CN108486118B

CN108486118B - BoNR8 long noncoding RNA transcribed by RNA polymerase III in common head cabbage and application thereof

Info

Publication number: CN108486118B
Application number: CN201810517255.3A
Authority: CN
Inventors: 吴娟; 刘自广; 刘春晓; 刘圣怡; 杨贺
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2018-05-25
Filing date: 2018-05-25
Publication date: 2021-05-14
Anticipated expiration: 2038-05-25
Also published as: CN108486118A

Abstract

The invention discloses BoNR8 long non-coding RNA which is expressed in large quantity in epidermal cortex tissues of a root elongation zone of a common head cabbage seed germination stage and serves as a negative regulator to regulate seed germination and seedling root growth under normal and stress conditions, and application of the BoNR8 long non-coding RNA transcribed by RNA polymerase III in the common head cabbage. It is used for the molecular breeding of cabbage. Under normal conditions, BoNR8 long non-coding RNA can inhibit seed germination, seedling root growth and silique growth by influencing AtRAVI expression; under salt stress, BoNR8 long noncoding RNA may inhibit seed germination independently of ABA signaling by affecting AtRAVI expression; in the presence of ABA, BoNR8 long non-coding RNA reduces the sensitivity of germinating seeds to ABA by influencing the expression of important genes in ABA signals. Therefore, the BoNR8 long noncoding RNA is a multifunctional long noncoding RNA transcribed by RNA polymerase III in Brassica oleracea.

Description

BoNR8 long noncoding RNA transcribed by RNA polymerase III in common head cabbage and application thereof

Technical Field

The invention relates to a medium-length non-coding RNA of common head cabbage and application thereof.

Background

Non-coding RNA (ncRNA) is a class of RNA molecules that have recently been attracting much attention, and they do not contain an open reading frame and do not have a function of coding proteins, and they are widely distributed in the organism as RNA molecules (accounting for nearly 98% of the mammalian genome sequence, nearly 71% of the arabidopsis genome sequence, and nearly 29% of the yeast genome sequence), and play an important role in growth, development, stress response, diseases, and the like.

Non-coding R in plants compared to humans and animalsNA studies are initiated later, and long non-coding RNA (lncRNA) studies are much less and less. In recent years, with the wide application of new molecular biological techniques in non-coding RNA research, some functional plant long non-coding RNAs are gradually discovered, and the functions and mechanisms of 7 long non-coding RNAs have been studied in detail:AtIPS1inhibiting the activity of miR399 by a target simulation mechanism, and participating in regulating the uptake of phosphate in Arabidopsis roots under the condition of phosphate starvation;COOLAIRinhibiting the expression of a flowering regulation gene FLC in a promoter transcription interference mode, and regulating the flowering time of plants;COLDAIRthe H3K27me3 histone modification which can cause FLC gene locus can silence FLC gene epigenetic inheritance and influence the flowering time of plants;LDMARone base C of the gene sequence is mutated into G, so that the promoter region is methylated, and the rice is subjected to male sterility caused by Photosensitivity (PSMS);ASCO(alternative splicing competes for long non-coding RNA) and interacts with AtNSRs (RNA binding protein) and alternative splicing mRNA, and the ASCO controls an alternative splicing mode formed by NSR and ASCO by intercepting an alternative splicing regulatory factor to influence the development of lateral roots of arabidopsis thaliana;HID1is a factor for promoting photomorphogenesis under the condition of continuous red light, and influences the growth of the hypocotyl of arabidopsis thaliana by regulating the expression of a photosensitizer acting factor PIF3 under the condition of red light; under auxin stress conditions, RNA polymerase II and V are transcribed to generate APOLO,APOLOthe double transcription of (2) changes the chromatin topological structure and expression of nearby PID genes (key regulators of auxin polar transport), and influences the growth of Arabidopsis roots. These long noncoding RNAs are transcribed by RNA polymerase II and expressed and function in young plants and mature plants.

The seeds are the peculiar reproduction organs of plants, and the seed germination is related to the reproduction and evolution of plant populations and the quality and yield of crops related to the life of people. The physiological process of seed germination is easily affected by external environmental factors such as illumination, temperature, moisture and oxygen, and is accurately regulated and controlled by germination related signal paths such as ABA signals, GA signals and the like and various metabolic pathways 18. At present, the seed germination process and the biological mechanism on the molecular level are not clear, and the research on the biological mechanism not only has theoretical significance, but also has important application value.

Cabbage is a 2-ploid brassica plant of the family brassicaceae, which contains 9 CC-type genomes in double copies. Cabbage contains important vegetable subspecies such as cauliflower, common head cabbage, turnip, broccoli, collard, brussels sprouts and the like, and plays an important role in human diet. The common head cabbage is a variety of the cabbage, is rich in nutrients such as fiber, vitamin C, carotene, minerals, lupeolin and the like, has anti-inflammatory and anti-carcinogenic effects, and has important nutritional and economic values. Currently, only a limited number of ncrnas are found in cabbage.

Cabbage and Arabidopsis (Arabidopsis) were isolated 1.5-2 million years ago; the research of molecular marker comparison mapping shows that the two species have wide collinearity relationship, the nucleotide sequence is highly conserved, the conservation of the exon sequence reaches 75-90%, and the conservation of the intron and the intergenic region is less than or equal to 70%. This suggests that knowledge gained in one species can be applied to the study of another species.

At present, with the application of various new technologies in ncRNA research, a large amount of lncRNA transcribed by RNA polymerase ll is found to play an important role in biological processes such as cell cycle regulation, apoptosis, cell identity establishment (cell identity), environmental stress response and the like in the form of regulatory factors. RNA polymerase lll in organisms transcribes a large number of tRNA, 5S rRNA, snorRNA, microRNA and other housekeeping ncRNAs which play an important role in the mRNA processing and translation process. In recent years, the transcription of ncRNA by RNA polymerase III has been increasingly found in association with environmental responses and human diseases, for example, Pagano, which finds a large number of functional ncRNA transcribed by RNA polymerase III on the human and mouse genomes based on the structural characteristics of RNA polymerase III type III promoter.

Disclosure of Invention

The invention provides BoNR8 long non-coding RNA transcribed by RNA polymerase III in common head cabbage and application thereof, wherein the BoNR8 long non-coding RNA (hereinafter written as BoNR8 lncRNA) is abundantly expressed in epidermal layer tissues of a root elongation region of a germinating seed of the common head cabbage and is used as a negative regulator to regulate seed germination, seedling root growth and silique growth under normal and stress conditions.

The nucleotide sequence of the BoNR8 long noncoding RNA transcribed by the RNA polymerase III in the common head cabbage is shown as the sequence table Seq ID No: 1 is shown.

The invention relates to application of BoNR8 long non-coding RNA transcribed by RNA polymerase III in common head cabbage, which is used for molecular breeding of the common head cabbage.

The invention discloses a AtR8 (long noncoding RNA transcribed by RNA polymerase III in Arabidopsis) homologue of RNA polymerase III in Brassica oleracea and a new long noncoding RNA with the length of 272 nucleotides, which are found by combining homologous sequence alignment and a tobacco cell-free transcription system, and is named as BoNR8 long noncoding RNA (BoNR8 lncRNA). The BoNR8 lncRNA exists in a single copy form in the genome of common head cabbage, is abundantly expressed in the epidermal cortex tissue of the root elongation region of the germinating seeds of the common head cabbage, and responds to various abiotic stresses. As a negative regulator, the plant growth regulator regulates the germination of arabidopsis seeds, the growth of seedling roots and the growth of siliques under normal and stressed conditions, namely under the normal condition, the overexpression of BoNR8 lncRNA can inhibit the germination of arabidopsis seeds, the growth of seedling roots and the growth of siliques by influencing the expression of AtRAVI; under salt stress, BoNR8 lncRNA overexpression may inhibit seed germination independently of ABA signaling by affecting AtRAVI expression; in the presence of ABA, the expression of BoNR8 lncRNA influences the expression of important genes in an ABA signal, and the sensitivity of germinating seeds to ABA is reduced. The discovery of BoNR8 lncRNA extends RNA polymerase III transcripts into new species, enriching plant ncRNA gene members. Since arabidopsis thaliana heterologous expression of BoNR8 lncRNA inhibits transgenic seed germination under normal and salt stress conditions and promotes transgenic seed germination in the presence of ABA, we can produce stress-tolerant transgenic brassica oleracea plants by reducing and increasing BoNR8 lncRNA expression, which will help molecular breeding and improve human life.

Drawings

FIG. 1 is a schematic representation of the cloning of the complete sequence of BoNR8 lncRNA from the common head cabbage genome using specific primer 1 and primer 2; wherein the Wbox (tgac) and ABRE (acgt) sequences are underlined and indicated in italics;

FIG. 2 is a schematic representation of the sequence similarity alignment of BoNR8 IncRNA and AtR8 IncRNA;

FIG. 3 is a diagram of primer extension analysis of total RNA of Brassica oleracea seedlings and in vitro transcribed BoNR8 IncRNA using a BoNR8-PE primer; wherein the asterisk indicates the 5' end of the BoNR8 IncRNA and EP represents the extension product;

FIG. 4 is a graph of the 3 'RACE analysis to determine the end of BoNR8 IncRNA 3'; wherein the arrow indicates the 3' end of the BoNR8 IncRNA;

FIG. 5 is a sequence diagram of the BoNR8 IncRNA gene; wherein the capital bold letters are the full-length sequences of the BoNR8 IncRNA genes, and the salt-conserved stress sequences are underlined;

FIG. 6 is a possible secondary structure diagram of BoNR8 IncRNA and UCC salt stress sequences predicted by RNAglogo software; wherein, bold letters are salt-conserved stress sequences;

FIG. 7 is a graph showing the transcription profile of RNA polymerase III from BoNR8 IncRNA; wherein U2 snRNA is RNA polymerase II transcriptional trait control, AtR8 lncRNA is used as RNA polymerase III transcriptional trait control;

FIG. 8 is a Southern analysis of Brassica oleracea genomic DNA digested with EcoRI, HindIII and SacI, respectively, hybridized with a DIG-labeled DNA probe (containing the USE, TATA-like sequence, BoNR8 IncRNA transcribed region);

FIG. 9 is a Southern analysis of Arabidopsis genomic DNA digested with EcoRI, HindIII and SacI, respectively, hybridized with a DIG-labeled DNA probe (containing USE, TATA-like sequence, BoNR8 IncRNA transcribed region);

FIG. 10 is an electrophoretogram of BoNR8 IncRNA cDNA amplified from Brassica oleracea genomic DNA using BoNR8 specific primers;

FIG. 11 is an electrophoretogram of a fragment obtained by digesting the plasmid pB1121-BoNR8 with Xba I and Sac I;

FIG. 12 is a graph showing the results of Northern analysis of the expression characteristics of BoNR8 lncRNA in different growth stages of dry cabbage seeds, imbibed seeds, germinated seeds, and 7-day-old seedlings;

FIG. 13 is a photograph of an integrated in situ hybridization of BoNR8 lncRNA expression profile in 2-day-germinated common head cabbage seeds; wherein the arrow indicates the BoNR8 lncRNA signal;

FIG. 14 is a photograph of in situ hybridization analysis of a section expressing BoNR8 lncRNA in an elongation region of a seed root of common head cabbage germinating for 2 days; wherein the arrow indicates the BoNR8 lncRNA signal;

FIG. 15 is a photograph of abiotic stress responses of BoNR8 IncRNA;

FIG. 16 is a graph of the lack of processing of BoNR8 IncRNA into short ncRNA under abiotic stress;

FIG. 17 is a graph showing the accumulation of BoNR8 IncRNA in imbibed seeds.

FIG. 18 is a diagram of the construction of a BoNR8 IncRNA overexpression vector;

FIG. 19 is a graph of the relative expression levels of Arabidopsis BoNR 8-overexpression lines (1#, 2#, and 3 #);

FIG. 20 is a graph showing germination rates of Arabidopsis thaliana seeds over-expressed by BoNR8 lncRNA under normal culture of 1/2 MS; wherein A is a WT germination rate map, B is a 1# germination rate map, C is a 2# germination rate map, and D is a 3# germination rate map;

FIG. 21 is a photograph comparing lengths of primary roots of 1/2MS cultured normally for 7 days;

FIG. 22 is a comparison histogram of primary root length; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 23 is a photograph of inhibition of silique development by overexpression of BoNR8 lncRNA in Arabidopsis thaliana;

FIG. 24 is a photograph of inhibition of silique development by overexpression of BoNR8 lncRNA in Arabidopsis thaliana;

FIG. 25 is a graph of germination rates for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 0mM NaCI; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 26 is a graph of germination rates for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 50mM NaCl; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 27 is a graph of germination rate for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 100mM NaCl; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 28 is a graph of germination rate for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 150mM NaCl; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 29 is a graph of germination rate for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 200mM NaCl; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 30 shows three BoNR8 overexpression lines and Wt seeds in the presence of 150mM NaCl and Na₆WO₄Germination profiles for 7 days on 1/2MS (0.1 mM); wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 31 shows three BoNR8 overexpression lines and Wt seeds in the presence of 200mM NaCl and Na₆WO₄Germination profiles for 7 days on 1/2MS (0.1 mM); wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 32 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 0. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 33 is a graph of germination rates for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 0.5. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 34 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 1 μ MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 35 is a graph of germination rates for three BoNR8 overexpression lines and Wt seeds grown for 7 days on 1/2MS with 1.5. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 36 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 2. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, and D is figure # 3.

FIG. 37 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 0. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 38 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 15 μ MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 39 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 35 μ MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 40 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 50. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 41 is a graph of germination rates for three BoNR8 overexpressing lines and Wt seeds grown for 7 days on 1/2MS with 75 μ MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 42 plots of germination for 7 days for three BoNR8 overexpressing lines and Wt seeds grown on 1/2MS with 100. mu. MABA; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 43 is a graph of expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene RD 29A; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 44 is a graph of expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene, SnRK2.3; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 45 is a graph of the expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene AtRAV 1; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 46 is a graph of expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene EM 1; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 47 is a graph of the expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene EM 6; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 48 is an expression diagram of three BoNR8 overexpression lines and Wt-affected ABA responsive gene WRKY 6; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 49 is a graph of expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene AB 13; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 50 is a graph of the expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene ABI 5; wherein A is a WT map; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 51 is a graph showing the expression of three BoNR8 overexpression lines and Wt affecting the ABA responsive gene SnRK2.2; wherein A is W T; b is figure # 1, C is figure # 2, D is figure # 3;

FIG. 52 is a schematic diagram of a BoNR8 lncRNA pathway for regulating seed germination.

Detailed Description

The first embodiment is as follows: the nucleotide sequence of the BoNR8 long noncoding RNA transcribed by RNA polymerase III in the common head cabbage of the embodiment is shown in the sequence table Seq ID No: 1 is shown.

The second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: the BoNR8 long noncoding RNA is a multifunctional long noncoding RNA transcribed by RNA polymerase III in common head cabbage. The rest is the same as the first embodiment.

The third concrete implementation mode: the application of the BoNR8 long non-coding RNA transcribed by RNA polymerase III in the common head cabbage of the embodiment is used for molecular breeding of the common head cabbage.

The fourth concrete implementation mode: the third difference between the present embodiment and the specific embodiment is that: the application of the BoNR8 long non-coding RNA transcribed by the RNA polymerase III in the common head cabbage in the molecular breeding of the cabbage refers to: under normal culture conditions, BoNR8 long non-coding RNA inhibits seed germination, seedling root growth, and silique growth by affecting AtRAVI expression. The rest is the same as the third embodiment.

The fifth concrete implementation mode: the third difference between the present embodiment and the specific embodiment is that: the application of the BoNR8 long non-coding RNA transcribed by the RNA polymerase III in the common head cabbage in the molecular breeding of the cabbage refers to: under salt stress, BoNR8 long noncoding RNA may inhibit seed germination by affecting AtRAVI expression. The rest is the same as the third embodiment.

The sixth specific implementation mode: the third difference between the present embodiment and the specific embodiment is that: the application of the BoNR8 long non-coding RNA transcribed by the RNA polymerase III in the common head cabbage in the molecular breeding of the cabbage refers to: in the presence of ABA, the BoNR8 long non-coding RNA reduces the sensitivity of germinating seeds to ABA by influencing gene expression in ABA signals. The rest is the same as the third embodiment.

The invention is not limited to the above embodiments, and one or a combination of several embodiments may also achieve the object of the invention.

In order to determine the sequence of AtR8 lncRNA homologues in common head cabbage, the present invention uses specific primers (primer 1: AAAGGACTTGCCCACATCCC; primer 2: GCGGACTACGAGACCGTTAT) from AtR8 lncRNA upstream and downstream sequences in the Arabidopsis genome to amplify and sequence sequences about 1306bp long sequences from the common head cabbage genome, based on the characteristic that Arabidopsis thaliana has high similarity to the common head cabbage genome sequence (FIG. 1). The highly conserved USE, TATA sequences and 4 consecutive T base terminator sequences are present in this sequence, indicating that this sequence has RNA polymerase III transcription activity. In addition, the downstream sequence of the TATA sequence was highly similar to the AtR8 incrna sequence (fig. 2), indicating that the present invention has cloned a AtR8 incrna homolog from the common head cabbage genome.

Next, the present inventors performed primer extension analysis of the transcription product of the cell-free system and the whole RNA of the seedlings of Brassica oleracea to determine that the 5' end of the AtR8 lncRNA homologue is A at the 25 th base position downstream of the TATA sequence (FIGS. 3 and 5). The 3 'RACE analysis was used to determine the position of the T residue at the 3' end of the terminator (FIGS. 4 and 5). Thus, the AtR8 incrna homologue in common head cabbage was 272 nucleotides in length (fig. 5), its 80% sequence was identical to AtR8 incrna (fig. 2), and no long ORF existed in the transcribed region, its similar sequence was not found in previously published DNA and protein sequences. Therefore, we judged it to be a new long noncoding RNA transcribed by RNA polymerase III in Brassica oleracea and named it BoNR8 lncRNA. RNAlogo predicted that BoNR8 lncRNA can form a stem-loop secondary structure with very low free energy (dG-82.71) (fig. 6).

We have studied the transcriptional properties of the BoNR8 lncRNA using the tobacco cell-free transcription system. The low concentration of a-amanitin (0.5 μ g) addition did not affect BoNR8 incrna (figure 7 No. 4) and AtR8 incrna transcription (figure 7 No. 6), but completely inhibited RNA polymerase II-dependent U2 snRNA transcription (figure 7 No. 2), indicating that BoNR8 incrna was transcribed by RNA polymerase III and not RNA polymerase II.

In order to analyze the copy number of the BoNR8 lncRNA in the genome of the common head cabbage, the genomic DNA of the common head cabbage was digested with EcoRI, HindIII and SacI respectively (three restriction sites are not present in the transcribed region of the BoNR8 lncRNA), hybridized with a Dig-DNA probe containing the USE, TATA sequences and the whole transcribed region of the BoNR8 lncRNA, and Southern blot analysis showed that there was only a single band in the digested genomic DNA (FIG. 8), which is very similar to the result of AtR8 lncRNA with a single copy number in the genome of Arabidopsis thaliana (FIG. 9), indicating that the BoNR8 lncRNA in the genome of the common head cabbage is a long noncoding RNA with a single copy.

The BoNR8 lncRNA gene of the invention can be obtained in the following way:

firstly, selecting common head cabbage seeds (cabbage seeds) (purchased from vegetable research institute of agricultural academy of sciences of Heilongjiang province), extracting and purifying genome DNA of common head cabbage seedlings by adopting an SDS method, detecting the DNA concentration by an ultraviolet spectrophotometer, and storing at-20 ℃;

cloning of long-chain non-coding RNA (BoNR8) gene in common head cabbage

We designed Xba I and Sac I cleavage site primers based on the full-length BoNR8 sequence to amplify the full-length BoNR8 incRNA sequence:

the primer sequences with Xba I and Sac I cleavage sites are as follows:

an upstream primer: (Xba I)TCTAGAAACGGGGTGGGCCCCAGGAG

A downstream primer: (Sac I)GAGCTCAAATTTGGGGGTGGGAGGGA

PCR amplification was performed using the Extaq enzyme, the PCR program was as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30sec, annealing at 58 ℃ for 30sec, and elongation at 72 ℃ for 30sec, and after 35 cycles, 10min at 72 ℃. PCR products with a full-length fragment of BoNR8 IncRNA were obtained by amplification (FIG. 10).

Thirdly, construction and sequence determination of over-expression vector

The PCR product was ligated to the intermediate vector PMD18-T (Takara Co.), transformed into E.coli competent cells (TOP10), plasmid was extracted with reference to the Kazakh reagent-CW 0500 kit, the short fragment obtained by double digestion with XbaI and SacI and the PBI121 over-expression vector obtained by double digestion with XbaI and SacI were ligated with T4DNA ligase, the PBI121-BoNR8 plasmid (FIG. 11) with the right double digestion with XbaI and SacI was sequenced to obtain the plasmid with the complete BoNR8 lncRNA sequence Seq ID No: 1, after electric shock transformation, agrobacterium infection inflorescence is carried out, and BoNR8 lncRNA overexpression plants are obtained.

The total length of the BoNR8 IncRNA obtained by the invention is 272 nucleotides, 5W box and 4 ABRE elements (ABA stress elements) exist in a promoter region, and BoNR8 IncRNA is expressed in a large amount in the epidermal layer of the root elongation region of the common head cabbage seed in the germination stage and responds to various stress environments in the germination stage in the form of long non-coding RNA. Di and the like find that the lncRNA sequence without pol A tail of Arabidopsis has an evolutionary conserved UCC salt stress sequence, and under the stress condition, the UCC salt stress sequence can be identified by regulating factors such as RNA binding protein and the like to cause the rearrangement of RNA molecular structure, show the stress response characteristic and regulate the growth and development of plants. This UCC salt stress-conserved sequence also exists in a dumbbell shape in the BoNR8 lncRNA sequence (fig. 2, 5, 6), with sequence conservation of up to 70% (fig. 2, 5). We speculate that this structural feature of BoNR8 lncRNA may be beneficial for exposing UCC stress sequences under salt stress conditions, facilitating its binding to regulatory factors. The sequence and secondary structure conformation characteristics of the BoNR8 lncRNA indicate that the BoNR8 lncRNA has important roles in plant growth and environmental stress.

The USE, TATA sequences, terminator and ORF sequences are boxed in FIG. 5; UCC salt stress conserved sequences are drawn. The transcribed region (272 nucleotides) is indicated in bold capital letters. Transcription initiation and termination sites numbered BoNR8 IncRNA.

FIG. 7 is a graph showing the confirmation of the RNA polymerase III transcription profile of BoNR8 IncRNA; adding low-concentration alpha-amanitin (0.5 mu g/ml) into a cell-free transcription system of the tobacco nuclear extract (+) or not, performing transcription reaction, performing electrophoresis detection on cDNA obtained by BoNR8-PE primer, and determining the in vitro transcription characteristic of the BoNR8 gene. The arabidopsis U2 snRNA and AtR8 IncRNA genes are indicated as RNA polymerase II and RNA polymerase III transcriptional trait controls, respectively.

The related functions of the BoNR8 lncRNA in the common head cabbage are verified:

1. biological characteristics of BoNR8 lncRNA in common head cabbage development process

The invention discovers that the BoNR8 lncRNA expresses characteristics in different stages of the growth of common head cabbage. The present invention relates to Martin et al, which extracts the low molecular RNA of dry seeds, imbibition seeds, germination seeds and 10-day seedlings of Brassica oleracea separately, and uses Dig-AtR8 nucleic acid probe to make northern blot analysis. The results showed that BoNR8 lncRNA was present in large amounts in germinating seed low-molecular RNA, in small amounts in seedling low-molecular RNA, and in dry seed low-molecular RNA no BoNR8 lncRNA (FIG. 12). This indicates that BoNR8 incrna is specifically expressed during the germination phase of common head cabbage seeds. Bulk in situ hybridization analysis further confirmed that BoNR8 lncRNA was expressed in the elongation region of germinating seed roots (fig. 13). In situ hybridization experiments transected the elongation zone of germinating seedroots confirmed in more detail that the BoNR8 lncRNA is mainly present in epidermal tissue in the elongation zone of germinating seedroots (fig. 14).

2. BoNR8 lncRNA response to various stress environments in the germination process of common head cabbage seeds

The present invention uses PLACE (plant cis-acting regulatory DNA elements) to predict cis-acting DNA regulatory elements (cis-acting regulatory DNA elements) present in 1000bp sequence upstream of BoNR8 IncRNA, and finds that 4 ABRE elements (ACGT motif) responding to ABA stress and 5W box (tgac) are present in this sequence (FIG. 1). The conserved salt stress UCC sequence (UCUUCUUCUUUA) also exists in this sequence, with similarity close to 70% (fig. 2, fig. 5, fig. 6). Based on the biological information analysis results, the invention analyzes the expression change of the BoNR8 lncRNA under various stress conditions in the germination process of common head cabbage seeds. Northern analysis showed that BoNR8 lncRNA was induced after 1 day germination of seeds after 18h treatment with 150mM NaCL and 250mM manitol. BoNR8 lncRNA reached the first peak at 18h treatment with 150mM NaCI, and the 2 nd peak at 30h treatment (FIG. 15). The hormones IAA, NAA and 2.4D, ABA obviously induced the expression of BoNR8 lncRNA after the seeds are treated for 18h after germinating for 1 day. BoNR8 lncRNA rapidly peaked at 6h after 50. mu.M ABA treatment, indicating that it is a long noncoding RNA that responds earlier to ABA stress (FIG. 15). Under these stress treatments, BoNR8 lncRNA was not processed to form short ncrnas (fig. 16). At the same time, after the seeds which were imbibed for 2 days were subjected to the above various stresses for 24h, the expression of BoNR8 lncRNA was not affected (FIG. 17). These results indicate that BoNR8 lncRNA is a long noncoding RNA transcribed by RNA polymerase III in response to various stresses during germination of common head cabbage seeds.

FIG. 15 is a photograph showing the results of abiotic stress responses of BoNR8 IncRNA; cabbage seeds germinating for 1 day are respectively exposed to stress environments of 150mM NaCl, 250mM mannitol, 10 mu MIAA, 10 mu MNAA, 10 mu M2,4-D and 50 mu MABA for 18 hours, stress treatment is carried out at different time by 150mM NaCl and 50 mu M ABA, low molecular RNA is extracted and hybridized with AtR 8-nucleic acid probe, and Northern blot analysis is carried out. Ethidium bromide stained tRNA was the loading control.

FIG. 20 is a plot of germination rates of seeds of BoNR8 overexpressing Arabidopsis; the germination rate test of BoNR8 over-expressed seeds comprises sowing seeds on 1/2MS culture medium, transferring to 16-hour light/8-hour dark condition at 22 ℃ after absorbing and swelling for 72 hours at 4 ℃ in dark condition, and counting the germination rate of several seeds at the designated time point. Each data represents the mean ± standard error of triplicate experiments with 30 seeds.

FIG. 22 is a histogram comparing the lengths of primary roots of BoNR8 overexpressing Arabidopsis; primary root length comparison experiment the primary root growth length within 7 days was measured after transferring 6 seedlings germinated on 1/2MS medium for 3 days to 1/2MS medium and vertically culturing for 7 days. Asterisks indicate that the primary root length of BoNR8 overexpressing Arabidopsis, as determined by the t-test, is statistically significantly different compared to the wild type: p < 0.01.

The function of BoNR8 lncRNA of the invention was verified by the following assay:

1. overexpression of BoNR8 lncRNA influences normal growth and development of Arabidopsis thaliana

At present, no long noncoding codes involved in seed germination have been reported. The results show that BoNR8 lncRNA is abundantly expressed in the epidermal layer of the elongation zone of the germinating seed roots and responds to various environmental stresses. It is of great importance to determine whether the BoNR8 lncRNA plays a role in seed germination and stress.

Making knockout mutants and transgenic common head cabbage plants is a technical difficulty, so we made BoNR8 overexpression Arabidopsis, T3 homozygous 1#, 2# and 3# were selected (FIG. 18, FIG. 19) and analyzed the function of BoNR8 lncRNA in Arabidopsis. When seeds germinated on 1/2MS medium, overexpression of BoNR8 lncRNA reduced the germination rate of Arabidopsis seeds, i.e., 57% of wild type seeds germinated on day 1 of germination, but less than 25% of BoNR8 lncRNA overexpressed seeds (FIG. 20). At the same time, BoNR8 lncRNA overexpression inhibited primary root growth (fig. 21, 22) and fruit clamp development (fig. 23, 24) in arabidopsis seedlings. This indicates that under normal growth conditions, BoNR8 lncRNA acts as a negative regulator inhibiting arabidopsis seed germination, seedling root and silique growth.

2. Overexpression of BoNR8 lncRNA influences germination of Arabidopsis seeds under high-salt and high-concentration ABA stress

To confirm whether BoNR8 incrna plays a role in stress responses, we first analyzed wild type and BoNR8 incrna for germination of arabidopsis thaliana seeds under salt stress conditions. When seeds germinated on 1/2MS containing 50mM NaCl, the germination rates of wild type and BoNR8 overexpressing seeds were similar; however, at NaCI concentrations above 100mM, the germination rate of BoNR8 overexpressing seeds was significantly lower than that of the wild type (fig. 25-29). These results indicate that overexpression of BoNR8 lncRNA reduces resistance to high salt in germinated seeds of arabidopsis thaliana.

It is well known that salt stress induces ABA accumulation and inhibits seed germination. To reveal whether overexpression of BoNR8 under high salt stress inhibited seed germination due to accumulation of endogenous ABA caused by high salt stress, the present invention synthesizes an ABA inhibitor, sodium tungstate (Na)₆WO₄) Endogenous ABA synthesis under saline stress was blocked using a membrane. As shown in FIGS. 30 and 31, 0.1mM Na₆WO₄Addition did not restore the germination rate of BoNR8 overexpressing seeds on 1/2MS culture containing 150mM and 200mM NaCl. This indicates that ABA accumulation resulting from high salt stress is not the cause of inhibition of germination of BoNR8 overexpressing seeds under high salt stress. Therefore, the BoNR8 lncRNA inhibits the germination of Arabidopsis seeds under high salt stress probably by other means than ABA signal.

The results of the previous analysis show that BoNR8 lncRNA responds to ABA stress in the germination process of common head cabbage seeds (FIG. 15), and therefore, we investigate the germination condition of BoNR8 overexpression Arabidopsis seeds under ABA stress. When germinated on 1/2MS containing low concentration ABA (0.5-2.0. mu.M), the germination rate of BoNR8 over-expressed seeds was similar to that of 1/2MS (FIGS. 32-36); however, when cultured on 1/2MS containing high concentration ABA, particularly 75 μ M and 100 μ MABA, the germination rate of BoNR8 over-expressed seeds is obviously improved and even better than that of wild type (FIG. 41, FIG. 42). This indicates that overexpression of BoNR8 lncRNA results in insensitivity of arabidopsis germinating seeds to high concentrations of ABA.

The data reveal that BoNR8 lncRNA is involved as a negative regulator in the germination of arabidopsis thaliana seeds under high salt and high concentration ABA stress.

3. Influence of overexpression of BoNR8 lncRNA on ABA response gene in Arabidopsis under normal germination and high-concentration ABA stress conditions

Currently, significant progress has been made in the study of ABA signaling pathway genes that regulate seed germination and early seedling development.

According to the invention, BoNR8 lncRNA responds to ABA stress and reduces the sensitivity of the germinated seeds to high-concentration ABA in the germination stage of the cabbage seeds (figure 15, figure 41 and figure 42), and the promoter region of the cabbage seeds comprises 4 ABREs (figure 1).

To determine the effect of BoNR8 lncRNA on ABA responsive genes, the present invention first analyzed the changes in expression of important genes in wild type 15h after 75 μ MABA treatment and 9 ABA signaling pathways in BoNR8 overexpressing arabidopsis germinating seeds. RT-PCR results showed that under normal germination conditions, in BoNR8 overexpressing Arabidopsis germinated seeds, RD29A (FIG. 43) and SnRK2.3 (FIG. 44) mRNA levels were higher than the wild type, and AtRAV1 (FIG. 45) mRNA levels were more than 2-fold higher than the wild type, whereas ABI3 (FIG. 49), ABI5 (FIG. 50), EM1 (FIG. 46) and EM6 (FIG. 47) mRNA levels were lower than the wild type. However, in ABA-treated BoNR8 overexpressing germinated seeds, ABA-induced mRNA levels of RD29A (fig. 43), WRKY6 (fig. 48), ABI3 (fig. 49) and ABI5 (fig. 50) were higher than wild-type, whereas snrk2.3 (fig. 44) mRNA levels were lower than wild-type.

4. Influence of overexpression of BoNR8 lncRNA on ABA response gene in Arabidopsis under high salt condition

Previous studies demonstrated that salt stress leads to ABA accumulation and activation of ABA signaling in plants and regulates seed germination. The present inventors have found the expression of these genes after 1 day germination of wild type and BoNR8 overexpressing seeds treated with 150mM NaCl for 15 hours. RT-PCR results showed that NaCl-treated BoNR8 overexpressed the RD29A (FIG. 43) and SnRK2.3 (FIG. 44) mRNA levels in germinated seeds lower than wild type; the AtRAV1 (fig. 45) mRNA levels were still more than 2-fold higher than the wild type. The expression of other genes was similar to normal culture conditions.

5. Effect of overexpression of BoNR8 lncRNA on ABA-responsive genes in Arabidopsis seedlings under Normal conditions

Similarly, BoNR8 overexpression under normal conditions for 7 days and expression of these genes in wild type arabidopsis seedlings were also examined. As shown in fig. 43 to 52, snrk2.2 (fig. 51) and snrk2.3 (fig. 44) mRNA levels were significantly higher than that of germinated seeds. In contrast, WRKY6 (fig. 48), ABI5 (fig. 50) and EM1 (fig. 46) levels were lower than germinated seeds. Expression of other genes is similar in germinating seeds.

The invention discovers that BoNR8 lncRNA may play an important role in normal development of Arabidopsis and high-salt stress seed germination by influencing the expression of AtRAV 1; the mechanism is as follows:

AtRAV1 is an ABI3/VP1(RAV) transcription factor of Arabidopsis thaliana, which contains two plant-specific B3 and AP2DNA binding domains. The B3 domain is mainly found in ABA and auxin response factors, and the AP 2-containing protein is a regulator of various developmental and stress responses. AtRAV1 is mainly expressed in the early stages of seed germination and seedling development, its expression is induced by callus and low temperature, and its expression is inhibited by brassinosteroids, ABA, drought and NaCI. Under normal conditions, over-expression of AtRAV1 in Arabidopsis inhibits expression of ABI3-ABI5-EM1-EM6 and inhibits seed germination. Under high salt stress conditions, over-expression of AtRAV1 reduced Arabidopsis seed germination in an ABA-independent manner, while the AtRAV1 mutant increased seed germination rate. Furthermore, whereas AtRAV1 overexpression hindered the growth of lateral roots and rosette leaves, the AtRAV1 mutant exhibited an earlier flowering phenotype, indicating that AtRAV1 regulates plant development.

The present study shows that under normal conditions, the overexpression of the AtRAV1 mRNA in Arabidopsis thaliana germinated seeds and seedlings by the BoNR8 lncRNA (FIG. 45), reduces the expression of ABI3 (FIG. 49), ABI5 (FIG. 50), EM1 (FIG. 46) and EM6 (FIG. 47), and inhibits seed germination (FIG. 20), primary roots (FIGS. 21 and 22) and silique development (FIGS. 23 and 24).

The research of the invention shows that the BoNR8 lncRNA sequence contains a conserved NaCI stress UCC sequence; cabbage seed germination stage BoNR8 lncRNA induced by 150mM NaCl (fig. 15); under high salt conditions (100-200 mM NaCl), overexpression of BoNR8 induces expression of AtRAV1 mRNA (FIG. 45), reduces expression of ABI3 (FIG. 49), ABI5 (FIG. 50), EM1 (FIG. 46) and EM6 (FIG. 47), and reduces germination rate of BoNR8 overexpression Arabidopsis seeds in an ABA independent manner and is lower than that of wild type seeds (FIGS. 25-31).

These results are highly consistent with the results of AtMYC1 overexpression in Arabidopsis. We speculate that BoNR8 lncRNA may play an important role in arabidopsis development and high salt stress response, mainly by influencing the expression of AtRAV1 (fig. 52).

According to the invention, the research shows that BoNR8 lncRNA is a high-concentration ABA signal which is used as a negative regulator and participates in regulating seed germination, and the action mechanism is as follows:

in recent years, many genes of ABA receptor PYR/PYL/RCAR and the downstream thereof which influence the germination of Arabidopsis seeds have been discovered, but the mechanism of ABA regulation of seed germination and early seedling growth is not completely understood.

Two SNF 1-related protein kinase 2(snrk2.2 and snrk2.3) genes are predominantly expressed in seeds and induced by high ABA. Under ABA stress conditions, the ABA inhibits the activity of AtRAV1 protein to regulate seed germination by improving the activity of ABI5, ABF (ABRE binding factor) and EEL protein. AtEM1 and AtEM6 are two important Late Embryo Abundant (LEA) protein genes. ABA strongly induces ABI5 expression, ABI5 activates ABI3, AtEM1 and AtEM6 promoters through being combined with the promoters to activate the expression, and inhibits seed germination and early growth of seedlings

In addition to the above-mentioned several well-studied basic members, several new members involved in ABA signaling in seed germination were also discovered. WRKY is the largest transcription factor family in plants, and contains conserved WRKY structural domain and zinc finger motif, and regulates target gene expression by combining with W-box (T) TGAC (C/T) motif in target gene promoter. Recently, several WRKY transcription factors have been found to be involved in the ABA signaling pathway of seed germination. In an ABA signaling pathway, AtWRKY6 is located at the upstream of AtRAV1, can directly down-regulate AtRAV1 expression and directly up-regulate SnRK2.3, SnRK2.6, EM1 and EM6 expression. Although the ABI3 and ABI5 promoters contained Wbox, AtWRKY6 was unable to directly regulate their expression. In contrast, AtRAV1 can down-regulate ABI3 and ABI5 expression by binding directly to ABI3 and ABI5 promoters. AtWRKY41 can control seed dormancy by directly modulating ABI3 expression. AtWRKY18, AtWRKY40 and AtWRKY60 are negative regulators in an ABA signal path for regulating seed germination, and knockout mutants of the three genes show ABA hypersensitive phenotype and inhibit seed germination and post-germination growth. At the seed germination and late growth stage, the AtWRKY63 and AtWRKY2 knockout mutants were hypersensitive to exogenous ABA. Recently, a unique high concentration ABA signaling pathway has been discovered. In high concentration ABA stress, AtWRKY40 is recruited from the nucleus to the cytoplasm and promotes the ABAR-AtWRKY40 interaction (ABAR is a chloroplast/plastid protein that functions as a receptor for ABA in arabidopsis). ABAR reduces the inhibition of ABI5 gene and regulates seed germination by inhibiting AtWRKY40 expression. These results indicate that WRKY transcription factors play an important role in ABA signaling in seed germination and early seedling growth.

The present study showed that 5W-boxes and 4 ABREs were present in the 5' upstream region of the BoNR8 IncRNA gene (FIG. 1). During germination of common head cabbage seeds, high concentration ABA (50 μ M) induced BoNR8 lncRNA expression (fig. 15). Low concentration ABA treatment did not affect BoNR8 overexpressing arabidopsis seed germination (fig. 32 to 36), but under high concentration ABA (75-100 μ M) stress BoNR8 overexpressing seeds showed ABA insensitive phenotypes promoting germination (fig. 41, 42), and BoNR8 overexpressing arabidopsis germinating seeds all had higher AtWRKY6 (fig. 48), ABI3 (fig. 49) and ABI5 (fig. 50) than wild type.

Previous researches show that the EM1 promoter contains one WRKY binding motif (W-box), two promoters of SnRK2.3 and three promoters of Em6, and WRKY6 can directly induce the expression of SnRK2.3, Em1 and Em6, but does not regulate the expression of SnRK2.2.

In the invention, in the high-concentration ABA stress treated BoNR8 IncRNA overexpression germinating seeds, AtWRKY6 is accumulated in a large amount (figure 48), while SnRK2.3 is induced in a large amount (figure 44), and the expression of SnRK2.2 is not changed (figure 51), which is consistent with the above research. We speculate that BoNR8 lncRNA may be involved in high-concentration ABA signal for regulating seed germination, namely under high-concentration ABA treatment, BoNR8 lncRNA regulates seed germination by regulating expression of important genes in ABA signal, such as WRKY family genes (FIG. 52).

Based on all the above results, we speculate that under high-concentration ABA stress, BoNR8 lncRNA regulates arabidopsis seed germination by participating in high-concentration ABA signaling. Under normal and salt stress, BoNR8 lncRNA was involved in the AtRAV 1-mediated process of arabidopsis seed germination and shoot root growth, mainly by affecting AtRAV1 expression (fig. 52).

Claims

1. BoNR8 long noncoding RNA transcribed by RNA polymerase III in common head cabbage is characterized in that the nucleotide sequence thereof is shown in sequence table Seq ID No: 1 is shown.

2. The use of BoNR8 long noncoding RNA transcribed by RNA polymerase III in common head cabbage according to claim 1, characterized in that it is used for molecular breeding of cabbage.

3. The use of the BoNR8 long noncoding RNA transcribed by RNA polymerase III in Brassica oleracea according to claim 2, wherein the BoNR8 long noncoding RNA transcribed by RNA polymerase III in Brassica oleracea is used for molecular breeding of Brassica oleracea: under normal culture conditions, BoNR8 long non-coding RNA inhibits seed germination, seedling root growth, and silique growth by affecting AtRAVI expression.

4. The use of the BoNR8 long noncoding RNA transcribed by RNA polymerase III in Brassica oleracea according to claim 2, wherein the BoNR8 long noncoding RNA transcribed by RNA polymerase III in Brassica oleracea is used for molecular breeding of Brassica oleracea: in the presence of ABA, the BoNR8 long non-coding RNA reduces the sensitivity of germinating seeds to ABA by influencing gene expression in ABA signals.