CN107815457B

CN107815457B - Separated adelphocoris suturalis delta 9-desaturase gene and protein coded by same

Info

Publication number: CN107815457B
Application number: CN201610820459.5A
Authority: CN
Inventors: 陈利珍; 罗静; 李哲; 马超; 金双侠; 雷朝亮
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2016-09-13
Filing date: 2016-09-13
Publication date: 2020-09-29
Anticipated expiration: 2036-09-13
Also published as: CN107815457A

Abstract

The invention belongs to the technical field of insect gene engineering, and particularly relates to a separated adelphocoris suturalis delta 9-desaturase gene and a protein coded by the same. The nucleotide sequence of the separated adelphocoris suturalis delta 9-desaturase gene is shown as SEQ ID NO: 1, and the coded protein sequence is shown as SEQ ID NO: 2, respectively. The invention also comprises application of the adelphocoris suturalis delta 9-desaturase gene as an RNA interference sequence, and the sequence has a good silencing effect on the adelphocoris suturalis delta 9-desaturase gene. The injection of the interference sequence obviously increases the content of pheromone component 4-oxo-trans-2-hexenal, changes the mixing ratio of pheromone and obviously inhibits the attraction of female insects to male insects. Further, the protein of the invention can be developed as a biological pheromone, or can be used for developing a transgenic insect-resistant plant and used for biological control of adelphocoris suturalis.

Description

Separated adelphocoris suturalis delta 9-desaturase gene and protein coded by same

Technical Field

The invention relates to the technical field of insect gene engineering. In particular to a separated adelphocoris suturalis delta 9-desaturase gene and a protein coded by the same. The invention also comprises the application of the RNA interference sequence of the adelphocoris suturalis delta 9-desaturase gene, and the RNA interference sequence of the delta 9-desaturase gene can be used for developing transgenic insect-resistant plants through biological verification.

Background

Adelphocoris suturalis (Adelphocoris suturalis) belongs to the family of plant bug of the order Hemiptera (Hemiptera: Miridae), is a polyphagia pest, and there are 270 currently documented host plants that are avid to cotton, wheat, soybean, alfalfa, etc. (zingiber officinale et al, 2015). Since the transgenic Bt cotton is commercially planted in 1997, the population number of lygus lucorum fields is greatly increased due to the rapid reduction of the usage amount of chemical pesticides, and the lygus lucorum gradually rises to be a main pest from the original secondary pest (Lu et al, 2008; Lu et al, 2010), and becomes an important pest in cotton planting areas in China. Currently, chemical control is mainly used for controlling lygus sinensis (Liu Jie Qing et al, 2007). Because the lygus lucorum is relatively hidden, the lygus lucorum moves quickly and is easy to be transferred, and the control effect of chemical agents is seriously influenced (Xuwenhua and the like, 2007). Meanwhile, the long-term use of a large amount of chemical pesticides also causes the problems of drug resistance, natural enemies killing, ecological balance destruction, environmental pollution, threat to human and animal health and the like. Therefore, the development and utilization of pollution-free control measures which accord with the concepts of environmental protection, health and continuous development are the main development direction of the future lygus prevention and control.

The semiochemicals are used as important media for identification and communication in or among insect species, have high species specificity, regulate and control actions of mating, feeding, oviposition, defense, aggregation and the like of insects, and have a decisive effect on survival and development of insect populations. Because the pheromone has the advantages of high efficiency, no toxicity, environmental friendliness, strong targeting property and the like, the pheromone components are separated and identified, the functions of the components are understood, the mechanism of pheromone biosynthesis and regulation is read, and the key points in the process of insect pheromone exchange evolution are researched by vast researchers in decades. Since the first insect sex pheromone, serinol (Bombykol), was identified and purified by Butenaudt and Karlson (1959), over 2000 species of insect pheromone components have been identified (online statistics, the Phenobase, http:// www.pherobase.com), and the molecular mechanisms of pheromone biosynthesis have also been extensively studied and reported in lepidopteran insects.

The Desaturase is catalyticThe main enzymes for unsaturated reaction exist in various eukaryotes, and include: animals, plants, yeasts, fungi, and various bacteria (Los and Murata, 1998; Sperling et al, 2003). The function of the fatty acyl complex is to introduce carbon-carbon double bonds into specific sites of the fatty acyl to generate various unsaturated fatty acids, and the fatty acyl complex plays an important role in basic life activities such as lipid metabolism, cell signal transduction, and maintenance of cell membrane fluidity (Hazel and Williams, 1990; Vigh et al, 1993; Pyre and Pyre, 2000; Miyazaki and Ntambi, 2003). Additionally, Desaturase is involved in the synthesis of pheromones in many insects (Knipple et al, 2002; Roelofsand Rooney, 2003;

et al, 2013), which achieve diversity of pheromone components by catalyzing the formation of double bonds of different spatial configurations (Z-type or E-type) at different sites, have been shown to be key enzymes in the communication evolution of some lepidopteran and dipteran pheromones (Knipple et al, 2002;

et al.,2015)。

at present, the related research on pheromones of lygus, even hemiptera insects is still in the stage of pheromone component identification, and only a few documents are speculated about the molecular mechanism of pheromone biosynthesis, and no clear report is found.

Disclosure of Invention

The invention aims to overcome the defects of the existing control method and provide a separated adelphocoris suturalis delta 9-desaturase gene and a protein coded by the same, wherein the gene comprises an RNA interference sequence of the gene, and a technical basis is provided for disturbing a sex pheromone communication system of adelphocoris suturalis by utilizing the delta 9-desaturase and controlling the development of the population of the adelphocoris suturalis.

According to the invention, the RNA interference technology is adopted, and the expression of the delta 9-desaturase gene of the adelphocoris suturalis is inhibited through injecting dsRNA of the delta 9-desaturase gene interference sequence in vitro, so that the content of 4-oxo-trans-2-hexenal serving as a pheromone component is changed, and the attraction capability of females to males is obviously inhibited. The invention discovers that the delta 9-desaturase participates in the biosynthesis of the adelphocoris suturalis pheromone for the first time, provides a technical basis for controlling the development of the population of the adelphocoris suturalis through interfering the sex pheromone communication system of the adelphocoris suturalis, and finally realizes the purpose of green pest control, and also provides help for further understanding the molecular mechanism of the biosynthesis of the semiptera insect pheromone.

The invention is realized by the following technical scheme:

the applicant separates a adelphocoris suturalis delta 9-desaturase gene, and the cDNA sequence of the gene is shown as SEQ ID NO: 1, the total length of the sequence is 1077 bp.

The applicant separates a protein coded by a adelphocoris suturalis delta 9-desaturase gene, and the protein sequence of the protein is shown as SEQ ID NO: 2, encodes 358 amino acid residues.

Based on the separation and cloning of the genes, the invention also provides an RNA interference sequence of the delta 9-desaturase gene, wherein the interference sequence is a double-stranded RNA molecule, dsRNA of the sequence is synthesized in vitro by using a specific primer and is injected into a newly-feathered female lygus bugus in a micro-injection manner, and the result shows that the sequence can obviously inhibit the expression of the delta 9-desaturase gene. Further researching the influence of the silent delta 9-desaturase gene on the attraction capacity of the female adelphocoris suturalis and the pheromone titer of the female adelphocoris suturalis, and finding out that the inhibition of the expression of the delta 9-desaturase gene obviously reduces the attraction capacity of the female adelphocoris suturalis on male adelphocoris suturalis, and changes the content of the pheromone component 4-oxo-trans-2-hexenal. The interference sequence can be applied to development of transgenic plant resistant to adelphocoris suturalis.

The sequences of the synthetic dsRNA-specific primers were as follows:

upstream primer ds. DELTA.9-des-F: CTATAGCGATGGCCCCCAAC

The downstream primer ds delta 9-des-R: GCAATCTCAGAGGGAGCCTG are provided.

The invention has the following positive beneficial effects:

(1) the invention discovers for the first time that the delta 9-desaturase gene participates in the synthesis process of the adelphocoris suturalis pheromone, the content of (E) -4-oxo-2-hexenal, which is one of main components of the adelphocoris suturalis pheromone, is remarkably increased after the delta 9-desaturase gene is silenced, the mixing ratio of the adelphocoris suturalis pheromone components is changed, and the attraction capability of female insects to males is finally reduced.

(2) As a plurality of lygus insects contain (E) -4-oxo-2-hexenol which is a pheromone component (on-line data statistics, the Phenobase, http:// www.pherobase.com), the gene can be used for developing and controlling various lygus insect products.

(3) The invention provides an interference sequence of adelphocoris suturalis delta 9-desaturase gene, which can obviously inhibit the expression of the delta 9-desaturase gene, can control the development of the population by using the regulation and control effect of the delta 9-desaturase gene on a sex pheromone communication system of adelphocoris suturalis, can be used for developing environment-friendly insect-resistant plants, and finally achieves the purpose of green pest control.

(4) By using gene engineering technology, exogenous gene can be introduced into the carrier of plant expression, and the gene capable of interfering normal expression can be introduced into plant cell, so that the insect-resistant transgenic cell and transgenic plant can be obtained.

Drawings

Sequence listing SEQ ID NO: 1 is the nucleotide sequence of the adelphocoris suturalis delta 9-desaturase gene, and the whole sequence length is 1077 bp. Wherein 1-1077bp of the sequence is the coding region of the gene.

Sequence listing SEQ ID NO: 2 is the protein sequence of adelphocoris suturalis delta 9-desaturase gene, and codes 358 amino acid residues.

FIG. 1: a functional verification flow chart of influence of the delta 9-desaturase gene on biosynthesis of the adelphocoris suturalis pheromone.

FIG. 2: the pEASY-T1 cloning vector structure is shown schematically.

FIG. 3: efficiency of silencing of the Δ 9-desaturase gene in the adipose body (FB) and the posterior thoracic gland (MTG), respectively, after injection of dsRNA of the Δ 9-desaturase gene. Where "ns" indicates no significant difference, "+" indicates p <0.05 and "+" indicates p < 0.01.

FIG. 4: after injection of dsRNA of the delta 9-desaturase gene, the male attractant capacity of the female is changed. Description of reference numerals: graph a in fig. 4: detecting results by a Y-shaped olfactometer; b diagram in fig. 4: and (5) detecting results of field trapping experiments. Wherein "-" denotes p < 0.05; "x" indicates p < 0.01.

FIG. 5: the titer of the dsRNA-post pheromone component of the Δ 9-desaturase gene injected was varied. Description of reference numerals: graph a in fig. 5: GC-MS peak plots of the stinky gland extracts of the ds Δ 9-desaturase-treated group; b diagram in fig. 5: GC-MS peak pattern of dsGFP treated group odor gland extract; c diagram in fig. 5: GC-MS peak diagrams of 4-oxo-trans-2-hexenal and hexanoic acid hexyl ester standard samples; d diagram in fig. 5: quantification of 4-oxo-trans-2-hexenal; e diagram in fig. 5: quantification of hexyl hexanoate. Wherein "ns" means no significant difference; "" indicates p < 0.05. The Chinese and English abbreviations in the figures mean: "E4O 2H" represents 4-oxo-trans-2-hexenal and "HH" represents hexyl hexanoate. The reference numerals in the diagrams a, b and c in fig. 5 denote the meanings: "1" represents the ion peak of 4-oxo-trans-2-hexenal, "2" represents the ion peak of the internal standard substance, i.e., folic alcohol isobutyrate, and "3" represents the ion peak of hexyl hexanoate.

Detailed Description

The techniques used in the examples below, including molecular biology techniques such as RNA extraction, cDNA synthesis, PCR amplification and detection, and purification of DNA and dsRNA products, are conventional techniques known to those skilled in the art, unless otherwise specified. The instruments, reagents, etc. used are those skilled in the art, and are available from public or commercial sources unless otherwise indicated by the specification.

The test insects (adelphocoris suturalis) used in the examples were virgins. Is obtained by a conventional method in the field.

Example 1: cloning and analysis of adelphocoris suturalis delta 9-desaturase gene

1. Extracting total RNA of adelphocoris suturalis: 30mg of adelphocoris suturalis sample is weighed and placed in a glass homogenizer, total RNA is extracted by using SV total RNA isolation system extraction kit of Promega company, and the detailed steps refer to the kit instruction.

Synthesis of cDNA: cDNA templates were synthesized by reverse transcription of mRNA using PrimeScript RT Master Mix from Bao bioengineering, Dalian, Inc. (for detailed procedures, see the instructions provided by Bao bioengineering, Dalian, Inc.).

3. Designing a primer: the nucleotide sequence of the delta 9-desaturase gene (shown in SEQ ID NO: 1) is obtained by utilizing transcriptome sequencing, and a primer is designed to verify the predicted open reading frame. The following primers were designed and synthesized:

the sequence of the upstream primer is delta 9-des-F: 5'-CGGGCATCCGAGATTTCAC-3', respectively;

the sequence of the downstream primer is delta 9-des-R: 5'-ACAGAGCAAGAACGGTGGTG-3'

The above primers were synthesized by Shanghai Biotechnology engineering services, Inc.

PCR amplification: the primers Delta 9-des-F and Delta 9-des-R were used to perform PCR amplification, and the PCR system was described in Ex Taq enzyme application manual of Bao bioengineering, Daizian, Ltd. PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, renaturation extension at 72 ℃ for 2min, and 38 cycles; extension at 72 ℃ for 10 min. After amplification, the fragment was identified by electrophoresis on 1% agarose gel, cut and purified and recovered by using a DNA gel recovery kit from AxyGen.

Cloning of the PCR product: the PCR product was ligated to pEASY-T1 vector (see FIG. 2) using pEASY-T1Simple Cloning Kit from TransGen according to the instructions, E.coli DH 5. alpha. competent cells were transformed, and positive clones were selected and sequenced by Kingston Biotech Ltd.

6. Sequence analysis: comparing the nucleotide sequence of the delta 9-desaturase gene obtained by sequencing with the nucleotide sequence obtained by sequencing of the transcriptome to verify the correctness of the nucleotide sequence, and displaying that the results of the two sequencing are consistent. The protein sequence of the gene is predicted and analyzed by using ExPASy (http:// web. ExPASy. org/translate /), and the result shows that the full length of the delta 9-desaturase gene open reading frame is 1077bp, 358 amino acid residues are coded, the predicted molecular mass is 77.6949KD, and the theoretical isoelectric point is 6.77. The invention further aligns the amino acid sequence with other 5 delta 9-desaturase amino acid sequences of hemiptera, and confirms that the isolated protein has the typical delta 9-desaturase protein characteristic.

Example 2: dsRNA synthesis

Preparation of dsRNA template:

(1) based on the Δ 9-desaturase gene sequence obtained in example 1, dsRNA regions were predicted by siDirect version2.0, and specific amplification primers (5' -end plus T7promoter sequence) were designed using the software Primer premier5.0 for amplification of dsRNA fragments of Δ 9-desaturase gene as follows:

upstream primer sequence ds. DELTA.9-des-F: CTATAGCGATGGCCCCCAAC

Downstream primer sequence ds. DELTA.9-des-R: GCAATCTCAGAGGGAGCCTG

PCR amplification was carried out using the above primers ds.DELTA.9-des-F and ds.DELTA.9-des-R, and the PCR reaction system was referred to Ex Taq enzyme application manual of Bao bioengineering, Daizian Ltd.

PCR reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, renaturation extension at 72 ℃ for 2min, and 38 cycles; extension at 72 ℃ for 10 min. After amplification, the target fragment was purified and recovered by gel electrophoresis using 1% agarose gel, followed by gel cutting and recovery using AxyGen's DNA gel recovery kit. Finally, it was ligated into pEASY-T1 vector by TA cloning.

(2) A Plasmid containing a target fragment is extracted by using an AxyPrep Plasmid Miniprep kit of AxyGen, and second PCR amplification is carried out by using the specific primers ds delta 9-des-F and ds delta 9-des-R by using the Plasmid as a template, wherein a PCR system and a reaction program are the same as the above-mentioned (R).

Purification of dsRNA templates

And (3) purifying the product of the second PCR by using a phenol chloroform extraction method, wherein the specific operation steps are as follows:

(1) using DEPC H to purify the material₂The volume of O is fixed to 300 mu l (the system can be expanded in equal proportion according to actual needs).

(2) Equal volume of phenol was added: chloroform: isoamyl alcohol (volume ratio 25: 24: 1), shaking thoroughly, room temperature, 12000rpm, centrifugation for 10 min.

(3) The upper phase (about 250. mu.l) was taken, placed in a new RNase-free 1.5ml centrifuge tube, added with 1/10 volumes (25. mu.l) of 3M sodium acetate (pH5.2) and 2 volumes (about 550. mu.l) of absolute ethanol (-20 ℃ for precooling), gently mixed and precipitated at-20 ℃ for 3 h.

(4) Centrifuge at 12000rpm for 15min at 4 ℃ and discard the supernatant.

(5) Adding 75% ethanol (using DEPC H)₂O formulation, -pre-cooling at-20 ℃) and washing the precipitate by turning it upside down several times.

(6) Centrifuge at 7500rpm for 5min at 4 ℃.

(7) Discarding the supernatant, air-drying the precipitate, and adding 20. mu.l DEPC H₂And dissolving the precipitate by using O.

(8) The recovered product was checked by electrophoresis on a 1% agarose gel and the product concentration and OD was determined by using NanoDrop 2000.

dsRNA synthesis:

(1) dsRNA synthesis reaction system

The reaction system for dsRNA synthesis is shown in Table 1.

TABLE 1 dsRNA Synthesis reaction System

Flicking, mixing, and centrifuging instantly. At 37 ℃ for 4 hours.

(2) DNAse I digests the DNA template and adds the reagents as described in Table 2 in the proportions indicated.

TABLE 2 DNAse I digestion reaction System

Mixing, and centrifuging at 37 deg.C for 30 min.

dsRNA purification:

(2) Mu.l of water-saturated phenol and 150. mu.l of chloroform were added thereto, and after sufficiently shaking, the mixture was centrifuged at 12000rpm at 4 ℃ for 15 min.

(3) The upper phase (about 250. mu.l) was taken, placed in a new RNase-free 1.5ml centrifuge tube, added with 1/10 volumes (25. mu.l) of 3M sodium acetate (pH5.2) and 2.5 volumes (about 700. mu.l) of absolute ethanol (-20 ℃ for precooling), gently mixed and left to stand overnight at-20 ℃.

(4) Centrifuge at 12000rpm for 30min at 4 deg.C, and discard the supernatant.

(5) Adding 75% ethanol (DEPC H)₂O formulation, -pre-cooling at-20 ℃) and washing the precipitate by turning it upside down several times.

(6) Centrifuge at 7500rpm for 5min at 4 ℃.

(8) The dsRNA quality was checked by electrophoresis on a 1% agarose gel and the product concentration and OD was determined by NanoDrop 2000.

(9) The dsRNA was diluted to 10. mu.g/. mu.l for use.

Example 3 silencing efficiency of the Gene after injection of ds. DELTA.9-desaturase and its effect on the Synthesis of Apolygus intermedius pheromone

And taking the synthesized dsGFP as a control, and injecting the synthesized dsRNA into the newly-emerged female insect body from the outermost side of the hindbreast and the abdominal internode membrane of the adelphocoris suturalis by using a microinjection instrument.

Respectively taking the fat body and the hindbreast stinky gland tissue of the adelphocoris suturalis treated 3, 5, 7 and 10 days after injection, extracting total RNA, and utilizing the Takara Shuzo of the Boehringer Mannheim Co., Ltd

Premix ExTaq^TMII and Bio-Rad detectinitoQ2Systems. the silencing effect of △ 9-desaturase gene was examined.

And 7 days after injection treatment, treating the female lygus lucorum every 5 times as a group of flavor sources, using the dsGFP as a control group, and detecting the change of the attraction capacity of the female lygus lucorum to the male lygus lucorum by using a Y-type olfactometer.

Injecting for 7-10 days, taking the female lygus lucorum treated every 3 times as a group of flavor sources, taking dsGFP and CK (contrast, namely no treatment) as a control group, and detecting the luring capability of the female lygus lucorum to the male lygus lucorum by utilizing a field trapping experiment.

And after 7 days of injection treatment, taking 10 lygus lucorum female worms as a group, taking dsGFP as a control group, extracting the content of the retrothoracic stinum of the lygus lucorum female worms in the treatment by using n-hexane, and analyzing the change of the pheromone titer by GC-MS.

Test results and analysis:

(1) efficiency of silencing of genes following injection of ds Δ 9-desaturase

The qRT-PCR detection result shows that: compared to dsGFP, injection of ds Δ 9-desaturase significantly inhibited Δ 9-desaturase expression in adipose body (see panel b in FIG. 3). In the posterior skyhook gland, the target genes were significantly down-regulated at

days

3, 7, and 10 after injection, except at day 5 after injection (see panel a in fig. 3). Therefore, the interference sequence of the adelphocoris suturalis delta 9-desaturase gene can interfere the expression of the delta 9-desaturase gene.

(2) Change in the attraction of females to males following ds Delta 9-desaturase injection

In the laboratory, the applicant detected the preference of the male lygus lucorum at 8 days old for ds Δ 9-desaturase and the female lygus lucorum in dsGFP treatment using a Y-type olfactometer, and the results showed that the male lygus lucorum tended to select the female lygus lucorum in dsGFP treatment more (see panel a in fig. 4). In the field, the applicant counted the number of attracted male lygus bugs with ds Δ 9-desaturase treated, dsGFP treated and CK treated female lygus bugs as attracting cores (see panel b in fig. 4), and the results showed that the number of attracted male bugs was significantly decreased in the ds Δ 9-desaturase treated group and no significant difference was observed between the dsGFP treated group and the CK treated group, compared to the dsGFP treated and untreated controls. Therefore, the injection of the ds delta 9-desaturase obviously inhibits the attraction capacity of the female adelphocoris suturalis to male adelphocoris suturalis.

(3) Change in DsMedus intermedius pheromone titer by injection of ds Δ 9-desaturase

Taking 10 female adelphocoris suturalis after 7 days of injection, and extracting and treating the content of the female adductor dorsalis by using n-hexane. The GC-MS analysis showed a significant increase in the content of 4-oxo-trans-2-hexenal in the retro-thoracic glands of lygus bugs in the ds Δ 9-desaturase treated group compared to dsGFP, while the content of hexyl hexanoate, another pheromone component, was not significantly changed (see figure 5). Therefore, the expression of the delta 9-desaturase gene is inhibited, the content of the pheromone component 4-oxo-trans-2-hexenal is changed, and the luring capability of the female lygus lucorum on the male lygus lucorum is influenced finally. Therefore, the RNA interference sequence provided by the invention can be applied to development of transgenic lygus lucorum resistant plants. Further develops the protein of the adelphocoris suturalis and can be applied to the biological control of adelphocoris suturalis.

Primary references

1.

A.,

P.,Vogel,H.,

P.,Jahn,U.,Weiβflog,J.,

A.and Pichová,I.,2015.Evolution of moth sex pheromone composition by asingle amino acid substitution in a fatty acid desaturase.Proceedings of theNational Academy of Sciences of the United States of America 112,12586-12591.

2.

A.,Vogel,H.,

P.,Prchalová,D.,

P.,Vrkoslav,V.,

P.,

A.,Jahn,U.,Valterová,I.and Pichová,I.,2013.The role ofdesaturases in the biosynthesis of marking pheromones in bumblebeemales.Insect Biochemistry and Molecular Biology 43,724-731.Butenandt,A.,Beckman,R.,Stamm,D and Hecker,E.,1959.Uber den sexuallockstoff desseidenspinners Bombyx mori Reindarstellung und konstitution.Z NaturforschB.14:283–284.

3.Hazel,J.R.and Williams,E.E.,1990.The role of alterations inmembrane lipid composition in enabling physiological adaptation of organismsto their physical environment.Prog Lipid Res 29,167-227.

4.Knipple,D.C.,Rosenfield,C.-L.,Nielsen,R.,You,K.M.and Jeong,S.E.,2002.Evolution of the Integral Membrane Desaturase Gene Family in Moths andFlies.Genetics 162,1737-1752.

5.Los,D.A.and Murata,N.,1998.Structure and expression of fatty aciddesaturases.Biochimica et Biophysica Acta(BBA)-Lipids and Lipid Metabolism1394,3-15.

6.Lu,Y.,Wu,K.,Jiang,Y.,Xia,B.,Li,P.,Feng,H.,Wyckhuys,K.A.G.and Guo,Y.,2010.Mirid Bug Outbreaks in Multiple Crops Correlated with Wide-ScaleAdoption of Bt Cotton in China.Science 328,1151-1154.

7.Lu,Y.H.,Qiu,F.,Feng,H.Q.,Li,H.B.,Yang,Z.C.,Wyckhuys,K.A.G.and Wu,K.M.,2008.Species composition and seasonal abundance of pestiferous plantbugs(Hemiptera:Miridae)on Bt Cotton in China.Crop Protection 27,465-472.

8.Miyazaki,M.and Ntambi,J.M.,2003.Role of stearoyl-coenzyme Adesaturase in lipid metabolism.Prostaglandins,Leukotrienes and EssentialFatty Acids 68,113-121.

9.Pyne,S.and Pyne,N.J.,2000.Sphingosine 1-phosphate signalling inmammalian cells.Biochemical Journal 349,385.

10.Roelofs,W.L.and Rooney,A.P.,2003.Molecular genetics and evolutionof pheromone biosynthesis in Lepidoptera.Proc Natl Acad Sci USA 100,9179-9184.

11.Sperling,P.,Ternes,P.,Zank,T.K.and Heinz,E.,2003.The evolution ofdesaturases.Prostaglandins,Leukotrienes and Essential Fatty Acids 68,73-95.

12.Vigh,L.,Los,D.A.,Horváth,I.and Murata,N.,1993.The primary signalin the biological perception of temperature:Pd-catalyzed hydrogenation ofmembrane lipids stimulated the expression of the desA gene in SynechocystisPCC6803.Proceedings of the National Academy of Sciences of the United Statesof America 90,9090-9094.

13. Pigeon Sagittarius, etc., and lygus plant zonal monitoring and management 2015, Beijing, Chinese agriculture Press.

14. Liu Jie Qing, etc., the research progress of drug resistance treatment of plant bugs, the Badong insect bulletin, 2007.16,141-148.

15. Xu wen hua, etc., the host species, transfer rule, ecological distribution and host fitness of the cotton plant bug, Jiangxi agricultural science.

Claims

1. A method for silencing a target gene and inhibiting the attraction of female lygus lucorum to male lygus lucorum by synthesizing dsRNA by using a specific primer of the dsRNA is characterized in that the target gene is delta 9-desaturase, and the nucleotide sequence of the target gene is shown as SEQ ID NO: 1 is shown in the specification; the sequence of the dsRNA specific primer is shown as follows:

upstream primer ds. DELTA.9-des-F: CTATAGCGATGGCCCCCAAC the flow of the air in the air conditioner,

the downstream primer ds delta 9-des-R: GCAATCTCAGAGGGAGCCTG are provided.