CN108486062A

CN108486062A - A kind of Chimeric antigen receptor immunocyte and its preparation method and application

Info

Publication number: CN108486062A
Application number: CN201810245283.4A
Authority: CN
Inventors: 李鹏; 秦乐; 魏新茹; 赵若聪; 程琳; 姚瑶
Original assignee: Shenzhen In Vivo Biological Medicine Technology Co Ltd
Current assignee: Shenzhen In Vivo Biological Medicine Technology Co Ltd
Priority date: 2018-03-23
Filing date: 2018-03-23
Publication date: 2018-09-04

Abstract

The present invention provides a kind of Chimeric antigen receptor immunocytes and its preparation method and application, the extracellular antigen binding domain of the anti-PD L1 Chimeric antigen receptors of Chimeric antigen receptor immunocyte surface expression, the anti-PD L1 Chimeric antigen receptors includes 1 signal peptide of 1 extracellular fragments of PD and PD.The present invention passes through in the anti-PD L1 Chimeric antigen receptors of Chimeric antigen receptor immunocyte surface expression, avoid because immunocyte surface PD 1 and tumor cell surface PD L1 in conjunction with due to the immunocyte that causes it is exhausted, it realizes and the inhibition signal that 1 accesses of PD cause is changed into immune cell activation signal, significantly enhance killing ability of the Chimeric antigen receptor immunocyte to tumour cell.

Description

A kind of Chimeric antigen receptor immunocyte and its preparation method and application

Technical field

The invention belongs to biotechnology, it is related to a kind of Chimeric antigen receptor immunocyte and preparation method thereof and answers With.

Background technology

Chimeric antigen receptor T cell (Chimeric Antigen Receptor T-Cell Immunotherapy, CAR- T) immunotherapy is the immunotherapy method of blood bome tumor popular in recent years, mainly passes through Chimeric antigen receptor T cell (CAR-T) identification and killing of cancer cell antigen are carried out.In recent years, CAR-T immunotherapies obtain pole in multiple clinical tests Good therapeutic effect.According to the report, by CAR-T immunotherapies, 90% Patients With Acute Lymphoblastic Leukemia is delayed completely Solve (S.L.Maude et al.Chimeric antigen receptor T cells for sustained remissions in leukemia.Engl.J.Med.,371,1507-1517(2014)).Target CD19 antigen therapy bone-marrow-derived lymphocyte leukaemia Inspiring with the success of lymthoma, food and medicine surveillance authority of the U.S. ratifies Novartis and lucky treatment leukaemia in succession within 2017 CAR-T cell products list.

Lung cancer is a kind of common pulmonary malignant tumour, and morbidity and mortality shelter has first of malignant tumour, nearly 50 years To have become one of the cancer types of most serious in global range.Non-small cell lung cancer (non-small-cell lung Cancer, NSCLC) the 85% of lung cancer total number of persons is accounted for, it predominantly performs the operation, put for the therapeutic scheme of non-small cell lung cancer at present Treatment, chemotherapy, Chinese medicine treatment and targeted therapy.China also fails to the regular tumor screening of universal resident comprehensively, about 80% lung cancer Patient has been enter into late period when making a definite diagnosis, and misses the optimal treatment phase, and cure rate is low；In addition, non-small cell lung cancer is for radiotherapy, change The sensibility for the treatment of is poor, and therapeutic effect is not good enough.It is only used for that there are above-mentioned for the magnetic target therapy of the gene mutations such as EGFR, ALK The patients with lung cancer of gene mutation, audient's number is few, and patient easy tos produce drug resistance.Therefore, non-small cell lung cancer needs more Potent treatment means.

Liver cancer (hepatocellular carcinoma, HCC) is a kind of common malignant tumour, because its death rate is high, The course of disease is short, is referred to as " king of cancer ".Treatment liver cancer most efficient method is operation, can for the patient that can not be performed the operation Using local chemotherapy embolism and Interventional radiology.Nevertheless, 5 years survival rates only 10% of liver cancer patient, exploration more has The treatment means of effect are extremely urgent.

Success of the CAR-T immunotherapies in terms for the treatment of leukaemia, let us associate naturally be applied to NSCLC and The treatment of HCC.Using CAR-T Immuno Suppressive Therapy NSCLC and HCC, the tumor cell surface antigen that may be used includes mesothelium Plain (Mesothelin, meso), prostate stem cell antigen (prostate stem cell antigen, PSCA), mucoprotein (mucin 1, MUC1), ErbB-2 (human epidermal receptor 2, HER2), phosphatidyl Inositol proteoglycans (glypican 3, GPC3).

Carry out the multinomial CAR-T immunotherapy clinical tests for above-mentioned target spot at present, however do not obtain effective progress, It is primarily due to solid tumor cell and immunocyte surface can 1 (programming of expression cell programmed death ligand Death ligand 1, PD-L1) and apoptosis ligand 2 (programming death ligand 2, PD-L2), PD-L1 and PD-L2 can be with the apoptosis receptor 1 (programming death 1, PD-1) of CAR-T cell surfaces In conjunction with initiation intracellular inhibition signal path causes CAR-T cells exhausted, loses the killing ability to tumour.

For the antibody drug of PD-1 accesses effect of attracting attention is achieved in the therapeutic process of entity tumor this has also been confirmed One is theoretical.However the antibody drug taken merely for PD-1 accesses is by infiltration to the T cell in tumor microenvironment (Tumor infiltration T cell, TIL) comes killing tumor cell, the limited amount of TIL, it is difficult to which acquisition is preferably controlled Therapeutic effect, in addition, antibody drug therapeutic scheme needs lasting medication, after withdrawal, T cell can be exhausted immediately, the program without Method fundamentally reverses the destiny of T cell.

Therefore, CAR-T is transformed so that it can which specific recognition and killing tumor cell, are of great significance.

Invention content

In view of the deficiencies of the prior art, the present invention provides a kind of Chimeric antigen receptor immunocyte and preparation method thereof and answers With the inhibition signal that PD-1 accesses cause is changed into activation signal by the Chimeric antigen receptor immunocyte, is significantly increased The identification and killing ability of Chimeric antigen receptor immunocyte to tumour cell.

For this purpose, the present invention uses following technical scheme：

In a first aspect, the present invention provides a kind of Chimeric antigen receptor immunocyte, the Chimeric antigen receptor is immune thin Cellular surface expresses anti-PD-L1 Chimeric antigen receptors, and the extracellular antigen binding domain of the anti-PD-L1 Chimeric antigen receptors includes PD-1 Extracellular fragment and PD-1 signal peptides.

In the present invention, by the anti-PD-L1 Chimeric antigen receptors of Chimeric antigen receptor immunocyte surface expression, avoiding Because immunocyte surface PD-1 and tumor cell surface PD-L1 in conjunction with due to the immunocyte apoptosis that causes, realize and lead to PD-1 The inhibition signal of pass hair is changed into immune cell activation signal, has fundamentally reversed Chimeric antigen receptor immunocyte in reality Exhausted state in body tumour significantly enhances killing ability of the Chimeric antigen receptor immunocyte to tumour cell.

In the present invention, the extracellular antigen binding domain using PD-1 as anti-PD-L1 Chimeric antigen receptors is affine to PD-L1 Power is moderate, not only ensure that effective killing of the Chimeric antigen receptor immunocyte to tumour cell, but also reduce chimeric antigen Side effect of the immune cell of the reviever to normal cell.

According to the present invention, PD-L1 antibody has the function of combining PD-L1, can be as anti-PD-L1 Chimeric antigen receptors Extracellular antigen binding domain, but PD-L1 antibody is artificial antibody, it is strong to PD-L1 affinity compared with PD-1, not only to tumour Cell has very strong lethal effect, and there is certain lethal effect, the Chimeric antigen receptor of preparation to exempt from normal cell Epidemic disease cell has apparent side effect to normal cell.

Preferably, the nucleic acid sequence of the PD-1 extracellular fragments is as shown in SEQ ID NO.1；

Nucleic acid sequence is shown in the SEQ ID NO.1：

ccaggatggttcttagactccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccga aggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagcc ccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtc acacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctg tggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacagagagaaggg cagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtg.

Preferably, the nucleic acid sequence of the PD-1 signal peptides is as shown in SEQ ID NO.2；

Nucleic acid sequence is shown in the SEQ ID NO.2：

atgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaactgggctggcgg.

Preferably, the transmembrane region of the anti-PD-L1 Chimeric antigen receptors includes PD-1 cross-film sections.

Preferably, the nucleic acid sequence of the PD-1 cross-films section is as shown in SEQ ID NO.3；

Nucleic acid sequence is shown in the SEQ ID NO.3：

gttggtgtcgtgggcggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatc.

Preferably, the intracellular signal transduction area of the anti-PD-L1 Chimeric antigen receptors includes Toll-like receptor 1 or Toll-like Receptor 2, preferably Toll-like receptor 2.

Toll-like receptor is to participate in a kind of key protein molecule of nospecific immunity (innate immunity), and connection is non- The bridge of specific immunity and specific immunity.Toll-like receptor can identify having from microorganism in the innate immunity The molecule of conserved structure, when the physical barriers of microorganism breakthrough body, such as when skin, mucous membrane, Toll-like receptor can identify They simultaneously activate body to generate immune cell responses.Toll-like receptor 1 is distributed mainly on monocyte, polymorphonuclear cell, T, B leaching Various kinds of cell, the Toll-like receptor 2 such as bar cell and NK cells are only distributed on marrow source property cell (such as mononuclear macrophage).It is obtaining Property it is immune in, Toll-like receptor has the function of identifying antigen, for example, dendritic cells can by Toll-like receptor identification LPS, GpG-DNA, peptide glycan, lipoprotein and cell wall constituent of mycobacterium etc. have the molecule of PAMP, provide acquired immunity Costimulatory signal.In addition, Toll-like receptor can by generated after activation IL-1 β, IL-6 and TNF and chemotactic type cell because Son generates regulating and controlling effect to Acquired immune response.

In the present invention, the Toll-like receptor in the intracellular signal transduction area significantly enhances Chimeric antigen receptor to immune thin The stimulation of born of the same parents and activation capability enhance the killing ability of Chimeric antigen receptor immunocyte, the Toll in intracellular signal transduction area Sample receptor and the PD-1 of extracellular antigen binding domain cooperate, and not only realize Efficient killing effect of the immunocyte to tumour cell, And reduce side effect to normal cell.

Preferably, the nucleic acid sequence of the Toll-like receptor 1 is as shown in SEQ ID NO.4；

Nucleic acid sequence is shown in the SEQ ID NO.4：

aacatacccttagaagaactccaaagaaatctccagtttcatgcatttatttcatatagtgggcacgattctttctg ggtgaagaatgaattattgccaaacctagagaaagaaggtatgcagatttgccttcatgagagaaactttgttcctg gcaagagcattgtggaaaatatcatcacctgcattga gaagagttacaagtccatctttgttttgtctcccaactttgtccagagtgaatggtgccattatgaactctactttg cccatcacaatctctttcatgaaggatctaatagcttaatcctgatcttgctggaacccattccgcagtactccatt cctagcagttatcacaagctcaaaagtctcatggccaggaggacttatttggaatggcccaaggaaaagagcaaacg tggccttttttgggctaacttaagggcagccattaatattaagctgacagagcaagcaaagaaa.

Preferably, the nucleic acid sequence of the Toll-like receptor 2 is as shown in SEQ ID NO.5；

Nucleic acid sequence is shown in the SEQ ID NO.5：

caggccaaaaggaagcccaggaaagctcccagcaggaacatctgctatgatgcatttgtttcttacagtgagcggga tgcctactgggtggagaaccttatggtccaggagctggagaacttcaatccccccttcaagttgtgtcttcataagc gggacttcattcctggcaagtggatcattgacaatatcattgactccattgaaaagagccacaaaactgtctttgtg ctttctgaaaactttgtgaagagtgagtggtgcaagtatgaactggacttctcccatttccgtctttttgatgagaa caatgatgctgccattctcattcttctggagcccattgagaaaaaagccattccccagcgcttctgcaagctgcgga agataatgaacaccaagacctacctggagtggcccatggacgaggctcagcgggaaggattttgggtaaatctgaga gctgcgataaagtcc.

Preferably, the intracellular signal transduction area of the anti-PD-L1 Chimeric antigen receptors further includes 41BB.

Preferably, the nucleic acid sequence of the 41BB is as shown in SEQ ID NO.6；

Nucleic acid sequence is shown in the SEQ ID NO.6：

atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatccca.

Preferably, the anti-PD-L1 Chimeric antigen receptors are connected by PD-1 signal peptides, PD-1,41BB and Toll-like receptor 2 Composition.

Preferably, the anti-PD-L1 Chimeric antigen receptors are：PD-1 signal peptides-PD-1-41BB-Toll 2.

In the present invention, the anti-PD-L1 Chimeric antigen receptors use PD-1 as extracellular antigen binding domain, by PD-1 accesses The inhibition signal of initiation is changed into immune cell activation signal, has fundamentally reversed Chimeric antigen receptor immunocyte in entity Exhausted state in tumour coordinates Toll-like receptor, significantly enhances Chimeric antigen receptor immunocyte and killed to tumour cell Hinder ability, and reduces the killing ability to normal cell.

Preferably, the auxiliary of the anti-PD-L1 Chimeric antigen receptors of auxiliary is also expressed on Chimeric antigen receptor immunocyte surface Help Chimeric antigen receptor.

In the present invention, the extracellular antigen binding domain of the auxiliary Chimeric antigen receptor includes anti-derived from tumor cell surface The single-stranded variable region of former monoclonal antibody specific not only has the work of enhancing immunocyte specific recognition tumour cell With, and can immune cell activated, realize killing to tumour cell.

In the present invention, auxiliary Chimeric antigen receptor guiding immunocyte specific recognition tumour cell, immune cell activated, Auxiliary Chimeric antigen receptor cooperation under, anti-PD-L1 Chimeric antigen receptors can more accurately with the PD- of tumor cell surface L1 is combined, and avoids the killing to normal cell.

Preferably, the auxiliary Chimeric antigen receptor includes anti-Mesothelin Chimeric antigen receptors, anti-PSCA inosculating antibodies Any one in original receptor, anti-MUC1 Chimeric antigen receptors, anti-HER2 Chimeric antigen receptors or resisting GPC 3 Chimeric antigen receptor.

In the present invention, mesothelin (Mesothelin, meso), prostate stem cell antigen (prostate stem cell Antigen, PSCA), mucoprotein (mucin 1, MUC1), ErbB-2 (human epidermal Receptor 2, HER2) and glypican (glypican 3, GPC3) be that the common surface of tumour cell is anti- Original, including the immunocyte of corresponding Chimeric antigen receptor has stronger identification and killing ability to tumour cell.

Preferably, the extracellular antigen binding domain of the anti-Mesothelin Chimeric antigen receptors includes Mesothelin single-stranded Variable region.

Preferably, the nucleic acid sequence of the single-stranded variable regions the Mesothelin is as shown in SEQ ID NO.7；

Nucleic acid sequence is shown in the SEQ ID NO.7：

tagaattcctgaggagacggtgaccgtggtcccttggccccagacgtccataccgtaatagtaagtcatcattcctc ttgcacagtaatacacagccgtgtcctcgggagtcacagagttcagctgcagggagaactggttcttggatgtgtct gggttgatgctcattcgacttttcacagatactgcatagtcgttataccacttggacctgtagtatgtccttcccag ccactcaaggcctctcgatggggactgcctgatccagttccaagtagcactgttgctagagacactgtccccggaga tggcacaggtgagtgagagggtctgcgagggcgtcacgagtcctggacctgactgctgcagctgtacctggctggat ccggtggcggtggcagcggcggtggtggttccggaggcggcggttctcagcctgtgctgactcagtcgtcttccctc tctgcatctcctggagcatcagccagtctcacctgcaccttgcgcagtggcatcaatgttggtccctacaggatata ctggtaccagcagaagccagggagtcctccccagtatctcctgaactacaaatcagactcagataagcagcagggct ctggagtccccagccgcttctctggatccaaagatgcttcggccaatgcaggggttttactcatctctgggctccgg tctgaggatgaggctgactattactgtatgatttggcacagcagcgctgctgtgttcggaggaggcacccaactgac cgtcctctccggaattctagaacaacagggt.

Preferably, the extracellular antigen binding domain of the anti-PSCA Chimeric antigen receptors includes the single-stranded variable regions PSCA.

Preferably, the nucleic acid sequence of the single-stranded variable regions the PSCA is as shown in SEQ ID NO.8；

Nucleic acid sequence is shown in the SEQ ID NO.8：

gacattcagctgacccaatctccaagctctttgtccgcctctgtgggggatagggtcaccatcacctgcagtgccag ttcaagtgtaagattcattcactggtaccagcagaaaccaggaaaagctcccaaaagactcatctatgacacatcca aactggcttctggcgtcccttctaggttcagtggctccgggtctgggacagacttcaccctcaccattagcagtctg cagccggaagatttcgccacctattactgtcagcagtggagtagtagcccattcacgttcggacaggggaccaaggt ggagataaaaggcagtactagcggcggtggctccggaggcggctccggaggtggcggcagctcagaggttcagctgg tggagtctgggggtggccttgtgcagccagggggctcactccgtttgtcctgcgcagcttctggcttcaacattaaa gactactatatacactgggtgcgtcaggcccctggtaagggcctggaatgggttgcatggattgatcctgagaatgg tgacactgaatttgtcccgaagttccagggccgtgccactataagcgcagacacatccaaaaacacagcctacctgc agatgaacagcctgcgtgctgaggacactgccgtctattattgtaaaacgggggggttctggggtcaaggaaccctg gtcaccgtctcgagcgagcccaaatcttgtgacaaaactcacacatgcccaccgtgc.

Preferably, the extracellular antigen binding domain of the anti-MUC1 Chimeric antigen receptors includes the single-stranded variable regions MUC1.

Preferably, the nucleic acid sequence of the single-stranded variable regions the MUC1 is as shown in SEQ ID NO.9；

Nucleic acid sequence is shown in the SEQ ID NO.9：

gatatcgttgtgactcaggaatctgcactcaccacatcacctggtgaaacagtcacactcacttgtcgctcaagtac tggggctgttacaacaagtaactatgccaactgggtccaagaaaaaccagatcatttattcactggtctaataggtg gtaccaacaaccgagcaccaggtgttcctgccagattctcaggctccctgattggagacaaggctgccctcaccatc acaggggcacagactgaggatgaggcaatatatttctgtgctctatggtacagcaaccattgggtgttcggtggagg aaccaaactgactgtcctaggatccgagggtggctcaggatcgggtggatcaggctctggtggctcaggatcggagg tccagctgcagcagtcaggaggaggcttggtgcaacctggaggatccatgaaactctcctgtgttgcctctggattc actttcagtaactactggatgaactgggtccgccagtctccagagaaggggcttgagtgggttgctgaaattagatt gaaatctaataattatgcaacacattatgcggagtctgtgaaagggaggttcaccatctcaagagatgattccaaaa gtagtgtctacctgcaaatgaacaacttaagagctgaagacactggcatttattactgtacctttggtaactccttt gcttactggggccaagggaccacggtcaccgtctcctca.

Preferably, the extracellular antigen binding domain of the anti-HER2 Chimeric antigen receptors includes the single-stranded variable regions HER2.

Preferably, the nucleic acid sequence of the single-stranded variable regions the HER2 is as shown in SEQ ID NO.10；

Nucleic acid sequence is shown in the SEQ ID NO.10：

attctgatgacccagtctccagcaatcatgtctgcaatcatgtctgcatctccaggggagaaggtcaccatgacctg cagtgccagctcaagtgtaagttacatgcactggtaccagcagaagtcaggcacctcccccaaaagatggatttatg acacatccaaactggcttctggagtccctgctcgcttcagtggcagtgggtctgggacctcttactctctcacaatc agcagcatggaggctgaagatgctgccacttattactgccagcagtggagtagtaacccgctcacgttcggtgctgg gaccaagctggaaataaaaggtggctcaggatcgggtggatcaggctctggtggctcaggatcgggacctggcctgg cggcgccctcacagagcctgtccatcacatgcactgtctctgggttctcattaaccagctatgttataagttgggtt cgccagccaccaggaaagggtctggagtggcttggagtaatatggactggtggaggcacaaattataattcagctct caaatccagactgagcatcagcaaagacaactccaagagtcaagtttccttaaaaatgaacagtctgcaaactgatg acacagccaggtactactgtgccagcctttcctatgatggtttcgactactggggccaagggaccacggtcac.

Preferably, the extracellular antigen binding domain of the resisting GPC 3 Chimeric antigen receptor includes the single-stranded variable regions GPC3.

Preferably, the nucleic acid sequence of the single-stranded variable regions the GPC3 is as shown in SEQ ID NO.11；

Nucleic acid sequence is shown in the SEQ ID NO.11：

gatgttgtgatgacccaaactccactctccctgcctgtcagtcttggagatcaagcctccatctcttgcagatctag tcagagccttgtacacagtaatggaaacacctatttacattggtacctgcagaagccaggccagtctccaaagctcc tgatctacaaagtttccaaccgattttctggggtcccagacaggttcagtggcagtggatcagggacagatttcaca ctcaagatcagcagagtggaggctgaggatctgggagtttatttctgctctcaaaatacacatgttcctcctacgtt cggatcggggaccaagctggaaataaaaggtggaggcggttcaggcggaggtggcagcggcggtggcgggtcgcagg ttcaactgcagcagtctggggctgagctggtgaggcctggggcttcagtgaagctgtcctgcaaggcttcgggctac acatttactgactatgaaatgcactgggtgaagcagacacctgtgcatggcctaaaatggattggagctcttgatcc taaaactggtgatactgcctacagtcagaagttcaagggcaaggccacactgactgcagacaaatcctccagcacag cctacatggagctccgcagcctgacatctgaggactctgccgtctattactgtacaagattctactcctatacttac tggggccaagggactctggtcactgtctctgca.

Preferably, the signal peptide of the auxiliary Chimeric antigen receptor is GM-CSF signal peptides.

Preferably, the nucleic acid sequence of the GM-CSF signal peptides is as shown in SEQ ID NO.12；

Nucleic acid sequence is shown in the SEQ ID NO.12：

atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatccca.

Preferably, the transmembrane region of the auxiliary Chimeric antigen receptor includes CD28 cross-film sections.

Preferably, the nucleic acid sequence of the CD28 cross-films section is as shown in SEQ ID NO.13；

Nucleic acid sequence is shown in the SEQ ID NO.13：

attgaagttatgtatcctcctccttacctagacaatgagaagagcaatggaaccattatccatgtgaaagggaaaca cctttgtccaagtcccctatttcccggaccttctaagcccttttgggtgctggtggtggttgggggagtcctggctt gctatagcttgctagtaacagtggcctttattattttctgggtg.

Preferably, the intracellular signal transduction area of the auxiliary Chimeric antigen receptor includes Toll-like receptor 1 and/or Toll-like Receptor 2, preferably Toll-like receptor 2.

Preferably, the nucleic acid sequence of the Toll-like receptor 1 is as shown in SEQ ID NO.4.

Preferably, the nucleic acid sequence of the Toll-like receptor 2 is as shown in SEQ ID NO.5.

Preferably, the intracellular signal transduction area of the auxiliary Chimeric antigen receptor further includes CD28 intracellulars section and/or CD3 ζ.

Preferably, the nucleic acid sequence of the CD28 intracellulars section is as shown in SEQ ID NO.14；

Nucleic acid sequence is shown in the SEQ ID NO.14：

aggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccgccgccccgggcccacccgcaagca ttaccagccctatgccccaccacgcgacttcgcagcctatcgctcc.

Preferably, the nucleic acid sequence of the CD3 ζ is as shown in SEQ ID NO.15；

Nucleic acid sequence is shown in the SEQ ID NO.15：

agagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatct aggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaagga agaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaa ggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgc ccttcacatgcaggccctgccccctcgc.

Preferably, the anti-Mesothelin Chimeric antigen receptors are single-stranded variable by GM-CSF signal peptides, Mesothelin Area, CD28, CD3 ζ and Toll-like receptor 2 are composed in series.

In the present invention, the anti-Mesothelin Chimeric antigen receptors are：GM-CSF signal peptide-Mesothelin scFv- CD28-CD3ζ-Toll 2.

Preferably, the anti-PSCA Chimeric antigen receptors are by GM-CSF signal peptides, the single-stranded variable regions PSCA, CD28, CD3 ζ It is composed in series with Toll-like receptor 2.

In the present invention, the anti-PSCA Chimeric antigen receptors are：GM-CSF signal peptide-PSCA scFv-CD28-CD3 ζ- Toll2.

Preferably, the anti-MUC1 Chimeric antigen receptors are by GM-CSF signal peptides, the single-stranded variable regions MUC1, CD28, CD3 ζ It is composed in series with Toll-like receptor 2.

In the present invention, the anti-MUC1 Chimeric antigen receptors are：GM-CSF signal peptide-MUC1scFv-CD28-CD3 ζ- Toll2.

Preferably, the anti-HER2 Chimeric antigen receptors are by GM-CSF signal peptides, the single-stranded variable regions HER2, CD28, CD3 ζ It is composed in series with Toll-like receptor 2.

In the present invention, the anti-HER2 Chimeric antigen receptors are：GM-CSF signal peptide-HER2scFv-CD28-CD3 ζ- Toll2.

Preferably, the resisting GPC 3 Chimeric antigen receptor is by GM-CSF signal peptides, the single-stranded variable regions GPC3, CD28, CD3 ζ It is composed in series with Toll-like receptor 2.

In the present invention, the resisting GPC 3 Chimeric antigen receptor is：GM-CSF signal peptide-GPC3scFv-CD28-CD3 ζ- Toll2.

Preferably, the immunocyte include in T cell, B cell or NK cells any one or at least two group It closes, preferably T cell.

Second aspect, the present invention provides a kind of sides preparing Chimeric antigen receptor immunocyte as described in relation to the first aspect Method the described method comprises the following steps：

(1) the anti-PD-L1 Chimeric antigen receptors of structure coding, anti-Mesothelin Chimeric antigen receptors, anti-PSCA are embedding respectively The expression for closing antigen receptor, anti-MUC1 Chimeric antigen receptors, anti-HER2 Chimeric antigen receptors or resisting GPC 3 Chimeric antigen receptor carries Body；

(2) by the expression vector for encoding anti-PD-L1 Chimeric antigen receptors and encode anti-Mesothelin Chimeric antigen receptors, Anti- PSCA Chimeric antigen receptors, anti-MUC1 Chimeric antigen receptors, anti-HER2 Chimeric antigen receptors or resisting GPC 3 Chimeric antigen receptor In the expression vector of any one be transformed into immunocyte genome, obtain the Chimeric antigen receptor immunocyte.

Preferably, the expression vector is slow virus.

The third aspect, the present invention provides a kind of Chimeric antigen receptor immunocytes as described in relation to the first aspect to prepare disease Application in medicine.

Preferably, the disease includes solid tumor.

Preferably, the solid tumor includes lung cancer and/or liver cancer.

Compared with prior art, the present invention has the advantages that：

(1) present invention is shown anti-by in the anti-PD-L1 Chimeric antigen receptors of Chimeric antigen receptor immunocyte surface expression PD-L1 Chimeric antigen receptors use PD-1 for extracellular antigen binding domain, the inhibition signal that PD-1 accesses cause are changed into immune Cell activation signal not only ensure that effective killing of the Chimeric antigen receptor immunocyte to tumour cell, but also reduce embedding Close side effect of the antigen receptor immunocyte to normal cell；

(2) anti-PD-L1 Chimeric antigen receptors of the invention are turned using the intracellular signal that is combined as of Toll-like receptor and 41BB Area is led, cooperates with the PD-1 of extracellular antigen binding domain, realizes Efficient killing effect of the immunocyte to tumour cell；

(3) anti-PD-L1 Chimeric antigen receptors are combined with the auxiliary Chimeric antigen receptor for tumor surface antigen, are prepared CAR-T cells show significant tumor-killing energy in vitro, in NSCLC mouse models and primary NSCLC mouse models Power.

Description of the drawings

Fig. 1 is Chimeric antigen receptor structure chart；

Fig. 2 (A) is PD.1BBT2+Meso.28zT2T cells to the external lethality of NSCLC cell lines A549-GL, Fig. 2 (B) it is PD.1BBT2+Meso.28zT2T cells to the external lethality of NSCLC cell lines H460-GL, Fig. 2 (C) is PD.1BBT2+Meso.28zT2T cells to be overexpressed Mesothelin NSCLC cell lines H460-Meso-GL it is external lethal Rate, Fig. 2 (D) are external lethality of the PD.1BBT2+PSCA.28zT2T cells to NSCLC cell lines H460-GL, and Fig. 2 (E) is For PD.1BBT2+MUC1.28zT2T cells to the external lethality of NSCLC cell lines H460-GL, Fig. 2 (F) is PD.1BBT2+ For HER2.28zT2T cells to the external lethality of NSCLC cell lines H460-GL, Fig. 2 (G) is PD.1BBT2+GPC3.28zT2T External lethality of the cell to HCC cell lines Huh-7-GL；

Fig. 3 (A) is the gross tumor volume of NSCLC cell line A549-GL mouse models, and Fig. 3 (B) is NSCLC cell lines A549- The tumour picture of GL mouse models, Fig. 3 (C) are the tumor weight of NSCLC cell line A549-GL mouse models, and Fig. 3 (D) is The tumour picture of NSCLC cell line H460-Meso-GL mouse models, Fig. 3 (E) are NSCLC cell line H460-Meso-GL mouse The tumor weight of model；

Fig. 4 (A) is the gross tumor volume of the mouse model of primary NSCLC transplanting, and Fig. 4 (B) is the mouse of primary NSCLC transplanting The tumour picture of model, Fig. 4 (C) are the tumor weight of the mouse model of primary NSCLC transplanting.

Specific implementation mode

The technological means and its effect taken for the present invention is further explained, with reference to embodiments with attached drawing to this hair It is bright to be further described.It is understood that the specific embodiments described herein are used only for explaining the present invention, rather than Limitation of the invention.

In the examples where no specific technique or condition is specified, according to technology or condition described in document in the art, Or it is carried out according to product description.Reagents or instruments used without specified manufacturer, be can be by regular channel commercially available from The conventional products of acquisition.

1 plasmid construction of embodiment

(1) it is as shown in Figure 1 anti-PD-L1 Chimeric antigen receptors (PD1.BBT2), anti-Mesothelin Chimeric antigen receptors (Meso.28zT2), anti-PSCA Chimeric antigen receptors (PSCA.28zT2), anti-MUC1 Chimeric antigen receptors (MUC1.28zT2), anti- The molecular structure of HER2 Chimeric antigen receptors (HER2.28zT2) and resisting GPC 3 Chimeric antigen receptor (GPC3.28zT2), in synthesis The nucleic acid sequence for stating Chimeric antigen receptor, as shown in SEQ ID NO.1-15,3 ' ends of all composition sequences contain restriction enzyme I restriction enzyme sites of enzyme Pme, the restriction enzyme site of 5 ' end Spe containing restriction enzyme I；

(2) restriction enzyme Pme I and I double digestion Lentiviral pwpxld-eGFP of Spe and synthesis are used The nucleic acid sequence of Chimeric antigen receptor；

(3) agarose gel electrophoresis recycles the target gene containing cohesive end：PD1.BBT2、Meso.28zT2、 The expression vector pwpxld-eGFP of PSCA.28zT2, MUC1.28zT2, HER2.28zT2, GPC3.28zT2 and linearisation；

(4) target gene of recycling is connected to by pwpxld-eGFP tables using T4DNA ligases (Invitrogen companies) Up to carrier, conversion to Top10 competent cells, picking positive plasmid, the final slow virus expression load for obtaining Chimeric antigen receptor Body：pwpxld-PD1.BBT2、pwpxld-Meso.28zT2、pwpxld-PSCA.28zT2、pwpxld-MUC1.28zT2、 Pwpxld-HER2.28zT2 and pwpxld-GPC3.28zT2.

2 slow virus of embodiment is packed

Viral packaging is carried out using 293T cells, when cell fusion degree reaches 80-90%, carries out slow virus packaging：

(1) virus packaging was carried out before 2 hours, and cell culture medium is changed to the DMEM containing 1% fetal calf serum, and addition is 6mL/100mm culture dishes；

(2) it presses table 1 plasmid is added in 500 μ L opti-MEM culture mediums, wherein pWPXLd-CAR-eGFP plasmids are pwpxld-PD1.BBT2、pwpxld-Meso.28zT2、pwpxld-PSCA.28zT2、pwpxld-MUC1.28zT2、pwpxld- Any one in HER2.28zT2 or pwpxld-GPC3.28zT2；

(3) 36 μ g PEI are added in another 500 μ L opti-MEM culture mediums, mixing is stored at room temperature 5min；

(4) mixing is blown and beaten after mixing plasmid with PEI, is stored at room temperature 25-30min；

(5) mixed liquor is added dropwise to 293T cells, 293T cell culture is in 100mm culture dishes；

(6) culture medium is changed to the fresh DMEM containing 1% fetal calf serum after 6h, addition is trained for 7mL/100mm Support ware；

(7) after packing respectively for 24 hours, 48h and 72h collect viral supernatants, while adding 7mL/100mm to 293T cells Culture dish fresh culture；

(8) 1000g centrifuges 10min, and 0.45 μm of filter filtering obtains slow virus, and 4 DEG C preserve for use.

Table 1

Reagent	Dosage
		PWPXLd-CAR-eGFP plasmids	4.5μg
PMD2.G helper plasmids	1.5μg
		psPAX2	6μg

The preparation of embodiment 3CAR-T cells

(1) Ficoll density gradient centrifugations kit (GE companies) separating peripheral blood mononuclear cells from whole blood are used (PBMC)；

(2) Pan T cell magnetic bead sortings kit (Mei Tian Ni companies) is used to detach T cell from PBMC；

(3) CD2/CD3/CD28T cell-stimulatings amplification kit (Mei Tian Ni companies) activation T cell 36h is used；

(4) after t cell activation 36h, magnetic bead is abandoned, with the 1640 culture base weights containing 10% fetal calf serum, 1000IU/mL IL2 Outstanding T cell, by the addition slow virus of table 2, every 10⁶1mL slow virus and 8 μ g/mL polybrenes are added in a T cell, in 37 DEG C, 5% CO₂It is infected in incubator twice, per minor tick 8-12h；

(5) after virus infection, T cell is resuspended using 1640 culture mediums containing 10% fetal calf serum, 1000IU/mL IL-2, Every 10⁶1mL slow virus is added in a T cell, fresh culture, adjustment cell density to (1-2) × 10 is added in interval 48h⁶/ mL, Culture carries out subsequent experimental after 10 days.

Table 2

Fragmentation effect of the vitro detection CAR-T cells to NSCLC cell lines

By the CAR-T cells as shown in Table 2 of preparation respectively with 1 × 10⁴NSCLC cell lines (A549-GL, H460-GL And H460-Meso-GL, wherein H460-GL is that artificial H460 of the importing containing green fluorescent protein and luciferase tag GL is thin Born of the same parents are that H460-Meso-GL is the H460 cell lines for being overexpressed Mesothelin) press 4:1、2:1、1:1、1:2、1:4、1:8 and 1: 16 ratios mix, while being arranged without containing CAR-T cells, the control group only containing NSCLC cells, are added in 96 hole U-shaped boards, often Group sets 3 multiple holes and is placed in 37 DEG C, 5%CO after 250g centrifuges 5min₂18h is co-cultured in incubator；

Killing-efficiency appraisal procedure is quantified using luciferase (Luciferase), carries out CAR-T cells to NSCLC cells It is the evaluation of fragmentation effect：CAR-T cells and tumour cell are co-cultured, or 18 hours after tumour cell individually cultivate, suction 100 μ L cell conditioned mediums are taken, blow and beat hole inner cell repeatedly with pipettor, are transferred in 96 new hole blanks, 100 μ L 1 are added per hole × luciferase substrate slightly shakes mixing, uses multi-function microplate reader to measure RLU (relative light unit) immediately, The fragmentation effect of CAR-T cells is evaluated using following formula：

Killing ratio=100% × (contain only the control wells reading of tumour cell-experimental port reading)/contain only tumour cell Control wells are read

As shown in Fig. 2 (A), Fig. 2 (B), Fig. 2 (C), Fig. 2 (D), Fig. 2 (E) and Fig. 2 (F), PD1.BBT2 enhances T cell Killing ability, include CAR-T cells (PD1.BBT2+Meso.28zT2T, PD1.BBT2+ of two kinds of Chimeric antigen receptors PSCA.28zT2T, PD1.BBT2+MUC1.28zT2T and PD1.BBT2+HER2.28zT2T) and include a kind of Chimeric antigen receptor CAR-T cells (PD1.BBT2T, Meso.28zT2T, PSCA.28zT2T, MUC1.28zT2T and HER2.28zT2T) compare, For NSCLC cell lines have significantly more Cytotoxicity in vitro effect, PD1.BBT2 significantly enhance Meso.28zT2, The killing ability of PSCA.28zT2, MUC1.28zT2 and HER2.28zT2.

Fragmentation effect of the vitro detection CAR-T cells to HCC cell lines

By GPC3.28zT2T the and PD1.BBT2+GPC3.28zT2T cells of preparation respectively with 1 × 10⁴HCC cell lines (Huh-7-GL is artificial HCC cell line of the importing containing green fluorescent protein and luciferase tag GL) presses 4:1、2:1、1:1、 1:2、1:4、1:8 and 1:16 ratios mix, while being arranged without containing CAR-T cells, the control group only containing HCC cells, are added In 96 hole U-shaped boards, every group sets 3 multiple holes and is placed in 37 DEG C, 5%CO after 250g centrifuges 5min₂18h is co-cultured in incubator；

Killing-efficiency appraisal procedure is quantified using luciferase (Luciferase), carries out CAR-T cells to HCC cell lines The evaluation of fragmentation effect：CAR-T cells and tumour cell are co-cultured, or 18 hours after tumour cell individually cultivate, absorption 100 μ L cell conditioned mediums, hole inner cell is blown and beaten with pipettor repeatedly, is transferred in 96 new hole blanks, be added per hole 100 μ L 1 × Luciferase substrate slightly shakes mixing, uses multi-function microplate reader to measure RLU (relative light unit) immediately, The fragmentation effect of CAR-T cells is evaluated using following formula：

As shown in Fig. 2 (G), PD1.BBT2 enhances the killing ability of T cell, includes the CAR- of two kinds of Chimeric antigen receptors T cell (PD1.BBT2+GPC3.28zT2T) and CAR-T cells (GPC3.28zT2T) phase comprising a kind of Chimeric antigen receptor Than there is significantly more Cytotoxicity in vitro effect, PD1.BBT2 to significantly enhance killing for GPC3.28zT2T HCC cell lines Hinder ability.

Fragmentation effect of the CAR-T cells to NSCLC cell lines is detected on NSCLC mouse models

(1) by 5 × 10⁵A NSCLC cells are through being subcutaneously injected into NOD/SCID IL2rg^-/-In immunodeficient mouse body, structure NSCLC cell line mice model of lung cancer, wherein NSCLC cell lines are A549-GL and H460-GL, and H460-GL is artificial imports H46 cell lines containing green fluorescent protein and luciferase tag GL；

(2) after tumour transplatation 3 days and 15 days, respectively through vein to mouse model injection 2 × 10⁶A PD1.BBT2T cells, Meso.28zT2T cells and PD1.BBT2+Meso.28zT2T cells, while being arranged without containing CAR-T cells, only containing NSCLC The control group of cell, five repetitions of every group of setting；

(3) the 20th after tumour transplatation, 23,27,31,34,37,41,43,48 days, mouse is measured respectively with vernier caliper Subcutaneous tumor block size draws tumor growth curve figure；

(4) the 51st day after tumour transplatation, mouse is killed, compares gross tumor volume, measures tumor weight.

As shown in Fig. 3 (A), Fig. 3 (B), Fig. 3 (C), Fig. 3 (D) and Fig. 3 (E), in NSCLC cell lines Mice models, PD1.BBT2 enhances the ability that T cell inhibits tumour growth, includes the CAR-T cells of two kinds of Chimeric antigen receptors (PD1.BBT2+Meso.28zT2T) with comprising a kind of Chimeric antigen receptor CAR-T cells (PD1.BBT2T, Meso.28zT2T it) compares, there is significantly more tumor-killing ability, PD1.BBT2 to significantly enhance NSCLC cell lines The killing ability of Meso.28zT2.

Fragmentation effect of the CAR-T cells to primary NSCLC is detected on primary NSCLC mouse models

(1) tumor sample of patient NSCLC is implanted into NOD/SCID IL2rg^-/-In immunodeficient mouse body, lung is built Cancer mouse model；

(2) 14 days after tumour transplatation, 2 × 10 are injected to mouse model through vein respectively⁶A PD1.BBT2T cells, Meso.28zT2T cells and PD1.BBT2+Meso.28zT2T cells, while being arranged without containing CAR-T cells, only containing NSCLC The control group of cell, five repetitions of every group of setting；

As shown in Fig. 4 (A), Fig. 4 (B) and Fig. 4 (C), in primary NSCLC mouse models, PD1.BBT2 enhances T cell The ability of tumour is killed, including the CAR-T cells (PD1.BBT2+Meso.28zT2T) of two kinds of Chimeric antigen receptors are with powerful Tumour resistivity.

Comparative example 1

Compared with Example 3, CAR-T cell surfaces express anti-PD-L1 Chimeric antigen receptors and anti-Mesothelin is chimeric Antigen receptor, wherein the extracellular antigen binding domain of anti-PD-L1 Chimeric antigen receptors is the single-stranded variable region of PD-L1 antibody.

Comparative example 2

Compared with Example 3, CAR-T cell surfaces express anti-PD-L1 Chimeric antigen receptors and anti-Mesothelin is chimeric Antigen receptor, wherein the intracellular signal transduction area of anti-PD-L1 Chimeric antigen receptors does not include Toll-like receptor, only 41BB.

Comparative example 3

Compared with Example 3, CAR-T cell surfaces express anti-PD-L1 Chimeric antigen receptors and anti-Mesothelin is chimeric Antigen receptor, wherein the intracellular signal transduction area of anti-Mesothelin Chimeric antigen receptors does not include Toll-like receptor, only 41BB。

By the CAR-T cells of embodiment 3 (PD1.BBT2+Meso.28zT2T), comparative example 1, comparative example 2 and comparative example 3 point Not with 1 × 10⁴A NSCLC cells A549-GL and 1 × 10⁴A 293T cells press 1:1 ratio mixes, vitro detection embodiment 3, right Killing ability of the CAR-T cells of ratio 1, comparative example 2 and comparative example 3 to A549-GL and 293T.

The results are shown in Table 3, and four kinds of CAR-T cells have A549-GL stronger killing ability, embodiment 3 and comparison Example 1 is stronger to the killing ability of A549-GL；But comparative example 1 equally shows 293T very strong killing ability, explanation is adopted Use the single-stranded variable region of PD-L1 antibody as the extracellular antigen binding domain of Chimeric antigen receptor, the CAR-T cell side effects of preparation By force, there is killing ability to normal cell.

Table 3

Number	A549-GL lethalities (%)	293T lethalities (%)
			Embodiment 3	96.6	1.5
Comparative example 1	96.4	32.8
			Comparative example 2	89.7	1.6
Comparative example 3	86.1	1.5

In conclusion the present invention is by the anti-PD-L1 Chimeric antigen receptors of Chimeric antigen receptor immunocyte surface expression, Shown anti-PD-L1 Chimeric antigen receptors use PD-1 for extracellular antigen binding domain, and the inhibition signal that PD-1 accesses are caused changes For immune cell activation signal, effective killing of the Chimeric antigen receptor immunocyte to tumour cell not only ensure that, but also subtract Small side effect of the Chimeric antigen receptor immunocyte to normal cell, while born of the same parents are combined as using Toll-like receptor and 41BB Interior signal transduction area cooperates with the PD-1 of extracellular antigen binding domain, realizes immunocyte efficiently killing to tumour cell Wound, anti-PD-L1 Chimeric antigen receptors are combined with the auxiliary Chimeric antigen receptor for tumor surface antigen, the CAR-T of preparation Cell shows significant tumor-killing ability in vitro, in NSCLC mouse models and primary NSCLC mouse models.

Applicant states that the present invention illustrates the method detailed of the present invention, but the present invention not office by above-described embodiment It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implement.Technical field Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention Addition, the selection etc. of concrete mode, all fall within protection scope of the present invention and the open scope.

Sequence table

<110>Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health

<120>A kind of Chimeric antigen receptor immunocyte and its preparation method and application

<130> 20180316

<141> 2018-03-23

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 450

<212> DNA

<213>Artificial synthesized ()

<400> 1

ccaggatggt tcttagactc cccagacagg ccctggaacc cccccacctt ctccccagcc 60

ctgctcgtgg tgaccgaagg ggacaacgcc accttcacct gcagcttctc caacacatcg 120

gagagcttcg tgctaaactg gtaccgcatg agccccagca accagacgga caagctggcc 180

gccttccccg aggaccgcag ccagcccggc caggactgcc gcttccgtgt cacacaactg 240

cccaacgggc gtgacttcca catgagcgtg gtcagggccc ggcgcaatga cagcggcacc 300

tacctctgtg gggccatctc cctggccccc aaggcgcaga tcaaagagag cctgcgggca 360

gagctcaggg tgacagagag aagggcagaa gtgcccacag cccaccccag cccctcaccc 420

aggccagccg gccagttcca aaccctggtg 450

<210> 2

<211> 60

<212> DNA

<213>Artificial synthesized ()

<400> 2

atgcagatcc cacaggcgcc ctggccagtc gtctgggcgg tgctacaact gggctggcgg 60

<210> 3

<211> 63

<212> DNA

<213>Artificial synthesized ()

<400> 3

gttggtgtcg tgggcggcct gctgggcagc ctggtgctgc tagtctgggt cctggccgtc 60

atc 63

<210> 4

<211> 486

<212> DNA

<213>Artificial synthesized ()

<400> 4

aacataccct tagaagaact ccaaagaaat ctccagtttc atgcatttat ttcatatagt 60

gggcacgatt ctttctgggt gaagaatgaa ttattgccaa acctagagaa agaaggtatg 120

cagatttgcc ttcatgagag aaactttgtt cctggcaaga gcattgtgga aaatatcatc 180

acctgcattg agaagagtta caagtccatc tttgttttgt ctcccaactt tgtccagagt 240

gaatggtgcc attatgaact ctactttgcc catcacaatc tctttcatga aggatctaat 300

agcttaatcc tgatcttgct ggaacccatt ccgcagtact ccattcctag cagttatcac 360

aagctcaaaa gtctcatggc caggaggact tatttggaat ggcccaagga aaagagcaaa 420

cgtggccttt tttgggctaa cttaagggca gccattaata ttaagctgac agagcaagca 480

aagaaa 486

<210> 5

<211> 477

<212> DNA

<213>Artificial synthesized ()

<400> 5

caggccaaaa ggaagcccag gaaagctccc agcaggaaca tctgctatga tgcatttgtt 60

tcttacagtg agcgggatgc ctactgggtg gagaacctta tggtccagga gctggagaac 120

ttcaatcccc ccttcaagtt gtgtcttcat aagcgggact tcattcctgg caagtggatc 180

attgacaata tcattgactc cattgaaaag agccacaaaa ctgtctttgt gctttctgaa 240

aactttgtga agagtgagtg gtgcaagtat gaactggact tctcccattt ccgtcttttt 300

gatgagaaca atgatgctgc cattctcatt cttctggagc ccattgagaa aaaagccatt 360

ccccagcgct tctgcaagct gcggaagata atgaacacca agacctacct ggagtggccc 420

atggacgagg ctcagcggga aggattttgg gtaaatctga gagctgcgat aaagtcc 477

<210> 6

<211> 66

<212> DNA

<213>Artificial synthesized ()

<400> 6

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atccca 66

<210> 7

<211> 801

<212> DNA

<213>Artificial synthesized ()

<400> 7

tagaattcct gaggagacgg tgaccgtggt cccttggccc cagacgtcca taccgtaata 60

gtaagtcatc attcctcttg cacagtaata cacagccgtg tcctcgggag tcacagagtt 120

cagctgcagg gagaactggt tcttggatgt gtctgggttg atgctcattc gacttttcac 180

agatactgca tagtcgttat accacttgga cctgtagtat gtccttccca gccactcaag 240

gcctctcgat ggggactgcc tgatccagtt ccaagtagca ctgttgctag agacactgtc 300

cccggagatg gcacaggtga gtgagagggt ctgcgagggc gtcacgagtc ctggacctga 360

ctgctgcagc tgtacctggc tggatccggt ggcggtggca gcggcggtgg tggttccgga 420

ggcggcggtt ctcagcctgt gctgactcag tcgtcttccc tctctgcatc tcctggagca 480

tcagccagtc tcacctgcac cttgcgcagt ggcatcaatg ttggtcccta caggatatac 540

tggtaccagc agaagccagg gagtcctccc cagtatctcc tgaactacaa atcagactca 600

gataagcagc agggctctgg agtccccagc cgcttctctg gatccaaaga tgcttcggcc 660

aatgcagggg ttttactcat ctctgggctc cggtctgagg atgaggctga ctattactgt 720

atgatttggc acagcagcgc tgctgtgttc ggaggaggca cccaactgac cgtcctctcc 780

ggaattctag aacaacaggg t 801

<210> 8

<211> 750

<212> DNA

<213>Artificial synthesized ()

<400> 8

gacattcagc tgacccaatc tccaagctct ttgtccgcct ctgtggggga tagggtcacc 60

atcacctgca gtgccagttc aagtgtaaga ttcattcact ggtaccagca gaaaccagga 120

aaagctccca aaagactcat ctatgacaca tccaaactgg cttctggcgt cccttctagg 180

ttcagtggct ccgggtctgg gacagacttc accctcacca ttagcagtct gcagccggaa 240

gatttcgcca cctattactg tcagcagtgg agtagtagcc cattcacgtt cggacagggg 300

accaaggtgg agataaaagg cagtactagc ggcggtggct ccggaggcgg ctccggaggt 360

ggcggcagct cagaggttca gctggtggag tctgggggtg gccttgtgca gccagggggc 420

tcactccgtt tgtcctgcgc agcttctggc ttcaacatta aagactacta tatacactgg 480

gtgcgtcagg cccctggtaa gggcctggaa tgggttgcat ggattgatcc tgagaatggt 540

gacactgaat ttgtcccgaa gttccagggc cgtgccacta taagcgcaga cacatccaaa 600

aacacagcct acctgcagat gaacagcctg cgtgctgagg acactgccgt ctattattgt 660

aaaacggggg ggttctgggg tcaaggaacc ctggtcaccg tctcgagcga gcccaaatct 720

tgtgacaaaa ctcacacatg cccaccgtgc 750

<210> 9

<211> 732

<212> DNA

<213>Artificial synthesized ()

<400> 9

gatatcgttg tgactcagga atctgcactc accacatcac ctggtgaaac agtcacactc 60

acttgtcgct caagtactgg ggctgttaca acaagtaact atgccaactg ggtccaagaa 120

aaaccagatc atttattcac tggtctaata ggtggtacca acaaccgagc accaggtgtt 180

cctgccagat tctcaggctc cctgattgga gacaaggctg ccctcaccat cacaggggca 240

cagactgagg atgaggcaat atatttctgt gctctatggt acagcaacca ttgggtgttc 300

ggtggaggaa ccaaactgac tgtcctagga tccgagggtg gctcaggatc gggtggatca 360

ggctctggtg gctcaggatc ggaggtccag ctgcagcagt caggaggagg cttggtgcaa 420

cctggaggat ccatgaaact ctcctgtgtt gcctctggat tcactttcag taactactgg 480

atgaactggg tccgccagtc tccagagaag gggcttgagt gggttgctga aattagattg 540

aaatctaata attatgcaac acattatgcg gagtctgtga aagggaggtt caccatctca 600

agagatgatt ccaaaagtag tgtctacctg caaatgaaca acttaagagc tgaagacact 660

ggcatttatt actgtacctt tggtaactcc tttgcttact ggggccaagg gaccacggtc 720

accgtctcct ca 732

<210> 10

<211> 689

<212> DNA

<213>Artificial synthesized ()

<400> 10

attctgatga cccagtctcc agcaatcatg tctgcaatca tgtctgcatc tccaggggag 60

aaggtcacca tgacctgcag tgccagctca agtgtaagtt acatgcactg gtaccagcag 120

aagtcaggca cctcccccaa aagatggatt tatgacacat ccaaactggc ttctggagtc 180

cctgctcgct tcagtggcag tgggtctggg acctcttact ctctcacaat cagcagcatg 240

gaggctgaag atgctgccac ttattactgc cagcagtgga gtagtaaccc gctcacgttc 300

ggtgctggga ccaagctgga aataaaaggt ggctcaggat cgggtggatc aggctctggt 360

ggctcaggat cgggacctgg cctggcggcg ccctcacaga gcctgtccat cacatgcact 420

gtctctgggt tctcattaac cagctatgtt ataagttggg ttcgccagcc accaggaaag 480

ggtctggagt ggcttggagt aatatggact ggtggaggca caaattataa ttcagctctc 540

aaatccagac tgagcatcag caaagacaac tccaagagtc aagtttcctt aaaaatgaac 600

agtctgcaaa ctgatgacac agccaggtac tactgtgcca gcctttccta tgatggtttc 660

gactactggg gccaagggac cacggtcac 689

<210> 11

<211> 726

<212> DNA

<213>Artificial synthesized ()

<400> 11

gatgttgtga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60

atctcttgca gatctagtca gagccttgta cacagtaatg gaaacaccta tttacattgg 120

tacctgcaga agccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180

tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240

agcagagtgg aggctgagga tctgggagtt tatttctgct ctcaaaatac acatgttcct 300

cctacgttcg gatcggggac caagctggaa ataaaaggtg gaggcggttc aggcggaggt 360

ggcagcggcg gtggcgggtc gcaggttcaa ctgcagcagt ctggggctga gctggtgagg 420

cctggggctt cagtgaagct gtcctgcaag gcttcgggct acacatttac tgactatgaa 480

atgcactggg tgaagcagac acctgtgcat ggcctaaaat ggattggagc tcttgatcct 540

aaaactggtg atactgccta cagtcagaag ttcaagggca aggccacact gactgcagac 600

aaatcctcca gcacagccta catggagctc cgcagcctga catctgagga ctctgccgtc 660

tattactgta caagattcta ctcctatact tactggggcc aagggactct ggtcactgtc 720

tctgca 726

<210> 12

<211> 66

<212> DNA

<213>Artificial synthesized ()

<400> 12

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atccca 66

<210> 13

<211> 198

<212> DNA

<213>Artificial synthesized ()

<400> 13

attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 60

catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagcccttt 120

tgggtgctgg tggtggttgg gggagtcctg gcttgctata gcttgctagt aacagtggcc 180

tttattattt tctgggtg 198

<210> 14

<211> 123

<212> DNA

<213>Artificial synthesized ()

<400> 14

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 15

<211> 336

<212> DNA

<213>Artificial synthesized ()

<400> 15

agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300

tacgacgccc ttcacatgca ggccctgccc cctcgc 336

Claims

1. a kind of Chimeric antigen receptor immunocyte, which is characterized in that the Chimeric antigen receptor immunocyte surface expression is anti- The extracellular antigen binding domain of PD-L1 Chimeric antigen receptors, the anti-PD-L1 Chimeric antigen receptors includes PD-1 extracellular fragments and PD-1 Signal peptide.

2. wanting the 1 Chimeric antigen receptor immunocyte according to right, which is characterized in that the nucleic acid sequence of the PD-1 extracellular fragments As shown in SEQ ID NO.1；

Preferably, the transmembrane region of the anti-PD-L1 Chimeric antigen receptors includes PD-1 cross-film sections；

Preferably, the intracellular signal transduction area of the anti-PD-L1 Chimeric antigen receptors includes Toll-like receptor 1 or Toll-like receptor 2, preferably Toll-like receptor 2；

Preferably, the intracellular signal transduction area of the anti-PD-L1 Chimeric antigen receptors further includes 41BB；

Preferably, the nucleic acid sequence of the 41BB is as shown in SEQ ID NO.6.

3. Chimeric antigen receptor immunocyte according to claim 1 or claim 2, which is characterized in that the anti-PD-L1 chimeric antigens Receptor is composed in series by PD-1 signal peptides, PD-1,41BB and Toll-like receptor 2；

4. according to any one of the claim 1-3 Chimeric antigen receptor immunocytes, which is characterized in that the chimeric antigen by Also express the auxiliary Chimeric antigen receptor for assisting anti-PD-L1 Chimeric antigen receptors in body immunocyte surface；

Preferably, the auxiliary Chimeric antigen receptor include anti-Mesothelin Chimeric antigen receptors, anti-PSCA chimeric antigens by Any one in body, anti-MUC1 Chimeric antigen receptors, anti-HER2 Chimeric antigen receptors or resisting GPC 3 Chimeric antigen receptor；

Preferably, the extracellular antigen binding domain of the anti-Mesothelin Chimeric antigen receptors includes Mesothelin single-stranded variable Area；

Preferably, the extracellular antigen binding domain of the anti-PSCA Chimeric antigen receptors includes the single-stranded variable regions PSCA；

Preferably, the extracellular antigen binding domain of the anti-MUC1 Chimeric antigen receptors includes the single-stranded variable regions MUC1；

Preferably, the extracellular antigen binding domain of the anti-HER2 Chimeric antigen receptors includes the single-stranded variable regions HER2；

Preferably, the extracellular antigen binding domain of the resisting GPC 3 Chimeric antigen receptor includes the single-stranded variable regions GPC3；

Preferably, the signal peptide of the auxiliary Chimeric antigen receptor is GM-CSF signal peptides；

Preferably, the transmembrane region of the auxiliary Chimeric antigen receptor includes CD28 cross-film sections；

Preferably, the intracellular signal transduction area of the auxiliary Chimeric antigen receptor includes Toll-like receptor 1 and/or Toll-like receptor 2, preferably Toll-like receptor 2；

Preferably, the intracellular signal transduction area of the auxiliary Chimeric antigen receptor further includes CD28 intracellulars section and CD3 ζ；

Preferably, the nucleic acid sequence of the CD3 ζ is as shown in SEQ ID NO.15.

5. according to any one of the claim 1-4 Chimeric antigen receptor immunocytes, which is characterized in that described anti- Mesothelin Chimeric antigen receptors by GM-CSF signal peptides, the single-stranded variable regions Mesothelin, CD28, CD3 ζ and Toll-like by Body 2 is composed in series；

Preferably, the anti-PSCA Chimeric antigen receptors by GM-CSF signal peptides, the single-stranded variable regions PSCA, CD28, CD3 ζ and Toll-like receptor 2 is composed in series；

Preferably, the anti-MUC1 Chimeric antigen receptors by GM-CSF signal peptides, the single-stranded variable regions MUC1, CD28, CD3 ζ and Toll-like receptor 2 is composed in series；

Preferably, the anti-HER2 Chimeric antigen receptors by GM-CSF signal peptides, the single-stranded variable regions HER2, CD28, CD3 ζ and Toll-like receptor 2 is composed in series；

Preferably, the resisting GPC 3 Chimeric antigen receptor by GM-CSF signal peptides, the single-stranded variable regions GPC3, CD28, CD3 ζ and Toll-like receptor 2 is composed in series.

6. according to any one of the claim 1-5 Chimeric antigen receptor immunocytes, which is characterized in that the immunocyte packet Include in T cell, B cell or NK cells any one or at least two combination, preferably T cell.

7. a kind of method preparing the Chimeric antigen receptor immunocyte as described in claim any one of 1-6, which is characterized in that institute The method of stating includes the following steps：

(1) structure encodes anti-PD-L1 Chimeric antigen receptors, anti-Mesothelin Chimeric antigen receptors, anti-PSCA inosculating antibodies respectively The expression vector of original receptor, anti-MUC1 Chimeric antigen receptors, anti-HER2 Chimeric antigen receptors or resisting GPC 3 Chimeric antigen receptor；

(2) by the expression vector for encoding anti-PD-L1 Chimeric antigen receptors and anti-Mesothelin Chimeric antigen receptors, anti-are encoded In PSCA Chimeric antigen receptors, anti-MUC1 Chimeric antigen receptors, anti-HER2 Chimeric antigen receptors or resisting GPC 3 Chimeric antigen receptor The expression vector of any one be transformed into immunocyte genome, obtain the Chimeric antigen receptor immunocyte.

8. the method according to the description of claim 7 is characterized in that the expression vector is slow virus；

Preferably, the immunocyte include in T cell, B cell or NK cells any one or at least two combination, it is excellent It is selected as T cell.

9. a kind of Chimeric antigen receptor immunocyte answering in preparing disease therapeuticing medicine as described in claim any one of 1-6 With.

10. application according to claim 9, which is characterized in that the disease includes solid tumor；

Preferably, the solid tumor includes lung cancer and/or liver cancer.