequence of coding, 514 amino acid residues, PRT

Sequence table

<110>Chengdu Inst. of Biology, Chinese Academy of Sciences

<120>CYP71A1 genes and its stress tolerance genetic engineering application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1545

<212> DNA

<213> poa

<400> 1

atggcttctc ttcttcagct cgattctagt accctagtcc tctgtctcgt cttggcagct 60

tccttcatct tcatcgctgc tagaagcctc cgcaaggacg gcgccgtacg tggaggagca 120

gcgccacctt cgcctctcgc gctgcccatc atcggcaacc ttcaccagct cggccggggc 180

caccaccacc ggaagctgca ggcactcgcc cggcgccacg gcccgctgtt tctcctccgc 240

ctcggctccg ttcccacgct cgtggtctcc tcgccctcgc tcgccgacgc cgtgctgagg 300

acccaggacc acgtcttctg cagccgccca cagccgcaca cggcccgcgg cacgctctac 360

ggctgccggg acatcgcctt cggcccctac ggcgagcggt ggcgccagct ccgccgcatc 420

gcggtcctgc acctcctcag cgcgaggcgt gtcgactcct tccgctcgct ccggcatgag 480

gaggccgcgg ggttcgtgga acggatccgc gccgccagcg cccgggagga ggggggcgtg 540

gtcaacgtga cggagctcat catcggcctg acgaacacgt tcgtttccag ggcggcgttc 600

gggaacaggc tcggcggcgt gaagccaggg gtggtccgtg acatgatgaa ggagctcact 660

gagctgctcg gggcgatcgc cgtcagcgac gtgctgccgc ggctgggccg gtgggtggac 720

tgggcgacgg gtctggacgc gagggtgagg aggacggcgg ctgagctcga cagtctcatc 780

gagagatcgc tagcggagca cgaagcgagc cgaggaaacg aaggcggcga gagcgagact 840

ggtgacctca tggacagttt ggtctcgatc tttaaggatg gtgatcgggg gtttaggctg 900

gaccggattg atgttaaggc gctcatcttg gacatgttca taggaggcac agacacgatc 960

tacaaggcga tagaatggac gatggccgaa cttgtcaaga atccaagaga aatggaaaag 1020

gttcaagcag aggtgagaca agtagctggt gcacaaggag gaatcctaga ggaagagctg 1080

gagaagatga gcttcctgca cgcggccatg aaggaagccc tgcgtctaca cccaccgata 1140

cccctcatcc cgcacgagtc aattcaggac acccggctgc acggctacca catcccagcc 1200

aagacccggg tcatgatcaa cgcatgggcg atcgggaggg acaatgagtg gtgggaggac 1260

gccgaggagt tccggccgga gaggttcatg gagaagacca ttgactacaa cggcaaggac 1320

ccccggtaca taccgttcgg cgccgggagg aggggatgcc ccggtatcgt ctttggcact 1380

cgcctcgcgg agctcacgct ggccaacatg atgtaccatt tcgactggga gctgccgaac 1440

ggacaggacc cggagtcgtt tgaggtcgtc gagtccagcg gcttcgcgcc tgcgcttaag 1500

tccgctttga ccttgttgca acacctatgt aaaaagatgg agtaa 1545

<210> 2

<211> 514

<212> PRT

<213> poa

<400> 2

Met Ala Ser Leu Leu Gln Leu Asp Ser Ser Thr Leu Val Leu Cys Leu

1 5 10 15

Val Leu Ala Ala Ser Phe Ile Phe Ile Ala Ala Arg Ser Leu Arg Lys

20 25 30

Asp Gly Ala Val Arg Gly Gly Ala Ala Pro Pro Ser Pro Leu Ala Leu

35 40 45

Pro Ile Ile Gly Asn Leu His Gln Leu Gly Arg Gly His His His Arg

50 55 60

Lys Leu Gln Ala Leu Ala Arg Arg His Gly Pro Leu Phe Leu Leu Arg

65 70 75 80

Leu Gly Ser Val Pro Thr Leu Val Val Ser Ser Pro Ser Leu Ala Asp

85 90 95

Ala Val Leu Arg Thr Gln Asp His Val Phe Cys Ser Arg Pro Gln Pro

100 105 110

His Thr Ala Arg Gly Thr Leu Tyr Gly Cys Arg Asp Ile Ala Phe Gly

115 120 125

Pro Tyr Gly Glu Arg Trp Arg Gln Leu Arg Arg Ile Ala Val Leu His

130 135 140

Leu Leu Ser Ala Arg Arg Val Asp Ser Phe Arg Ser Leu Arg His Glu

145 150 155 160

Glu Ala Ala Gly Phe Val Glu Arg Ile Arg Ala Ala Ser Ala Arg Glu

165 170 175

Glu Gly Gly Val Val Asn Val Thr Glu Leu Ile Ile Gly Leu Thr Asn

180 185 190

Thr Phe Val Ser Arg Ala Ala Phe Gly Asn Arg Leu Gly Gly Val Lys

195 200 205

Pro Gly Val Val Arg Asp Met Met Lys Glu Leu Thr Glu Leu Leu Gly

210 215 220

Ala Ile Ala Val Ser Asp Val Leu Pro Arg Leu Gly Arg Trp Val Asp

225 230 235 240

Trp Ala Thr Gly Leu Asp Ala Arg Val Arg Arg Thr Ala Ala Glu Leu

245 250 255

Asp Ser Leu Ile Glu Arg Ser Leu Ala Glu His Glu Ala Ser Arg Gly

260 265 270

Asn Glu Gly Gly Glu Ser Glu Thr Gly Asp Leu Met Asp Ser Leu Val

275 280 285

Ser Ile Phe Lys Asp Gly Asp Arg Gly Phe Arg Leu Asp Arg Ile Asp

290 295 300

Val Lys Ala Leu Ile Leu Asp Met Phe Ile Gly Gly Thr Asp Thr Ile

305 310 315 320

Tyr Lys Ala Ile Glu Trp Thr Met Ala Glu Leu Val Lys Asn Pro Arg

325 330 335

Glu Met Glu Lys Val Gln Ala Glu Val Arg Gln Val Ala Gly Ala Gln

340 345 350

Gly Gly Ile Leu Glu Glu Glu Leu Glu Lys Met Ser Phe Leu His Ala

355 360 365

Ala Met Lys Glu Ala Leu Arg Leu His Pro Pro Ile Pro Leu Ile Pro

370 375 380

His Glu Ser Ile Gln Asp Thr Arg Leu His Gly Tyr His Ile Pro Ala

385 390 395 400

Lys Thr Arg Val Met Ile Asn Ala Trp Ala Ile Gly Arg Asp Asn Glu

405 410 415

Trp Trp Glu Asp Ala Glu Glu Phe Arg Pro Glu Arg Phe Met Glu Lys

420 425 430

Thr Ile Asp Tyr Asn Gly Lys Asp Pro Arg Tyr Ile Pro Phe Gly Ala

435 440 445

Gly Arg Arg Gly Cys Pro Gly Ile Val Phe Gly Thr Arg Leu Ala Glu

450 455 460

Leu Thr Leu Ala Asn Met Met Tyr His Phe Asp Trp Glu Leu Pro Asn

465 470 475 480

Gly Gln Asp Pro Glu Ser Phe Glu Val Val Glu Ser Ser Gly Phe Ala

485 490 495

Pro Ala Leu Lys Ser Ala Leu Thr Leu Leu Gln His Leu Cys Lys Lys

500 505 510

Met Glu

Claims (10)

1. purposes of the following any substance in regulation and control plant stress tolerance or in cultivating plant with adverse resistance；

1) CYP71A1 genes；

2) the coding albumen of CYP71A1 genes；

3) recombinant vector, expression cassette, transgenic cell line containing CYP71A1 gene orders or recombinant bacterium.

2. purposes according to claim 1, it is characterised in that：It is described resistance to inverse for drought-resistant, Thief zone, salt and/or low temperature.

3. purposes according to claim 1, it is characterised in that：The plant is dicotyledonous or monocotyledon；Further Ground, the plant are tobacco.

4. purposes according to claim 1, it is characterised in that：The CYP71A1 genes are from cool-zone turfgrasses It expands and obtains in Poacrymophila Keng.

5. purposes according to claim 1 or 4, it is characterised in that：The nucleotide sequence of the CYP71A1 genes is such as Shown in SEQID No.1；The amino acid sequence of albumen is encoded as shown in SEQ ID No.2.

6. a kind of nucleotide sequence, it is characterised in that：Sequence is as shown in SEQ ID No.1.

The coding albumen of nucleotide sequence shown in 7.SEQ ID No.1；Further, sequence is as shown in SEQ ID No.2.

8. recombinant vector, expression cassette, transgenic cell line or the recombination of sequence shown in ID containing SEQ No.1 or SEQ ID No.2 Bacterium.

9. a kind of method improving plant stress tolerance, it is characterised in that：The recombinant vector of the gene order containing CYP71A1 is imported and is planted Object or plant tissue simultaneously make the gene expression；

Further, the CYP71A1 gene orders are as shown in SEQ ID No.1；The recombinant vector carries for pCAMBIA series Body；Preferably, the carrier is pCAMBIA2301 or p2355 carriers.

10. a kind of method for cultivating plant with adverse resistance, it is characterised in that：The recombinant vector of the gene order containing CYP71A1 is imported and is planted Object or plant tissue simultaneously make the gene expression, obtain the genetically modified plants that resistance of reverse improves；

Further, the CYP71A1 gene orders are as shown in SEQ ID No.1；The recombinant vector carries for pCAMBIA series Body；The purpose plant is dicotyledonous or monocotyledon.