CN108410983B - Application of NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor - Google Patents
Application of NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor Download PDFInfo
- Publication number
- CN108410983B CN108410983B CN201810142442.8A CN201810142442A CN108410983B CN 108410983 B CN108410983 B CN 108410983B CN 201810142442 A CN201810142442 A CN 201810142442A CN 108410983 B CN108410983 B CN 108410983B
- Authority
- CN
- China
- Prior art keywords
- nkx2
- tumor
- ovarian cancer
- deletion
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/24—Heavy metals; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- General Engineering & Computer Science (AREA)
- Inorganic Chemistry (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
The invention discloses an application of NKX2-8 in tumor drug resistance detection and an application of FAO inhibitor in NKX2-8 deletion tumor. The invention discovers that under the condition that NKX2-8 is deleted, the body remarkably promotes the chemotherapy resistance and the relapse of the tumor by activating a FAO pathway. The combination of the fatty acid oxidation inhibitor ETO of the invention makes NKX2-8 deficient epithelial ovarian cancer more sensitive to chemotherapeutic drugs. These results indicate that NKX2-8 plays an important role in chemoresistance and can be used as a novel therapeutic strategy for NKX 2-8-deficient tumors. The invention provides a new diagnosis and treatment method and a drug screening platform for tumor diseases.
Description
Technical Field
The invention relates to application of NKX2-8 in drug resistance detection, treatment and prognosis of tumors and application of FAO inhibitors in NKX2-8 deletion type tumor treatment.
Background
Ovarian malignancies are one of the most common malignancies of the female genitalia, with the incidence second only to cervical and uterine body cancers. However, the death rate of ovarian epithelial cancer accounts for the first position of various gynecological tumors, and the life of women is seriously threatened. Because the embryonic development, tissue dissection and endocrine function of the ovary are complex and the early symptoms are not typical, the identification of the tissue type and the benign and malignant properties of the ovarian tumor before operation is quite difficult. In the operation of patients with epithelial ovarian cancer, the tumor is only limited to 30% of ovaries, most of the tumor has spread to the organs of the uterus, bilateral appendages, the greater omentum and the pelvic cavity, so once the tumor is diagnosed, the tumor is mostly in the middle and later stages of the ovarian cancer, and the combined treatment of paclitaxel-platinum chemical drugs and excision is mostly adopted. However, the overall survival of women with epithelial ovarian cancer has improved little since about 30 years ago with chemotherapy. Although the results of the primary clinical response to standard first-line therapy (including primary debulking surgery followed by taxane-platinum chemotherapy) are reasonable in patients with epithelial ovarian cancer, most patients with epithelial ovarian cancer receiving chemotherapy relapse after short-term remission and develop chemotherapy resistance. Approximately 25% of epithelial ovarian cancer patients relapse within 6 months after completion of chemotherapy, and up to 90% of patients with advanced disease relapse within 18 months with the appearance of chemotherapy resistance, eventually dying from the disease. Thus, significant improvement in the survival of patients with epithelial ovarian cancer requires reversal of the patient's chemoresistance to chemotherapeutic drugs.
Abnormal metabolism is known to be a marker of human cancer progression and plays an important role in cancer progression and chemotherapy failure. Various experimental and clinical studies have shown that glucose metabolism, glutamate breakdown and fatty acid metabolism of Warburg Effect, which is dysregulated in cancer cell metabolic reprogramming, may contribute to tumor cell growth and chemotherapy failure, suggesting that abnormal metabolism is a promising target for cancer cell unique fragility and cancer therapy. Due to the adipocyte-rich microenvironment, the metabolism of epithelial ovarian cancer is unique to other cancers, where the breakdown of fatty acids is highly dependent to produce ATP and NADPH biosynthetic intermediates, contributing to the growth, metastasis and chemoresistance of epithelial ovarian cancer. For example, adipocytes promote the proliferation of metastatic cells by transferring fatty acids into highly activated tumor cells that are oxidized by Fatty Acids (FAO). Meanwhile, polyunsaturated fatty acids secreted by the platinum analogue-activated MSCs confer resistance to various chemotherapies to epithelial ovarian cancer by increasing the activity of fatty acid oxidation. All of these studies on the activation of fatty acid oxidation in epithelial ovarian cancer have generated profound insights and suggest that targeting fatty acid oxidation may be a potential clinical strategy for epithelial ovarian cancer. In addition, pharmacological inhibition using CPT inhibitors such as Etomovir (ETO for short ) and Teglicr (currently in clinical trials for diabetes treatment) has been tested, which show significant antitumor effects in various cancer types, such as lymphoma, leukemia, triple negative breast cancer and glioma. Therefore, studying the dependence of cancer cells on fatty acid metabolism would provide a potential personalized treatment for epithelial ovarian cancer patients.
Disclosure of Invention
The invention provides a sufficient theoretical basis for the combined treatment of chemotherapy of the epithelial ovarian cancer and the fatty acid oxidation inhibition drugs, finds preparation of one of clinical diagnosis markers of the epithelial ovarian cancer and a corresponding detection kit, and can combine the fatty acid beta oxidation inhibitor with the treatment of clinical chemotherapy drugs such as paclitaxel-cisplatin if the NKX2-8 gene deletion in a patient can be detected. The invention also finds that whether the epithelial ovarian cancer recurs or not is judged by detecting whether NKX2-8 is deleted or not and more importantly whether the expression level of several key enzymes for fatty acid beta oxidation is increased or not.
The invention aims to provide application of NKX2-8 as a tumor drug resistance detection target, a tumor prognosis detection target and a detection target for predicting tumor recurrence.
The invention further aims to provide application of the reagent for detecting NKX2-8 in preparing a tumor drug resistance detection kit, a tumor prognosis detection kit or a tumor recurrence prediction detection kit.
The invention also aims to provide application of the NKX2-8 protein or/and a substance for improving the expression of the NKX2-8 protein in preparing a medicament for improving the sensitivity of tumors to paclitaxel and/or cisplatin.
The invention further aims to provide application of the fatty acid oxidation inhibitor in preparing a medicine for treating NKX2-8 deficiency type tumors.
The invention further aims to provide application of the fatty acid oxidation inhibitor in preparing a medicament for improving the sensitivity of NKX2-8 deletion tumors to paclitaxel and/or cisplatin.
The invention further aims to provide application of the reagent for inhibiting the expression of CPT1A, ACADVL and/or ACSL1 in preparing a medicament for improving the sensitivity of NKX2-8 deletion-type tumors to paclitaxel and/or cisplatin.
The invention also aims to provide application of the reagent for detecting the expression level of CPT1A, ACADVL and/or ACSL1 in preparing a tumor drug resistance detection kit, a tumor prognosis detection kit or a tumor recurrence prediction detection kit.
The technical scheme adopted by the invention is as follows:
the NKX2-8 is used as tumor drug resistance detection target, tumor prognosis detection target and tumor recurrence prediction detection target, and the drugs in the tumor drug resistance comprise paclitaxel and cisplatin.
The reagent for quantitatively detecting NKX2-8 is applied to the preparation of a tumor drug resistance detection kit, or a tumor prognosis detection kit, or a detection kit for predicting tumor recurrence, wherein the drugs in the tumor drug resistance comprise paclitaxel and cisplatin.
Further, the reagent for quantitatively detecting the NKX2-8 is at least one selected from a reagent for detecting whether the NKX2-8 gene is deleted or mutated, a reagent for quantitatively detecting the RNA transcription level of NKX2-8 and a reagent for quantitatively detecting the protein expression level of NKX 2-8.
Furthermore, the reagent for detecting whether the NKX2-8 gene is deleted or mutated contains the primer of SEQ ID NO. 1-2 or the probe for detecting the NKX2-8 gene.
The NKX2-8 protein and/or the substance for improving the expression of the NKX2-8 protein are/is applied to the preparation of the medicine for improving the sensitivity of tumors to paclitaxel and/or cisplatin.
Application of fatty acid oxidation inhibitor and/or reagent for inhibiting expression of CPT1A, ACADVL and/or ACSL1 in preparation of drug for treating NKX2-8 deficiency tumor.
Application of fatty acid oxidation inhibitor or reagent for inhibiting expression of CPT1A, ACADVL and/or ACSL1 in preparation of medicine for improving sensitivity of NKX2-8 deletion tumor to paclitaxel and/or cisplatin.
Further, the fatty acid oxidation inhibitor comprises etomoxider, ticagrelor, pikecillin, ranolazine and trimetazid.
Further, the agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL1 is an siRNA sequence for silencing CPT1A, ACADVL and/or ACSL 1.
Further, siRNA sequences of silencing CPT1A, ACADVL and ACSL1 are respectively shown as SEQ ID NO. 3 and SEQ ID NO
NO. 4 and SEQ ID NO. 5.
The application of the reagent for detecting the expression level of CPT1A, ACADVL and/or ACSL1 in the preparation of a tumor drug resistance detection kit, or a tumor prognosis detection kit, or a detection kit for predicting tumor recurrence, wherein the drugs in the tumor drug resistance comprise paclitaxel and cisplatin.
A kit for detecting tumor resistance, tumor prognosis, or/and tumor recurrence prediction comprises a reagent for detecting NKX2-8, or/and a reagent for detecting CPT1A, ACADVL and/or ACSL1 expression level, wherein the drugs in the tumor resistance comprise paclitaxel and cisplatin.
Further, the reagent for quantitatively detecting the NKX2-8 is at least one selected from a reagent for detecting whether the NKX2-8 gene is deleted or mutated, a reagent for quantitatively detecting the RNA transcription level of NKX2-8 and a reagent for quantitatively detecting the protein expression level of NKX 2-8.
An agent for increasing the sensitivity of a tumor to paclitaxel and/or cisplatin, which comprises at least one of an NKX2-8 protein, a substance for increasing the expression of an NKX2-8 protein, a fatty acid oxidation inhibitor, and an agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL 1.
An agent for increasing the sensitivity of NKX 2-8-deficient tumor to paclitaxel and/or cisplatin, which comprises at least one of NKX2-8 protein, a substance for increasing the expression of NKX2-8 protein, a fatty acid oxidation inhibitor, and an agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL 1.
The invention has the beneficial effects that:
(1) the invention discovers that in the case of NKX2-8 deficiency, the body remarkably promotes the chemotherapy resistance and the relapse of tumors (such as epithelial ovarian cancer) by activating FAO pathway. The combination of the fatty acid oxidation inhibitor ETO of the invention makes NKX2-8 deficient epithelial ovarian cancer more sensitive to chemotherapeutic drugs. These results indicate that NKX2-8 plays an important role in chemoresistance and can be used as a novel therapeutic strategy for NKX 2-8-deficient tumors.
(2) The invention finds the application of the NKX2-8 gene in diagnosis, treatment and prognosis of epithelial ovarian cancer, and the invention finds that the NKX2-8 gene has certain deletion in epithelial ovarian cancer patients and is obviously related to the disease-free recurrence rate of the epithelial ovarian cancer patients. According to the invention, the NKX2-8 gene is found in epithelial ovarian cancer, and data TCGA (TCGA) and clinical sample analysis show that the deletion of the NKX2-8 gene is positively correlated with poor prognosis survival rate of patients with epithelial ovarian cancer, and is correlated with drug resistance of the epithelial ovarian cancer to chemotherapeutic drugs, which suggests that the NKX2-8 gene can be used as one of auxiliary diagnostic markers for prognosis of survival of patients. Through a series of in vivo and in vitro and PDX model experiments, the deletion of the NKX2-8 gene is found to be closely related to the drug resistance of the epithelial ovarian cancer to the chemotherapeutic drug paclitaxel-cisplatin chemotherapeutic drug. This suggests that the NKX2-8 gene can be used as one of the auxiliary detection markers for diagnosis and prognosis of patients with epithelial ovarian cancer. Furthermore, CHIP experimental analysis on the NKX2-8 gene shows that NKX2-8 has a very close relationship with apoptosis and beta oxidation of fatty acid, and the inhibition of the NKX2-8 gene can enhance the activity of mitochondrial fatty acid beta oxidation, and at the same time, the generation of drug resistance of fatty acid beta oxidation in ovarian cancer cells with NKX2-8 gene deletion is found to play an important role, and more importantly, in vivo and in vitro experiments show that the sensitivity of the treatment can be greatly enhanced by using the fatty acid beta oxidation inhibitor in combination with the chemotherapeutic drug paclitaxel-cisplatin to treat epithelial ovarian cancer. In conclusion, the research finds that NKX2-8 is an important inhibitor in epithelial ovarian cancer cells and has important significance in the development process of cancer. In addition, the deletion of the NKX2-8 gene can enhance the sensitivity of epithelial ovarian cancer cells to the chemotherapeutic drug paclitaxel-cisplatin. Whether NKX2-8 is deleted at the gene level in a cancer patient is detected, the kit can be used as an auxiliary diagnosis and/or prognosis judgment of the epithelial ovarian cancer cells, and can also provide sufficient theoretical support for the chemotherapy drugs and the fatty acid beta oxidation inhibitor to jointly treat the epithelial ovarian cancer cells. The invention provides a new diagnosis and treatment method and a drug screening platform for tumor diseases.
Drawings
FIG. 1 is a graph which shows the relationship between the deletion of NKX2-8 gene in patients with epithelial ovarian cancer and the deletion of NKX2-8 gene and the drug resistance and survival of patients; the results show that a considerable part of patients with epithelial ovarian cancer have the NKX2-8 gene deletion, and the NKX2-8 gene deletion is positively correlated with the tumor resistance and survival prognosis of the patients.
FIG. 2 is a graph for investigating the effect of the deletion of NKX2-8 gene on cis-platin resistance of epithelial ovarian cancer cells in an in vivo experiment; the results show that in an experimental mouse model, the deletion of NKX2-8 can promote the development of tumors and obviously change the drug resistance of mice to paclitaxel-cisplatin.
FIG. 3 is a graph for investigating the effect of the deletion of NKX2-8 gene on cis-platin resistance of epithelial ovarian cancer cells in an in vitro experiment; the results show that the NKX2-8 deletion promotes the growth of the epithelial ovarian cancer cells in various in vitro paclitaxel-cisplatin treatment experiments, thereby promoting the paclitaxel-cisplatin resistance of the epithelial ovarian cancer cells.
FIG. 4 is a graph that explores the regulatory pathways of the effect of the NKX2-8 gene on epithelial ovarian cancer cells; the result shows that the NKX2-8 deletion can remarkably promote the activation of a signal path of fatty acid beta oxidation and up-regulate the RNA and protein expression of a series of genes downstream of the signal path.
FIG. 5 is a graph that explores the effect of modulating fatty acid beta oxidation signaling pathway on drug resistance of epithelial ovarian cancer cells in the absence of the NKX2-8 gene; the results show that when the NKX2-8 gene is deleted, the drug resistance of the epithelial ovarian cancer cells can be remarkably reduced by using the inhibitor of fatty acid beta oxidation, and the apoptosis of the cancer cells is promoted.
FIG. 6 is a diagram for exploring the specific molecular mechanism of NKX2-8 gene for regulating fatty acid beta oxidation signaling pathway to influence drug resistance of epithelial ovarian cancer cells; the results show that the protein coded by NKX2-8 can inhibit the expression of a series of key genes (ACSL1, CPT1A and ACADVL) of fatty acid beta oxidation by binding to the promoters of the genes, so that the deletion of NKX2-8 can promote the fatty acid beta oxidation in the epithelial ovarian cancer cells, promote the generation of ATP and the removal of active oxygen to cause the drug resistance of the epithelial ovarian cancer cells, and at the moment, the drug resistance of the epithelial ovarian cancer can be reversed by using the inhibitor of the fatty acid beta oxidation.
Detailed Description
The NKX2-8 is used as tumor drug resistance detection target, tumor prognosis detection target and tumor recurrence prediction detection target, and the drugs in the tumor drug resistance comprise paclitaxel and cisplatin.
Preferably, the tumor comprises ovarian cancer.
Preferably, the ovarian cancer is epithelial ovarian cancer.
The application of a reagent for detecting NKX2-8 in preparing a tumor drug resistance detection kit, or a tumor prognosis detection kit, or a detection kit for predicting tumor recurrence, wherein drugs in the tumor drug resistance comprise paclitaxel and cisplatin.
Preferably, the reagent for quantitatively detecting NKX2-8 is at least one selected from the group consisting of a reagent for detecting whether the NKX2-8 gene is deleted or mutated, a reagent for quantitatively detecting the RNA transcription level of NKX2-8, and a reagent for quantitatively detecting the protein expression level of NKX 2-8.
Preferably, the reagent for quantitatively detecting NKX2-8 is a reagent for detecting whether the NKX2-8 gene is deleted or mutated.
Preferably, the reagent for detecting whether the NKX2-8 gene is deleted or mutated contains the primer shown in SEQ ID NO. 1-2 or the probe for detecting the NKX2-8 gene.
Preferably, the tumor comprises ovarian cancer.
Preferably, the ovarian cancer is epithelial ovarian cancer.
The NKX2-8 protein and/or the substance for improving the expression of the NKX2-8 protein are/is applied to the preparation of the medicine for improving the sensitivity of tumors to paclitaxel and/or cisplatin.
Preferably, the tumor comprises ovarian cancer.
Preferably, the ovarian cancer is epithelial ovarian cancer.
Application of fatty acid oxidation inhibitor or reagent for inhibiting expression of CPT1A, ACADVL and/or ACSL1 in preparation of medicine for treating NKX2-8 deletion type tumor.
Preferably, the tumor medicament also contains paclitaxel and/or cisplatin.
Application of fatty acid oxidation inhibitor or reagent for inhibiting expression of CPT1A, ACADVL and/or ACSL1 in preparation of medicine for improving sensitivity of NKX2-8 deletion tumor to paclitaxel and/or cisplatin.
Preferably, the fatty acid oxidation inhibitor comprises etomoxider, ticagrelor, pivampicillin, ranolazine, trimetazit.
Preferably, the tumor comprises ovarian cancer.
Preferably, the ovarian cancer is epithelial ovarian cancer.
Preferably, the agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL1 is an siRNA sequence for silencing CPT1A, ACADVL and/or ACSL 1.
Preferably, the sequences of siRNA silencing CPT1A, ACADVL and ACSL1 are shown as SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5 respectively.
The application of the reagent for detecting the expression level of CPT1A, ACADVL and/or ACSL1 in the preparation of a tumor drug resistance detection kit, or a tumor prognosis detection kit, or a detection kit for predicting tumor recurrence, wherein the drugs in the tumor drug resistance comprise paclitaxel and cisplatin.
Preferably, the reagent for detecting the expression level of CPT1A, ACADVL and/or ACSL1 comprises SEQ ID NO: 6 to 11.
A kit for detecting tumor resistance, tumor prognosis, or/and tumor recurrence prediction comprises a reagent for detecting NKX2-8, or/and a reagent for detecting CPT1A, ACADVL and/or ACSL1 expression level, wherein the drugs in the tumor resistance comprise paclitaxel and cisplatin.
Preferably, the reagent for quantitatively detecting NKX2-8 is at least one selected from the group consisting of a reagent for detecting whether the NKX2-8 gene is deleted or mutated, a reagent for quantitatively detecting the RNA transcription level of NKX2-8, and a reagent for quantitatively detecting the protein expression level of NKX 2-8.
Preferably, the reagent for detecting whether the NKX2-8 gene is deleted or mutated contains the primer shown in SEQ ID NO. 1-2 or the probe for detecting the NKX2-8 gene.
The tumor comprises ovarian cancer, and the ovarian cancer is epithelial ovarian cancer.
An agent for increasing the sensitivity of a tumor to paclitaxel and/or cisplatin, which comprises at least one of an NKX2-8 protein, a substance for increasing the expression of an NKX2-8 protein, a fatty acid oxidation inhibitor, and an agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL 1.
Preferably, the fatty acid oxidation inhibitor comprises etomoxider, ticagrelor, pivampicillin, ranolazine, trimetazit.
Preferably, the agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL1 is an siRNA sequence for silencing CPT1A, ACADVL and/or ACSL 1.
Preferably, the sequences of siRNA silencing CPT1A, ACADVL and ACSL1 are shown as SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5 respectively.
An agent for increasing the sensitivity of NKX 2-8-deficient tumor to paclitaxel and/or cisplatin, which comprises at least one of NKX2-8 protein, a substance for increasing the expression of NKX2-8 protein, a fatty acid oxidation inhibitor, and an agent for inhibiting the expression of CPT1A, ACADVL and/or ACSL 1.
The tumor comprises ovarian cancer, and the ovarian cancer is epithelial ovarian cancer.
The present invention will be further described with reference to the following examples.
The invention will be further elucidated with reference to the following specific embodiments. The experimental procedures for which specific conditions are not indicated in the following examples are generally carried out according to conventional conditions, such as those described in the molecular cloning instructions (third edition), or according to the manufacturer's recommendations.
Example 1: the NKX2-8 gene is deleted in EOC samples and causes tumor drug resistance
(1) Detection of deletion of NNKX2-8 Gene in clinical specimens of epithelial ovarian cancer
The method comprises the following steps: in 144 cases of clinical samples of EOC (Epithelial Ovarian Cancer), the expression values of the NKX2-8 gene at the DNA level and the protein level were detected by Fluorescence In Situ Hybridization (FISH) and Immunohistochemistry (IHC) experiments, and the related clinical information was analyzed and classified by the analysis results of 144 cases of clinical samples.
The primers used for detecting the copy number of the NKX2-8 gene at the DNA level are as follows:
NKX2-8-F：5’-AGACCCGGACCTCGGCTTTC-3’(SEQ ID NO：1)；
NKX 2-8-R: and 5'-CCTACGGATGGGCGTGGGAG-3' (SEQ ID NO: 2).
As a result: FISH assay results demonstrated that NKX2-8 has a deletion in 38% (55/144) of clinical EOC patients (as shown in FIG. 1-A). Immunohistochemistry experiments show that the EOC tissue with the deletion of NKX2-8 has lower expression level of NKX2-8 protein (as shown in figure 1-A).
And (4) conclusion: in clinical samples, NKX2-8 has a deletion rate of 38% in clinical EOC samples.
② in clinical samples, the loss of NKX2-8 can lead to a reduction in protein levels.
(2) Analysis of the influence of NKX2-8 deletion and low expression on survival prognosis of patients with epithelial ovarian cancer
The method comprises the following steps: among 144 clinical samples of EOC, the samples were classified into two groups, NKX 2-8-deleted (NKX2-8del) and NKX-8-Non-deleted (NKX2-8Non-del) based on the experimental results of FISH in (1) above, and the correlation between the samples and chemotherapy resistance (chemoresistance assay) was analyzed. The NKX 2-8-deleted (indicated as "weak/deleted" in FIG. 1) and NKX 2-8-non-deleted groups of patients were analyzed for prognosis of tumor survival and recurrence. 144 samples were divided into two groups of NKX 2-8-low expression (weak/non-deletion in FIG. 1, Weak/NKX 2-8) and NKX 2-8-high expression (strong/NKX2-8, strong/non-deletion in FIG. 1) based on the immunohistochemical results in (1), and the respective groups were analyzed for tumor recurrence.
As a result: the NKX2-8 deletion in clinical samples is found to be negatively correlated with the prognosis of 5-year survival of EOC patients (as shown in figure 1-B), more than 80% of clinical patients with NKX2-8 deletion are found to have resistance to chemotherapeutic drugs, while only about 30% of patients without NKX2-8 deletion have resistance to chemotherapeutic drugs (as shown in figure 1-C), and the result of the resistance enrichment analysis on the gene chip also shows that the NKX2-8 deletion is positively correlated with the resistance of the patients (as shown in figure 1-D). Analysis of the information on 144 clinical samples collected also revealed that the loss of NKX2-8 was of greater relevance to drug resistance in epithelial ovarian cancer patients (as shown in fig. 1-E), but not significantly to tumor histology, clinical staging of tumors, and distant metastasis of tumors in EOC patients. NKX 2-8-deficient group patients had shorter relapse-free survival times compared to the NKX 2-8-non-deficient group of EOC patients (as shown in FIG. 1-F). Patients in the NKX 2-8-low expression group had shorter relapse-free survival times than those in the EOC patients in the NKX 2-8-high expression group (as shown in FIG. 1-F).
And (4) conclusion: in clinical samples, the deletion of NKX2-8 results in chemotherapy resistance of EOC.
② in clinical samples, the lack or low expression of NKX2-8 can cause the recurrence of the tumor.
Example 2: in vivo experiments, NKX2-8 deletion/low expression can enhance paclitaxel/cisplatin resistance of epithelial ovarian cancer
(1) Selection for establishing ovarian cancer cell line for stably expressing NKX2-8
The method comprises the following steps: fluorescence In Situ Hybridization (FISH), Western Blot and Q-PCR experiments are carried out on the existing ovarian cancer cell strains IOSE80, SKOV3, A2780, CAOV3 and COV362 to detect the expression values of the NKX2-8 gene at the DNA level, the RNA level and the protein level.
As a result: in the FISH, Q-PCR and Western Blot detection of NKX2-8, the deletion rate of IOSE80 is low, the deletion rate of CAOV3 and COV362 is high, the deletion rate of SKOV3 and A2780 is moderate, and is close to the deletion rate of clinical sample cells of an EOC patient (shown in figure 2-A), and meanwhile, NKX2-8 is knocked out by using a CRISPR/Cas9 system to establish cell strains SKOV3-NKX2-8-gRNA # 1, SKOV3-NKX2-8-gRNA # 2, A2780-NKX2-8-gRNA # 1, A2780-NKX2-8-gRNA # 2 which stably express NKX2-8 genes and are low-expressed by two ovarian cancer cells of SKOV3 and A2780 (shown in figure 2-B).
And (4) conclusion: firstly, two ovarian cancer cells, namely SKOV3 and A2780, are selected to study the NKX2-8 gene.
Secondly, establishing a cell line with stable low expression of NKX 2-8.
(2) Tumor cell abdominal cavity planting mouse model
The method comprises the following steps: constructing a cell line stably expressing luciferase (luci) in two ovarian cancer cells, namely SKOV3 and A2780 screened in the step (1), and then, preparing SKOV3-luci (a control group) and SKOV3-NKX2-8-gRNA #1-luci, SKOV3-NKX2-8-gRNA #2-luci and A2780-luci (control group), A2780-NKX2-8-gRNA #1-luci, A2780-NKX2-8-gRNA #2-luci cells were planted into the abdominal cavity of NOD SCID mice, respectively (1 10)6Cell/cell). When the mouse tumor fluorescence value reaches 2 x 107p/sec/cm2At/sr, mice were initially treated with paclitaxel/cisplatin, and mice were dosed every three days with 5mg/kg cisplatin and weekly with 10mg/kg paclitaxel at a dose and treatment time of normal chemotherapy, and mice in each group were assayed for survival by plotting fluorescence values from each group taken and recorded weekly using In Vivo Imaging System (IVIS).
② female NOD SCID mice were inoculated intraperitoneally with 500 EOC cells and treated with paclitaxel/cisplatin for 6 weeks. The survival level of each group of mice was analyzed by plotting the fluorescence values of each group after weekly imaging and recording using a living body imaging system (IVIS) for 18 weeks of chemotherapy.
As a result: in experimental mice, the low expression of NKX2-8 can obviously reduce the tumor inhibition effect of paclitaxel/cisplatin (as shown in figure 2-C and figure 2-D) along with the increase of time; meanwhile, the survival rate of the mice with low NKX2-8 expression is obviously reduced compared with the control group (as shown in figure 2-E). When female NOD SCID mice were inoculated with 500 EOC cells intraperitoneally and treated with paclitaxel/cisplatin for 6 weeks, mice with low expression of NKX2-8 gradually showed more obvious tumor cell masses in 18 weeks of chemotherapy, which also indicates that the tumor inhibition effect of paclitaxel/cisplatin can be significantly reduced by low expression of NKX2-8 (as shown in FIGS. 2-F and 2-G).
And (4) conclusion: in vivo experiments, the deletion/low expression of NKX2-8 can enhance the chemotherapy resistance of EOC to paclitaxel/cisplatin.
(3) Detecting the expression of tumor apoptosis index in mice
The method comprises the following steps: after the tumor tissues in the abdominal cavity of the mice of each group in (2) above were taken out, the sections were embedded, and TUNEL immunofluorescence staining (DNA damage indication experiment) was performed to quantify the experimental results of each group of sections and to perform statistical analysis.
As a result: the experimental results show that the deletion/low expression of NKX2-8 can inhibit the apoptosis of tumor cells in mice, and the statistical difference is obvious (as shown in figure 2-F).
And (4) conclusion: in vivo experiments, the deletion/low expression of NKX2-8 can enhance the chemotherapy resistance of EOC to paclitaxel/cisplatin by inhibiting apoptosis of cells.
Example 3: in vitro, NKX2-8 deletion/under-expression enhanced paclitaxel/cisplatin resistance in epithelial ovarian cancer.
The method comprises the following steps: the proportion of apoptosis of NKX2-8 deletion/under expression after paclitaxel/cisplatin (5. mu.M) treatment was examined by Annexin V flow cytometry. The plate colony formation assay was used to examine the growth of NKX2-8 deletion/under expression after paclitaxel/cisplatin (5. mu.M) treatment. Half maximal inhibitory concentration (IC50) of each group of cells was examined to show the effect of NKX2-8 expression level on paclitaxel/cisplatin resistance and statistically analyzed.
As a result: in the stable cell line in the experiment, after paclitaxel/cisplatin, the NKX2-8 deletion/low expression obviously inhibits the apoptosis of the tumor cells (shown in figure 3-A) and promotes the growth of the tumor cells (shown in figure 3-B). Meanwhile, the deletion/underexpression of NKX2-8 significantly increased the IC50 concentration of paclitaxel/cisplatin in tumor cells (as shown in FIGS. 3-C, 3-D).
And (4) conclusion: in vitro, NKX2-8 deletion/underexpression can enhance the chemotherapy resistance of epithelial ovarian cancer to paclitaxel/cisplatin.
Example 4: deletion of NKX2-8 promotes mitochondrial Fatty Acid Oxidation (FAO)
The method comprises the following steps: high throughput sequencing data analyzed molecules that NKX2-8 bound and regulated. Genes related to NKX2-8 were enriched by analyzing CHIP experimental results and sequencing data of NKX 2-8. Simultaneously, the NKX2-8 is subjected to GSEA database analysis, and the corresponding cell metabolites are subjected to experimental detection. WB and Q-PCR experiments further detect the expression of three genes, namely CPT1A, ACADVL and ACSL1, when the NKX2-8 gene is deleted/low expressed. Wherein, the primers for detecting the expression quantity of three genes of CPT1A, ACADVL and ACSL1 by Q-PCR are respectively:
CPT1A-F:5’-GCCTCGTATGTGAGGCAAAA-3’(SEQ ID NO：6)，
CPT1A-R:5’-TCATCAAGAAATGTCGCACG-3’(SEQ ID NO：7)；
ACADVL-F:5’-ACGGGCGTACTGGGTGTT-3’(SEQ ID NO：8)，
ACADVL-R:5’-ATGGTGGAGGAGACCACTTG-3’(SEQ ID NO：9)；
ACSL1-F:5’-GCTTGCATTGTCCTGTGTTG-3’(SEQ ID NO：10)，
ACSL1-R:5’-GGAGTGGGCTGCAGTGAC-3’(SEQ ID NO：11)。
as a result: a considerable number of genes were enriched near the Transcription Start Site (TSS) of NKX2-8 (as shown in FIG. 4-A). The gene ontology enrichment analysis showed that genes with the biological process terms "apoptosis signaling pathway", "response to cisplatin" and "response to docetaxel" were enriched, while genes with GO terms such as "long chain fatty acid import", "fatty acid β -oxidation" and "fatty acid β -oxidation using acyl-coa dehydrogenase" (as shown in figure 4-B) were also enriched with similar results observed in public database GSEA using enrichment analysis (as shown in figure 4-C). Meanwhile, cellular metabolites of SKOV3 and a2780 were examined to show that higher amounts of long-chain acylcarnitine intermediates and production levels of acetyl-coa, NAD, NADP and ATP were significantly increased in NKX2-8 deficient EOC cells (as shown in fig. 4-D, 4-E). Analysis of the NKX2-8ChIP-seq results showed that 16 key components in the fatty acid beta oxidation pathway are likely to be downstream targets of the NKX2-8 gene (as shown in FIG. 4-F). The ChIP assay further confirmed that NKX2-8 was most significantly associated with CPT1A, ACADVL and ACSL1 promoters in EOC cells (as shown in FIGS. 4-G). The WB and Q-PCR experiments further show that when the NKX2-8 gene is deleted/underexpressed, the expressions of the three genes CPT1A, ACADVL and ACSL1 are obviously increased compared with the control group (as shown in FIGS. 4-H and 4-I). The negative correlation of NKX2-8 with Fatty Acid Oxidation (FAO) activity was further confirmed by immunohistochemical experimental analysis in EOC specimens, with low expression of CPT1A, ACADVL and ACSL1 in the high expression of NKX2-8 EOC sample type I, and high expression of CPT1A, ACADVL and ACSL1 in the low expression of NKX2-8 EOC sample type II (as shown in FIG. 4-J). Silencing of CPT1A, ACADVL and ACSL1 abolished the effect of NKX2-8 deletion on the promotion of fatty acid beta-oxidation activity and ATP production (FIG. 4-K).
And (4) conclusion: deletion of NKX2-8 in ovarian cancer cells promotes mitochondrial fatty acid beta oxidation mainly by increasing expression of three genes, CPT1A, ACADVL and ACSL 1.
Example 5: in vivo experiments, fatty acid beta oxidation is crucial to NKX2-8 gene deletion-mediated chemoresistance of ovarian cancer cells to chemotherapeutic drugs.
The method comprises the following steps: the effect of fatty acid beta oxidation on NKX2-8 gene deletion-mediated ovarian cancer patients was first analyzed in the TCGA database. Furthermore, the paclitaxel/cisplatin-deprocessed NKX2-8 cell line with low expression/deletion is utilized to study the apoptosis condition and the expression condition of the key protein of the apoptosis-related signal pathway.
As a result: in the analysis of relevant data for TCGA, we identified a set of seven key genes for fatty acid beta oxidation that was highly correlated with shorter relapse-free survival in EOC patients receiving paclitaxel/cisplatin (TP) chemotherapy (as shown in figure 5-a). These results indicate that activation of the fatty acid beta oxidation signaling pathway may contribute to chemotherapy failure in EOC patients. As expected, the blockade of the fatty acid beta oxidation signaling pathway by CPT1A, ACADVL and ACSL1 alone largely eliminated the NKX2-8 gene deletion-induced chemoresistance (as shown in FIG. 5-B). Furthermore, in NKX2-8 deficient/silenced cells, the use of fatty acid beta oxidation inhibitors such as ETO (etomoxir), tegricar (tegaserod), Perhexiline (pivirin), Ranolazine (Ranolazine) or trimetazidine (trimetazidine) decreased the activity of the fatty acid beta oxidation signaling pathway, decreased ATP production and Oxygen Consumption Rate (OCR) more, but resulted in increased ROS levels compared to control cells (as shown in fig. 5-C, 5-D, 5-E). Furthermore, we found that inhibition of the fatty acid beta oxidation signaling pathway by ETO significantly inhibited the Akt and m-TOR/S6K signaling pathways, but increased p-Bad expression, in cells with low expression/deletion of NKX2-8, which resulted in more cytochrome c release and increased activated caspase 3 (as shown in FIG. 5-F). Furthermore, ETO treatment significantly increased the cytotoxic effects of paclitaxel/cisplatin in NKX2-8 low expressing/deleted cells, but paclitaxel/cisplatin had less toxic effects in NKX2-8 non-deleted cells (as shown in figures 5-G, 5-H, 5-I). In addition, analysis of drug combination effect index further confirmed that FAO inhibitor and paclitaxel/CDDP have synergistic antitumor effect in NKX2-8 deleted EOC cells (not NKX2-8 non-deleted cells) (as shown in FIG. 5-J).
The RNA sequences of the silent CPT1A, ACADVL and ACSL1 are respectively as follows:
CPT1A-si:GACAACGAUGUACGCCAAGAU(SEQ ID NO：3)；
ACADVL-si:CUUUGCCAAGACGCCAAUUAA(SEQ ID NO：4)；
ACSL1-si:GCCAAAUGUAUUUCAGGGCUA(SEQ ID NO：5)；
and (4) conclusion: in vitro experiments, the fatty acid beta oxidation signaling pathway plays a crucial role in NKX2-8 deletion-mediated paclitaxel/cisplatin chemical resistance in ovarian cancer cells.
Example 6: in vivo experiments, the activity of the inhibitory fatty acid beta oxidation signaling pathway sensitizes NKX-2-8 deficient EOC to paclitaxel/CDDP treatment.
The method comprises the following steps: in the tumor cell abdominal cavity implantation mouse model established in the above example 2, the effect on mice under different conditions was studied by using a paclitaxel/cisplatin chemotherapeutic drug in combination with an inhibitor of a fatty acid β oxidation signaling pathway, and then the survival level of each group of mice was analyzed by plotting fluorescence values of each group after weekly photographing and recording by using an In Vivo Imaging System (IVIS).
As a result: in experimental mice, the therapeutic effect of inhibiting the fatty acid beta oxidation signaling pathway with the inhibitor ETO of the fatty acid beta oxidation signaling pathway was tested in EOC mice over time. Consistent with the results of in vitro experiments, the effect of combined treatment of the inhibitor ETO of the fatty acid beta oxidation signaling pathway and paclitaxel/cisplatin remarkably improves the curative effect of paclitaxel/cisplatin on the growth of tumors with low expression/deletion of NKX2-8 gene, and prolongs the survival time of tumor-bearing mice (as shown in FIGS. 6-A and 6-B). Summarizing the above key experimental results, it was demonstrated that signals inhibiting fatty acid oxidation in NKX2-8 deficient epithelial ovarian cancer could enhance the response signaling pathway to the chemotherapeutic effect of this tumor (as shown in figure 6-C).
And (4) conclusion: the combination of an inhibitor of the fatty acid beta oxidation signaling pathway and paclitaxel/cisplatin sensitizes NKX-2-8 deficient EOC patients to paclitaxel/cisplatin chemotherapy.
To summarize: according to the invention, the NKX2-8 gene is found in epithelial ovarian cancer, and data TCGA (TCGA) data and clinical sample analysis show that the deletion of the NKX2-8 gene is positively correlated with poor prognosis survival rate of patients with epithelial ovarian cancer, and is correlated with drug resistance of the epithelial ovarian cancer to chemotherapeutic drugs, which suggests that the NKX2-8 gene can be used as one of auxiliary diagnostic markers for prognosis of survival of patients. Through a series of in vivo and in vitro and PDX model experiments, the deletion of the NKX2-8 gene is found to be closely related to the drug resistance of the epithelial ovarian cancer to the chemotherapeutic drug paclitaxel-cisplatin chemotherapeutic drug. This suggests that the NKX2-8 gene can be used as one of the auxiliary detection markers for diagnosis and prognosis of patients with epithelial ovarian cancer. Furthermore, CHIP experimental analysis on the NKX2-8 gene shows that NKX2-8 has a very close relationship with apoptosis and beta oxidation of fatty acid, and the inhibition of the NKX2-8 gene can enhance the activity of mitochondrial fatty acid beta oxidation, and at the same time, the generation of drug resistance of fatty acid beta oxidation in ovarian cancer cells with NKX2-8 gene deletion is found to play an important role, and more importantly, in vivo and in vitro experiments show that the sensitivity of the treatment can be greatly enhanced by using the fatty acid beta oxidation inhibitor in combination with the chemotherapeutic drug paclitaxel-cisplatin to treat epithelial ovarian cancer. In conclusion, the research finds that NKX2-8 is an important inhibitor in epithelial ovarian cancer cells and has important significance in the development process of cancer. In addition, the deletion of the NKX2-8 gene can enhance the sensitivity of epithelial ovarian cancer cells to the chemotherapeutic drug paclitaxel-cisplatin. Whether NKX2-8 is deleted at the gene level in a cancer patient is detected, the kit can be used as an auxiliary diagnosis and/or prognosis judgment of the epithelial ovarian cancer cells, and can also provide sufficient theoretical support for the chemotherapy drugs and the fatty acid beta oxidation inhibitor to jointly treat the epithelial ovarian cancer cells. The invention provides a new diagnosis and treatment method and a drug screening platform for tumor diseases.
In conclusion, the gene NKX2-8 can be used as a tumor drug resistance detection target, a tumor prognosis detection target and a tumor recurrence prediction detection target. Therefore, corresponding tumor drug resistance detection kits, tumor prognosis detection kits and tumor recurrence prediction detection kits can be prepared, and the kits contain reagents for detecting whether the NKX2-8 gene is deleted or mutated, reagents for quantitatively detecting the RNA transcription level of NKX2-8, reagents for quantitatively detecting the protein expression level of NKX2-8 and the like. Whether the patient has chemotherapy resistance to cis-platin/paclitaxel treatment is judged by detecting the gene copy number, RNA and protein expression level of NKX2-8 in the tumor tissues of the patient to determine whether NKX2-8 is deleted. Whether the patient has a high recurrence tendency is judged by detecting the gene copy number of NKX2-8 in the tumor tissues of the patient to determine whether NKX2-8 is deleted. The NKX2-8 deletion is determined by detecting the gene copy number of NKX2-8 in tumor tissues of patients, so that the combination treatment scheme of the fatty acid oxidation inhibitor and cisplatin/paclitaxel is established for the NKX 2-8-deleted patients to achieve the treatment effect.
It will be readily understood by those skilled in the art that the foregoing is only a preferred embodiment of this invention and is not intended to limit the invention, and that any modification, equivalent replacement or improvement made within the spirit and principle of the invention will fall within the protection scope of the claims.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> Zhongshan university
GUANGZHOU JIEERKE BIOTECHNOLOGY Co.,Ltd.
Application of <120> NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor
<130>
<160> 11
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
agacccggac ctcggctttc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 21
<212> RNA
<213> Artificial sequence
<400> 3
<210> 4
<211> 21
<212> RNA
<213> Artificial sequence
<400> 4
cuuugccaag acgccaauua a 21
<210> 5
<211> 21
<212> RNA
<213> Artificial sequence
<400> 5
gccaaaugua uuucagggcu a 21
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
<210> 11
<211> 18
<212> DNA
<213> Artificial sequence
<400> 11
Claims (3)
1. The application of a reagent for quantitatively detecting NKX2-8 in preparing a tumor drug resistance detection kit, or a tumor prognosis detection kit, or a detection kit for predicting tumor recurrence, wherein the drug in the tumor drug resistance is selected from paclitaxel and cisplatin;
the tumor is selected from ovarian cancer.
2. The use of claim 1, wherein the reagent for quantitatively detecting NKX2-8 is at least one selected from the group consisting of a reagent for detecting whether the NKX2-8 gene is deleted or mutated, a reagent for quantitatively detecting the RNA transcription level of NKX2-8, and a reagent for quantitatively detecting the protein expression level of NKX 2-8.
3. The use of claim 2, wherein the reagent for detecting deletion or mutation of NKX2-8 gene comprises the primers of SEQ ID NOS: 1-2 or the probe for detecting NKX2-8 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810142442.8A CN108410983B (en) | 2018-02-11 | 2018-02-11 | Application of NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810142442.8A CN108410983B (en) | 2018-02-11 | 2018-02-11 | Application of NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108410983A CN108410983A (en) | 2018-08-17 |
| CN108410983B true CN108410983B (en) | 2021-08-17 |
Family
ID=63128544
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810142442.8A Active CN108410983B (en) | 2018-02-11 | 2018-02-11 | Application of NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108410983B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012142330A1 (en) * | 2011-04-15 | 2012-10-18 | Brown University | Micro rnas as diagnostic biomarkers and therapeutics for ovarian cancer and metastatic tumors that disseminate within the peritoneal cavity |
| CN104762375A (en) * | 2015-03-13 | 2015-07-08 | 中山大学肿瘤防治中心 | Application of POU5F1B in diagnosis, treatment, prognosis and relapse prediction of tumor |
-
2018
- 2018-02-11 CN CN201810142442.8A patent/CN108410983B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012142330A1 (en) * | 2011-04-15 | 2012-10-18 | Brown University | Micro rnas as diagnostic biomarkers and therapeutics for ovarian cancer and metastatic tumors that disseminate within the peritoneal cavity |
| CN104762375A (en) * | 2015-03-13 | 2015-07-08 | 中山大学肿瘤防治中心 | Application of POU5F1B in diagnosis, treatment, prognosis and relapse prediction of tumor |
Non-Patent Citations (7)
| Title |
|---|
| Activation of AMP-activated protein kinase signaling pathway by adiponectin and insulin in mouse adipocytes: requirement of acyl-CoA synthetases FATP1 and Acsl1 and association with an elevation in AMP/ATP ratio;Qingqing Liu等;《Research Communication》;20101130;第24卷;第4229-4239页 * |
| Carnitine palmitoyltransferase 1A (CPT1A): a transcriptional target of PAX3-FKHR and mediates PAX3-FKHR–dependent motility in alveolar rhabdomyosarcoma cells;Lingling Liu等;《BMC Cancer》;20121231;第12卷(第154期);第1-12页 * |
| Carnitine palmitoyltransferase 1A functions to repress FoxO transcription factors to allow cell cycle progression in ovarian cancer;Huanjie Shao等;《Oncotarget》;20151224;第7卷(第4期);第3832-3846页 * |
| Comparative proteomics analysis reveals roles for FADD in the regulation of energy metabolism and proteolysis pathway in mouse embryonic fibroblast;Hongqin Zhuang等;《Proteomics》;20131231;第13卷;第2398-2431页 * |
| NKX2-8 deletion-induced reprogramming of fatty acid metabolism confers chemoresistance in epithelial ovarian cancer;Jinrong Zhu等;《EBioMedicine》;20190429;第43卷;第238–252页 * |
| Nkx2-8 Downregulation Promotes Angiogenesis and Activates NF-kB in Esophageal Cancer;Chuyong Lin等;《Cancer Res》;20130419;第73卷(第12期);第3638-3648页 * |
| The tumor-suppressor gene Nkx2.8 suppresses bladder cancer proliferation through upregulation of FOXO3a and inhibition of the MEK/ERK signaling pathway;Chunping Yu等;《Carcinogenesis》;20120104;第33卷(第3期);第678-686页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108410983A (en) | 2018-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xu et al. | Hypoxia induces drug resistance in colorectal cancer through the HIF-1α/miR-338-5p/IL-6 feedback loop | |
| EP3237638B1 (en) | Therapeutic, diagnostic and prognostic methods for cancer of the bladder | |
| Wang et al. | Elevated Expression of Zinc Finger Protein 703 Promotes Cell Proliferation and Metastasis through PI3K/AKT/GSK-3β Signalling in Oral Squamous Cell Carcinoma. | |
| CN112522394B (en) | Novel exosome release related target and application thereof in tumor monitoring and inhibition | |
| Shin et al. | CC motif chemokine receptor 1 (CCR1) is a target of the EGF-AKT-mTOR-STAT3 signaling axis in breast cancer cells | |
| Li et al. | S100A16 induces epithelial-mesenchymal transition in human PDAC cells and is a new therapeutic target for pancreatic cancer treatment that synergizes with gemcitabine | |
| Zhang et al. | HOTAIR maintains the stemness of ovarian cancer stem cells via the miR-206/TBX3 axis | |
| Han et al. | Omental cancer‐associated fibroblast‐derived exosomes with low microRNA‐29c‐3p promote ovarian cancer peritoneal metastasis | |
| Yang et al. | RETRACTED ARTICLE: Involvement of NORAD/miR-608/STAT3 axis in carcinostasis effects of physcion 8-O-β-glucopyranoside on ovarian cancer cells | |
| Wu et al. | Aurora-A induces chemoresistance through activation of the AKT/mTOR pathway in endometrial cancer | |
| Sheng et al. | Correlation between LncRNA‐LINC00659 and clinical prognosis in gastric cancer and study on its biological mechanism | |
| Venkata et al. | KDM1A inhibition augments the efficacy of rapamycin for the treatment of endometrial cancer | |
| Jandova et al. | Vemurafenib Drives Epithelial-to-Mesenchymal Transition Gene Expression in BRAF Inhibitor‒Resistant BRAFV600E/NRASQ61K Melanoma Enhancing Tumor Growth and Metastasis in a Bioluminescent Murine Model | |
| Liu et al. | α-Enolase lies downstream of mTOR/HIF1α and promotes thyroid carcinoma progression by regulating CST1 | |
| Li et al. | Aberrant super-enhancer-driven oncogene ENC1 promotes the radio-resistance of breast carcinoma | |
| Duan et al. | IGF2BPs as novel m6A readers: Diverse roles in regulating cancer cell biological functions, hypoxia adaptation, metabolism, and immunosuppressive tumor microenvironment | |
| CN104726584B (en) | Applications of the miR 425 in the diagnosis, treatment and prognosis of tumour | |
| CN112516317B (en) | Pharmaceutical composition for preventing and treating cancer and application thereof | |
| Liu et al. | STNM1 in human cancers: role, function and potential therapy sensitizer | |
| CN108410983B (en) | Application of NKX2-8 in tumor drug resistance detection and application of FAO inhibitor in NKX2-8 deletion tumor | |
| Jian et al. | Inhibition of APE1 Expression Enhances the Antitumor Activity of Olaparib in Triple‐Negative Breast Cancer | |
| Xia et al. | LncRNA DiGeorge syndrome critical region gene 5: a crucial regulator in malignant tumors | |
| Wang et al. | PBOV1 correlates with progression of ovarian cancer and inhibits proliferation of ovarian cancer cells | |
| Dong et al. | Downregulation of miRNA-14669 reverses vincristine resistance in colorectal cancer cells through PI3K/AKT signaling pathway | |
| Yang et al. | Expression of CDK9 in endometrial cancer tissues and its effect on the proliferation of HEC-1B |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |