CN107653194B - It is a kind of for cultivating the culture medium and cultural method of preeminent hickory chick - Google Patents
It is a kind of for cultivating the culture medium and cultural method of preeminent hickory chick Download PDFInfo
- Publication number
- CN107653194B CN107653194B CN201711126323.5A CN201711126323A CN107653194B CN 107653194 B CN107653194 B CN 107653194B CN 201711126323 A CN201711126323 A CN 201711126323A CN 107653194 B CN107653194 B CN 107653194B
- Authority
- CN
- China
- Prior art keywords
- preeminent
- hickory chick
- morchella
- culture medium
- extract
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Abstract
The invention discloses a kind of for cultivating the culture medium and cultural method of preeminent hickory chick, is related to edible mushroom field.Contain poplar leaf extract in culture medium disclosed by the invention for cultivating preeminent hickory chick, it is applicable to the present invention and separates and identify, and cultivate the new preeminent hickory chick that deposit number is CCTCC NO:M 2016032, using the culture medium culture provided by the invention preeminent hickory chick, fast with mycelial growth rate, biomass is high, and anti-miscellaneous bacteria ability is strong, the features such as pollution rate is few, and the sclerotium generation time is short.
Description
Technical field
The present invention relates to edible mushroom field, in particular to a kind of culture medium for cultivating preeminent hickory chick and
Cultural method.
Background technique
Hickory chick (Morchella) is a kind of Rare edible fungus kind, due to its cap surface irregularity, shape such as sheep tripe
It gains the name.Hickory chick (Morchella) is Ascomycetes (Ascomycetes), Pezizale (Pezizales), Morchellaceae
(Morohellaceae), the dual-purpose fungi of rare food, the medicine of morchella (Morchella), also known as morel, sheep tripe dish,
Sheep mushroom, sheep tripe mushroom.Hickory chick type known to China has had much at present, it is relatively common have hickory chick, small top hickory chick,
Morchellaconica, Morchella crassipes, small hickory chick etc..
Hickory chick is that foremost delicious food bacterium, cap part contain isoleucine, leucine, rely ammonia in sac fungus
7 kinds of acid, methionine, phenylalanine, threonine and valine amino acid needed by human.The nutrition of hickory chick is quite abundant, according to
Measurement, hickory chick contain crude protein 20%, crude fat 26%, carbohydrate 38.1%, also containing there are many amino acid, especially paddy
Histidine content is up to 1.76%.Therefore, it is believed that being " very good protein source ", and there is the laudatory title of " meat or fish in element ".
In addition, hickory chick at least contains 8 kinds of vitamins according to surveying and determination: vitamin B1, vitamin B2, vitamin B12, niacin,
Pantothenic acid, pyrrole sound of vomiting alcohol, biotin, folic acid etc..The nutrition of hickory chick, can be suitable with cow's milk, meat and fish meal.Therefore, in the world
Often it is referred to as one of " healthy food ".
Wild toadstool is distributed in China Shaanxi, Gansu, Qinghai, Tibet, Xinjiang, Sichuan, Shanxi, Jilin, Jiangsu, cloud
The areas such as south, Henan, Hebei, Beijing, Hunan, Guizhou.It grows in a natural environment, monomer is up to more than 200 grams, currently, China
It has been found that hickory chick have more than 20 kinds.
It is therefore desirable to provide the application of more hickory chick new varieties and hickory chick new varieties, identification method and
Cultural method etc..
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of new hickory chick bacterial strain, has and improve immunity, tumour cell is inhibited to increase
The effects of growing.
Another object of the present invention is to provide a kind of extract, extract from from above-mentioned preeminent hickory chick.
Another object of the present invention is to provide a kind of drugs or health care product for improving immunity.
Another object of the present invention is to provide the drugs for preventing or treating tumour.
Another object of the present invention is to provide a kind of identification methods for identifying above-mentioned preeminent hickory chick.
Another object of the present invention is to provide the applications of above-mentioned preeminent hickory chick or its extract.
Another object of the present invention is to provide a kind of for cultivating the culture medium of above-mentioned preeminent hickory chick.
Another object of the present invention is to provide a kind of methods for cultivating above-mentioned preeminent hickory chick.
The present invention is implemented as follows:
On the one hand, the present invention provides a kind of preeminent hickory chick, and deposit number is CCTCC NO:M2016032.
The present inventor separates from a kind of fructification of hickory chick in Yunnan, obtains mycelial samples after purification,
It is observed by the form to mycelial samples, determines that it is one of them kind of Morchellaceae, pass through further ITS sequence
Analysis, carrying out the resulting rDNA-ITS sector sizes of PCR amplification with the DNA that mycelial samples extract is about 750bp, by NCBI's
BLAST is compared, and the sequence similarity of the mycelial samples and Morchella eximia voucher strain is 99%, is thus inferred
The new hickory chick bacterial strain of one kind that the hickory chick bacterial strain is Morchella eximia voucher, is preeminent hickory chick
(Morchella eximia voucher)。
The bacterial strain was preserved in China typical culture collection center (CCTCC) on January 13rd, 2016, address: China is military
Chinese Wuhan University, classification naming are as follows: Morchella eximia voucher SAAS-1, deposit number are as follows: CCTCC NO:M
2016032。
On the other hand, the present invention provides a kind of extract, extracts and obtains from above-mentioned preeminent hickory chick.
Further, in some embodiments of the invention, which is water extract or alcohol extract.
Further, in some embodiments of the invention, which is polyoses extract.
Further, in some embodiments of the invention, the water extract or alcohol extract can be prepared via a method which:
Take the preeminent new fresh sporophore of hickory chick as described above, after cleaning, freeze-drying；
By the fructification of freeze-drying, ethyl alcohol mixing is added, ultrasonication obtains crude extract；
It is centrifuged crude extract, is taken supernatant (precipitating is spare), it is dry, alcohol extract is obtained,
Above-mentioned precipitating is taken, it is dry, water is added, is heated, filters, collects filtrate, concentration filtrate obtains water extract.
Experimental verification in the embodiment of the present invention, extract provided by the invention, which has, to be promoted T cell proliferation and inhibits swollen
The effect of tumor cell proliferation.
On the other hand, the present invention provides a kind of drug or health care product for improving immunity comprising: above-mentioned preeminent sheep tripe
Bacterium or above-mentioned extract.
Experimental verification in the embodiment of the present invention, extract provided by the invention have the function of promoting T cell proliferation.Cause
This, the extract or the preeminent hickory chick can be used for preparing the drug or health care product for improving immunity.Correspondingly, contain the extraction
The drug or health care product of object or the preeminent hickory chick, which also have, promotes T cell proliferation, improves the function and effect of immunity.
On the other hand, the present invention provides a kind of drug prevented or treat tumour comprising: preeminent sheep tripe as described above
Bacterium or extract as described above.
Experimental verification in the embodiment of the present invention, extract provided by the invention have the work for inhibiting tumor cell proliferation
With.Therefore, the extract or the preeminent hickory chick can be used for preparing prevention or treat the drug of tumour.Correspondingly, it is mentioned containing this
The drug or health care product for taking object or the preeminent hickory chick also have inhibition tumor cell proliferation, achieve the purpose that prevention or treatment.
On the other hand, the present invention provides a kind of identification method of preeminent hickory chick as described above comprising:
The ITS region sequence for expanding bacteria to be tested, obtains sequence to be checked；
The sequence to be checked is compared with reference sequences, if the sequence to be checked contains the reference sequences,
Indicate that the bacteria to be tested is the preeminent hickory chick；
Wherein, the reference sequences are as shown in SEQ ID NO.1.
Further, in some embodiments of invention, the area ITS of the bacteria to be tested is expanded with fungi universal primer
Sequence.
Further, in some embodiments of invention, fungi the universal primer ITS1 and ITS4 amplification it is described to
Survey the ITS region sequence of strain；The base sequence of ITS1 is as shown in SEQ ID NO.2, the base sequence of ITS4 such as SEQ ID NO.3
It is shown.
On taxology, from traditional form on to divide hickory chick is divided into 28 kinds, but in molecular biology
Angle be but only divided into three or four kinds, illustrate to lack through hypha form the reference frame for identifying strain.Because these are asked
Topic is so that there is a phenomenon where strain confusions in the production of hickory chick, therefore establish a set of science, effective strain idenfication system
It is a major issue of urgent need to resolve.So by traditional form and molecular biology combine in the way of, while from shape
State feature and molecular level identification hickory chick strain are a relatively good approach.
ITS (Internal Transcribed Spacer): the Internal Transcribed Spacer is eucaryote ribosomes RNA
(rRNA) a part of gene nontranscribed domain.ITS sequence commonly used in Fungal identification includes ITS1,5.8S and ITS2.Ribose
Vivo transcription spacer region includes 2 different non-coding regions, i.e. ITS1 and ITS4.Fungi ITS zone length generally 650~
750bp (base-pair).ITS sequence identification, which refers to, carries out DNA sequencing to ITS sequence, by the way that obtained ITS sequence and will be sequenced
Know that the ITS sequence of fungi is compared, to obtain a kind of method of unknown fungi kind information.
Traditional taxology identification method be different strain is distinguished according to sporophore shape, but due to present environment become
Change greatly, seriously polluted, sporophore shape can generate variation due to being influenced by growing environment and different developmental phases, so being difficult
Accurately distinguish.
Identification method application rDNA provided by the invention ITS sequence analysis method bacteria to be tested is identified, with
For SEQ ID NO.1 as reference sequences, which is originated from the preeminent hickory chick that deposit number is CCTCC NO:M2016032
The ITS sequence of rDNA therefore have the characteristics that qualification result is accurate, reliable using the identification method.
On the other hand, the present invention provides the preeminent hickory chick that deposit number as described above is CCTCC NO:M 2016032
Or the preeminent Morchella esculenta extract improves the application in immunity drug or health care product in preparation.
On the other hand, the present invention provides the preeminent hickory chick that deposit number as described above is CCTCC NO:M 2016032
Or application of the preeminent Morchella esculenta extract in preparation prevention or tumor.
Through the experimental verification in the embodiment of the present invention, the results show that the water extract that is extracted from above-mentioned preeminent hickory chick or
Alcohol extract has the function of promoting T cell proliferation and inhibits tumor cell proliferation.Illustrate, preeminent hickory chick as described above or super
Group's Morchella esculenta extract, which can be used for preparing, improves immunity drug or health care product, and the neck such as prevention or tumor
Domain.
On the other hand, a kind of for cultivating the culture medium of preeminent hickory chick, it is suitable for cultivating deposit number as described above
For the preeminent hickory chick of CCTCC NO:M 2016032, poplar leaf extract is contained in the culture medium.
Further, in some embodiments of invention, the poplar leaf extract is Poplar leaves water extract.
Further, in some embodiments of invention, the Poplar leaves water extract is prepared by the following method to obtain:
Poplar leaves are decocted with water, filtering takes filtrate up to the Poplar leaves water extract.
Further, in some embodiments of invention, the culture medium also contains: glucose and KH2PO4。
Further, in some embodiments of invention, based on every L, the culture medium contains: 18-22g glucose and
0.8-1.1g KH2PO4。
Preeminent Morchella esculenta (L.) Pers sporophore provided by the invention comes from Qujing of Yunnan, inventor according to the living environment of fructification and
The tree species of surrounding have carried out continuous improvement and creative thinking to its mycelial culture medium prescription, the results show that phase
To ordinary culture medium, culture medium provided by the invention can make the preeminent hickory chick well by the way that poplar leaf extract is added
Growth, shows that mycelia is sturdy, the speed of growth is fast, the feature more than sclerotium quantity.
In another aspect, it is that CCTCC NO:M2016032 is preeminent that the present invention, which provides a kind of culture deposit number as described above,
The method of hickory chick, this method use culture medium culture as described above.
The invention has the following advantages:
Preeminent hickory chick provided by the invention, deposit number are CCTCC NO:M 2016032.It is identified, the preeminent sheep tripe
Bacterium is a kind of new preeminent hickory chick bacterial strain, and extract promotes T cell proliferation and inhibits the effect of tumor cell proliferation, this is super
Group hickory chick or its extract can be used for improving immunity and prevent or treatment tumour, correspondingly, the preeminent hickory chick or its
Extract can be used for preparing the drug or health care product for improving immunity, or preparation prevents or treats in the drug of tumour, tool
Have broad application prospects；
In addition, the method that the ITS sequence of identification method application rDNA provided by the invention is analyzed reflects to bacteria to be tested
Fixed, using SEQ ID NO.1 as reference sequences, it is the preeminent of CCTCC NO:M 2016032 which, which is originated from deposit number,
Therefore the ITS sequence of the rDNA of hickory chick using the identification method, can accurately identify whether bacteria to be tested is preservation
The preeminent hickory chick that number is CCTCC NO:M 2016032 has the characteristics that qualification result is accurate, reliable.
Further more, the culture medium and corresponding cultural method of preeminent hickory chick provided by the invention, according to deposit number
For the initial growth environmental quality of the preeminent hickory chick of CCTCC NO:M 2016032, mentioned by the way that Poplar leaves are added in the medium
Object is taken, the preeminent hickory chick can be made to grow well, shows that mycelia is long, the feature more than sclerotium quantity.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the DNA electrophoresis detection figure of the preeminent hickory chick extraction in the embodiment of the present invention (in figure: M:Marker；1,2,
3,4,5 be mycelia DNA of the same race)；
Fig. 2 is PCR electrophoresis of the DNA of the preeminent hickory chick extraction in the embodiment of the present invention under 52-62 DEG C of temperature gradient
Figure is (in figure: M:Marker；13,14 be 58 DEG C；23,24 be blank control group)；
Fig. 3 be the embodiment of the present invention in preeminent hickory chick extract DNA at a temperature of 58 DEG C PCR electrophoretogram (in figure:
M:Marker；16 be blank control group)；
Fig. 4 is that the glue in the embodiment of the present invention recycles electrophoretogram (in figure: M:Marker)；
Fig. 5 is the extraction electrophoretogram of the bacterium solution plasmid in the embodiment of the present invention (in figure: M:Marker)；
Fig. 6 is the restriction enzyme digestion and electrophoresis figure (M:Marker in the embodiment of the present invention；1,2,3,4, No. 6 are successfully transferred to carrier)；
Fig. 7 is the Blast comparison result in the embodiment of the present invention；
Fig. 8 is the chadogram constructed with different hickory chick ITS sequences in the embodiment of the present invention；
Fig. 9 is that the preeminent hickory chick alcohol extracting thing of various concentration of the flow cytomery in the embodiment of the present invention is thin to T
The influence result of born of the same parents' proliferation；
Figure 10 be the embodiment of the present invention in flow cytomery different volumes than preeminent hickory chick water extract to T
The influence result of cell Proliferation；
Figure 11 is the preeminent hickory chick alcohol extracting thing of various concentration in the embodiment of the present invention to three kinds of tumor cell proliferations
Influence result；
Figure 12 is for the different volumes in the embodiment of the present invention than preeminent hickory chick water extract to three kinds of tumor cell proliferations
Influence result；
Figure 13 is the chadogram constructed with different preeminent hickory chick ITS sequences in the embodiment of the present invention；
Figure 14 is Morchella eximia the voucher SAAS-1 and Morchella in the embodiment of the present invention
The ITS sequence of eximia voucher LIP:Ph253 compares partial results.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
The separation and identification of preeminent hickory chick
The separation of 1 preeminent hickory chick
Original hickory chick, which acquires, to be separated from Qujing of Yunnan, obtains the mycelial samples of experiment after purification.
The identification of 2 preeminent hickory chicks
2.1 cultural hypha
It takes a small amount of strains tested with culture medium to access PDA culture medium, is put into constant temperature and humidity incubator after sticking sealed membrane
In cultivated.Condition of culture is constant are as follows: and 25 DEG C of temperature, relative humidity 40%, and no light.
Growing aerial hyphae behind mycelia 1 day or so of access, and the speed of growth is accelerated, mycelia generally covers with plate at 3 days,
Mycelia color is white, and mycelia browning in 5 days or so becomes brown, granular brown material is grown among culture medium.Due to bacterium
The dosage that silk extracts DNA is bigger, and general scraping is inoculated with 4 days or so white hyphas as the material subsequently tested.
2.2CTAB method extracts DNA
(1) after the completion of cultural hypha, picking part mycelia is in the centrifuge tube of 2ml.
(2) take the 800 μ l of CTAB of 65 DEG C of preheating, be added in centrifuge tube, 65 DEG C of water-bath 1h, or shake up mixed liquor.
(3) 12000rpm, 4 DEG C of centrifugation 20min, takes supernatant to be transferred in another 2ml centrifuge tube.
(4) (4 DEG C) of pre-cooling isometric phenol is added: chloroform (1:1) mixes well, 12000rpm, 4 DEG C of centrifugations
10min takes supernatant to be transferred in the centrifuge tube of 2ml.
(5) chloroform isometric with (4 DEG C) of pre-cooling: isoamyl alcohol (24:1) extracts 2 times, mixes well, 12000rpm, 4
DEG C centrifugation 10min, take supernatant to be transferred in the centrifuge tube of 1.5ml.
(6) NaAc (3M, pH5.2) of 60 μ l is added, and (- 20 DEG C) isopropanol that 500 μ l pre-cooling is added is stood in -20 DEG C
20min or more precipitates DNA.
(7) 12000rpm, 4 DEG C of centrifugation 10min abandon supernatant.
(8) ethyl alcohol of (4 DEG C) 70% of 1ml pre-cooling is added, gently turns upside down, 12000rpm, 4 DEG C of centrifugation 10min are abandoned
Ethyl alcohol spontaneously dries, and stands 15min or more.
(9) ddH2O of 50 μ l is added, gently beaing dissolves precipitating.
(10) DNA extract is in -20 DEG C of preservations.
Morciiella Esculeuta Mycelia genomic DNA takes 5 μ l and 2 μ 6 × Loading of l Buffer after mixing, with 2% agarose
Then Ago-Gel is placed in gel imaging system in carrying out electrophoresis on gel-electrophoretic apparatus and is detected and observe figure by gel
As result.Experimental result is shown in Fig. 1.Fig. 1 shows that it is effective for extracting Morciiella Esculeuta Mycelia with CTAB method, and the DNA is subsequent reality
The basis tested.
The PCR amplification of 2.3ITS region sequence
2.3.1 annealing temperature is screened
Using fungi universal primer ITS1 (5 '-TCCGTAGGTGAACCTGCG-3 ', SEQ ID NO.2) and ITS4 (5 '-
TCCTCCGCTTATTGATATGC-3 ', SEQ ID NO.3) carry out ITS region sequence amplification.
25 μ lPCR reaction systems: 10 × PCR Buffer, 2.5 μ l, rTaq enzyme (5U/ μ l) 0.2 μ l, MgCl2(25mmol/
μ l) 2 0.3 μ l, primer ITS4 of μ l, dNTPs (10mmol/ μ l) 0.5 μ l, primerITS5 0.5 μ l, 2.5 μ l of DNA profiling,
ddH2O 16.5μl。
Response procedures: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 45s；52-62 DEG C of temperature gradient annealing 45s；72 DEG C of extensions
45s；35 circulations；72 DEG C of filling-in 10min.
In order to filter out the optimum annealing temperature of mycelia PCR, 52-62 DEG C is set by the annealing temperature in response procedures,
Other conditions are constant, then carry out PCR amplification, after mixing with 2 μ 6 × Loading of l Buffer by PCR product, with 2%
Then Ago-Gel is placed in gel imaging system and is detected simultaneously in carrying out electrophoresis on gel-electrophoretic apparatus by Ago-Gel
Observe image result.Experimental result is shown in Fig. 2.
Band is clearest when Fig. 2 shows 58 DEG C, and brighter, so 58 DEG C are comparatively proper annealing temperature
Degree.
After the optimum annealing temperature for filtering out the PCR of mycelia DNA is 58 DEG C, regular-PCR is carried out as reaction condition,
His condition is constant.After mixing by PCR product and 2 μ 6 × Loading of l Buffer, with 2% Ago-Gel in gel electricity
Electrophoresis is carried out on swimming instrument, then Ago-Gel is placed in gel imaging system and is detected and observes image result.As a result
See Fig. 3.Fig. 3 shows that when annealing temperature is 58 DEG C, band is all very limpid in sight.
2.4, which carry out PCR amplification by the annealing temperature filtered out, takes 5 μ lPCR products and 2 μ l6 × Loading after the completion
Ago-Gel after mixing, with 2% Ago-Gel in carrying out electrophoresis on gel-electrophoretic apparatus, is then placed in solidifying by Buffer
It is detected in glue imaging system and observes result.
The recycling of 2.5 glue
(1) it after cutting glue, is smashed to pieces as far as possible in the centrifuge tube of 1.5ml with the pipette tips of 1ml.
(2) 300 μ l (no more than 600 μ l) Binding B, 55 DEG C of water-bath 10min is added.
(3) it is transferred in casing after melting, makes film contact liq, after being sufficiently humidified so as to 2min, centrifugation.
(4) 600 μ l Wash D are added, liquid is abandoned in centrifugation.
(5) 400 μ l Wash D are added, liquid is abandoned in centrifugation.
(6) blank pipe centrifugation after, standing allow alcohol volatilize 15min or more.
(7) ddH is added230 μ l of O places more than half an hour, glue recovery product is allowed to be substantially dissolved in water.
(8) 5 μ l glue recovery products and 2 μ 6 × Loading of l Buffer are taken after mixing, with 2% Ago-Gel in
Electrophoresis is carried out on gel-electrophoretic apparatus, and then Ago-Gel is placed in gel imaging system and is detected and observes result.Knot
Fruit sees Fig. 4.Fig. 4 shows that glue recovering effect is fine, and band is limpid in sight.
2.6 clone
(1) 4 μ l of glue recovery product is sequentially added in micro centrifugal pipe (can recycle concentration according to glue suitably to increase and decrease, at most
No more than 4 μ l), 1 μ l of pEASY-T3Cloning Vector is gently mixed, 25 DEG C of reaction 10min.It after reaction, will be micro-
Type centrifuge tube is placed on ice.
(2) connection product is added in the Trans1-T1 competent cell of 50 μ l (will add when competent cell just thaws
Enter connection product, and is placed on ice chest always.), flick mixing, ice bath 20-30 minutes.
(3) 42 DEG C water-bath heat shock 50 seconds, be immediately placed on 5 minutes on ice.
(4) be added having balanced to the LB liquid medium of room temperature for 250 μ l, 200rpm, 37 DEG C cultivate 1 hour.
(5) the 500mM IPTG and 40 μ l 20mg/ml X-gal drops for taking 20 μ l are mixed on plate, are equably coated in standard
(contain millesimal ammonia benzyl in culture medium) on the plate got ready, is placed 30 minutes in 37 DEG C of incubators.
(6) after IPTG and X-gal is absorbed after 30 minutes, 200 μ l bacterium solutions are taken equably to be coated on plate, at 37 DEG C
(to obtain more clone, 12000rpm wink is from discarding 100 μ l supernatants, retain 200 μ l or so, gently for overnight incubation in incubator
Precipitating is beaten in featheriness, dissolves it sufficiently, is drawn remaining whole bacterium solutions and is carried out coated plate).
It (is not exceeded 16 hours) after (7) 16 hours and the culture dish being incubated overnight is taken out, observed and select and (use lancet
Head) different zones bacterium (be preferably selected a region and there was only single bacterium), be put into 1.5ml centrifuge tube together with small pipette tips,
Then into centrifuge tube be added 1ml LB liquid medium, by centrifuge tube be placed in 200rpm on shaking table, 37 DEG C cultivate 3 hours.3
PCR amplification, which is carried out, in this, as DNA profiling after hour is verified (PCR system and reaction condition are all same as above).
(8) it selects white monoclonal to be inoculated in LB liquid medium, 200rpm, 37 DEG C of overnight incubations, extract within second day
Plasmid takes 17 μ l plasmids to carry out digestion identification with restriction enzyme EcoR I, and runs glue observation result.As a result as shown in Figure 5.
Fig. 5 shows that plasmid band is bright, and concentration is higher, may be used as subsequent experimental and carries out digestion.
(6) part plasmid is taken, digestion identification is carried out with restriction enzyme EcoR I, with 2% Ago-Gel in gel
Electrophoresis is carried out on electrophoresis apparatus, and then Ago-Gel is placed in gel imaging system and is detected and observes image result.It is real
It tests result and sees Fig. 6.Electrophoretogram shows that 1,2,3,4, No. 6 plasmid has all been transferred to carrier, and No. 5 do not have then.
(10) by digestion, successfully remaining plasmid send to the raw work in Shanghai and is sequenced.
Sequencing result is following (SEQ ID NO.4):
5’-GGATCGGCAGTGATTGTATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCCGG
CCGCCATGGCGGCCGCGGGAATTCGATTGGATCGCCCTTGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAAC CTGCGGAAGGATCATTACCAAGAACCACACAGAAAAGGGCAGCCGAGGGGCCAACCAGGGCTAGTAGCTTTACGTT GTTGAACGTCCTGGAACGGACCCGGAGCCGCCCCCATCTAAACACTCTGCGTACCCATCCCACCTTGCTTCCCCCG GCCATCCGCTGGGGGGAGGAACAACAACCAAAACTCTTTGTGAAGAAACAGACGTCAGAATCATAACCAAAAAAAA GTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAA TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCG AGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGATTACTATCGTTGGGGGGGTATTGGCCTACTGGGAAAGCGAT TTGGCAATTGCCTTCCCACTGTCCTAAATACACTTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCG TGGAGTTATGGAATACCGTTCTCCACACGCCGATGGCAAACCGGTCGCAGTTGCGGGCGTAAATTGGAGCCCTCTT CAGGACCCTCGTGGCCTAGCATCCACCATACATATTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGC ATATCAATAAGCGGAGGAAAAGGGCGATCCCAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATTGGG
AGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCTGGGTCA
TAGCTGTTTCCTGGGGTGAAATT-3’。
2.7BLAST comparing
After above-mentioned sequencing sequence is removed primer sequence, submit (partial sequence for as above using underscore to mark as progress
The sequence formally compared, SEQ ID NO.1) arrive NCBI (National Center for Biotechnology
Information), http://www.ncbi.nlm.nih.gov/ carries out Blast comparison.
For Blast comparison result as shown in Fig. 7 and Figure 14, Figure 14 shows Morchella eximia voucher SAAS-
The ITS sequence part of 1 ITS sequence and preeminent hickory chick (Morchella eximia voucher LIP:Ph253), which compare, ties
(Query represents Morchella eximia voucher LIP:Ph253 to fruit；Sbjct represents Morchella eximia
voucher SAAS-1).Comparison result shows, the sequence (SEQ ID NO.1) and Morchella eximia of submission
The ITS sequence comparative analysis of voucher, there are the difference of 3 bases (shown in arrow as shown in figure 14), sequence similarities for the two
Up to 99%.Thus infer that sample is Morchella eximia voucher, entitled preeminent hickory chick is a kind of new preeminent sheep
Tripe bacteria strain.Name are as follows: Morchella eximia voucher SAAS-1.
2.8 building systematic evolution trees
2.8.1 chadogram is constructed with software PHYML 3.0.It is downloaded from the official website NCBI (www.ncbi.nlm.nih.gov)
The ITS sequence for the hickory chick kind being currently known, after handling each ITS sequence using software MUSCLE v3.7, according to maximum likelihood
Method carries out Genetic relationship to it), by ITS sequence (the i.e. SEQ ID of Morchella eximia voucher SAAS-1
NO.1) with other hickory chick species: Morchella septentr, Morchella delicious (small hickory chick),
Morchella brunnea, Morchella elata (Morchella elata), Morchella purpuras (heteropleural silk purple sheep tripe
Bacterium), Morchella norvegie, Morchella disparil, Morchella snyderi, Morchella
Angustic, Morchella eximioid, Morchella costata (costae hickory chick), Morchella capitata,
Morchella exuberan, Morchella sextelat, Morchella eximia (preeminent hickory chick), Morchella
Septimel, Morchella conica (Morchellaconica), Morchella dunalii, Morchella gigas,
Morchella semilibe (half-open hickory chick), Morchella Pakistan, Morchella populiph,
Morchella punctipe,Morchella tridenti,Morchella quercusi,Morchella elatoide,
Morchella frustrat, Morchella tomentos, Morchella rufobrun (reddish brown hickory chick),
Morchella anatolic, Morchella steppico, Morchella spongiol (small sponge hickory chick),
Morchella dunensis,Morchella prava,Morchella diminuti,Morchella ulmaria,
Morchella cryptica, Morchella castanea, Morchella vulgaris (common hickory chick),
Morchella esculent,Morchella American,Morchella Virginia,Morchella sceptrif,
Morchella palazoni, Morchella crassipe (Morchella crassipes), Morchella fluviali and
The ITS sequence of Aspergillus flavus (aspergillus flavus) constructs chadogram together, as a result as shown in Figure 8.
Fig. 8 shows, preeminent hickory chick Morchella eximia voucher SAAS-1 provided in an embodiment of the present invention its
He compares the affiliation of 46 hickory chick kinds, although as a result, it has been found that Morchella eximia voucher SAAS-1 with
The homologous similitude of preeminent hickory chick (Morchella eximia) is higher, but still has a certain difference in affiliation.
2.8.2 by ITS sequence (the SEQ ID of the Morchella eximia voucher SAAS-1 of the present embodiment
NO.1) with the ITS sequence of other 14 kinds preeminent hickory chick (Morchella eximia) subspecies using identical with above-mentioned steps
Method constructs chadogram, determines status of the bacterial strain in preeminent hickory chick, as a result as shown at 13.
It can be seen that from the result of Figure 13, Morchella eximia voucher SAAS-1 and Morchella eximia
Voucher FR0410 affiliation is closer.
The above results absolutely prove preeminent hickory chick (Morchella eximia provided in an embodiment of the present invention
Voucher SAAS-1) it is a kind of new preeminent hickory chick bacterial strain, never recorded by the prior art.
To sum up as a result, above-mentioned isolated hickory chick bacterial strain is a kind of new preeminent hickory chick bacterial strain, the bacterial strain in
On January 13rd, 2016 is preserved in China typical culture collection center (CCTCC), address: Wuhan, China Wuhan University, classification life
Name are as follows: Morchella eximia voucher SAAS-1, deposit number are as follows: CCTCC NO:M 2016032.
Embodiment 2
It is provided in this embodiment to identify that deposit number is the identification method of the preeminent hickory chick of CCTCC NO:M 2016032,
Comprising:
1 expands the ITS region sequence of bacteria to be tested using fungi universal primer ITS1 and ITS4, obtains sequence to be checked；
Wherein, the base sequence of ITS1 is as shown in SEQ ID NO.2, and the base sequence of ITS4 is as shown in SEQ ID NO.3.
Wherein, 0.2 μ l, MgCl of PCR reaction system (25 μ l): 10 × PCR Buffer 2.5 μ l, rTaq enzyme (5U/ μ l)2
0.5 μ l, primerITS50.5 μ l, DNA mould of (25mmol/ μ l) 2 0.3 μ l, primer ITS4 of μ l, dNTPs (10mmol/ μ l)
Plate (bacteria to be tested DNA) 2.5 μ l, ddH2O 16.5μl。
PCR response procedures: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 45s；58 DEG C of temperature gradients annealing 45s；72 DEG C of extensions
45s；35 circulations；72 DEG C of filling-in 10min.
2 sequence to be checked is compared with reference sequences, if sequence to be checked contains reference sequences, indicates described to be measured
Strain is the preeminent hickory chick that deposit number is CCTCC NO:M 2016032.
Wherein, reference sequences are as shown in SEQ ID NO.1.It is CCTCC NO:M that the reference sequences, which are originated from deposit number,
The ITS sequence of the rDNA of 2016032 preeminent hickory chick.
Embodiment 3
The preeminent Morchella esculenta extract for extracting from preeminent hickory chick (CCTCC NO:M 2016032) is present embodiments provided,
The preeminent Morchella esculenta extract is preeminent hickory chick water extract or preeminent hickory chick alcohol extracting thing.
The extracting method of the preeminent Morchella esculenta extract is as follows:
1 takes the new fresh sporophore 200g of preeminent hickory chick (CCTCC NO:M 2016032), and it is real to rinse son with 75% ethyl alcohol
Body twice, place -80 DEG C of refrigerators and 4h be lyophilized by fructification.
2 are transferred to freeze-drying fructification in 50mL centrifuge tube, and 95% (v/v) ethyl alcohol is added in the ratio of 1:10 (M/V),
40 DEG C, (400W) ultrasonication three times, is crushed 30min every time.Broken interval time is 30min.
3 in 10000rpm centrifugation (16000 × G) 15 minutes, and (precipitating is spare, is used to prepare preeminent sheep tripe for transfer supernatant
Bacterium water extract) to rotary vacuum evaporator, 60 DEG C of conditions are evaporated to get preeminent hickory chick alcohol extracting thing.
Precipitating in 4 steps 3 is extracted using (60 DEG C) processing 2h of heated-air drying instrument, is added and is steamed according to 1:20 (w/v) ratio
Distilled water, 100 DEG C of water-baths three times, 2 hours every time.Filtering collects filtrate and is concentrated into the 1/ of original volume in freeze concentration instrument
10 to get arrive preeminent hickory chick water extract.
The extracting method step is simple, fast, does not need complex instrument, and it is more disposably can largely to extract hickory chick
Sugar.
Preeminent Morchella esculenta extract provided in this embodiment has the work for promoting T cell proliferation and inhibiting tumor cell proliferation
With can be used for preparing and improve in immunity drug or health care product, and the fields such as preparation prevention or tumor.
Embodiment 4
The facilitation that the preeminent Morchella esculenta extract that verifying embodiment 3 obtains is proliferated T cell, experimental method are as follows:
1 every group of experiment takes 10 mouse, and daily stomach-filling 1 time continues 30 days,
2 by separating spleen after mouse anesthesia, grinding, and the suspension after grinding is utilized 70 μm of membrane filtrations,
3 filtrate 1500rpm are centrifuged 5min, and cell liquid is put into warm bath 10 minutes in ACK lysis buffer,
4 are added anti-mouse CD4 magnetic-particle (BD Bioscience, San Jose, CA, USA), separate from splenocyte
CD4+T cell out.
5 are placed in T cell in the hydroxyl fluorescein diacetate succinimide lipoprotein solution that concentration is 5mM, 37 DEG C of warm bath
10min is transferred in cold 1640 culture medium of RPMI containing 10%FBS, and 1000rpm is centrifuged 3min, is repeated once.
6 respectively using preeminent hickory chick water extract (0 μ g/mL (as control), 0.25 μ g/mL, 2.5 μ containing various concentration
G/mL, 5 μ g/mL) 1640 culture medium culture of RPMI and addition have various concentration (volume ratio) (0% (as control),
0.1%, 1%, 10%, 50%) the 1640 culture medium culture T cell of RPMI of preeminent hickory chick alcohol extracting thing, 37 DEG C, 72h,
Cell is collected, and with flow cytometry analysis T cell proliferative conditions.As a result (figure is flow cytometer pair as shown in Figure 9 and Figure 10
The test map of T cell, abscissa indicate fluorescence intensity when detection cell, and ordinate indicates cell count, that is, count).
Fig. 9 shows the preeminent hickory chick water extract of various concentration (0 μ g/mL, 0.25 μ g/mL, 2.5 μ g/mL, 5 μ g/mL)
Influence to T cell proliferation, as shown in figure 9, preeminent hickory chick water extract can promote T cell to be proliferated, and concentration is bigger, and T is thin
Born of the same parents' quantity is more, illustrates that preeminent hickory chick water extract promotes T cell proliferation function to be more obvious.
Figure 10 shows the preeminent hickory chick alcohol extract of various concentration (0%, 0.1%, 1%, 10%, 50%) to T cell
The influence of proliferation, as shown in Figure 10, preeminent hickory chick alcohol extract can promote T cell to be proliferated, and the preeminent hickory chick alcohol being added
Extract amount is more, and T cell quantity is more, and cultivation effect is promoted to be more obvious.
It is indicated above that the preeminent Morchella esculenta extract that embodiment 3 obtains has facilitation to what T cell was proliferated, it can
To be used to prepare the drug or health care product that improve immunity.
Embodiment 5
The inhibiting effect of the tumor cell proliferation for the preeminent Morchella esculenta extract that verifying embodiment 3 obtains, experimental method is such as
Under:
1 has been respectively placed in tumour cell (Daudi, NAMALWA, SU-DHL-4, three kinds of different human lymphoma cells)
In full culture medium, 37 DEG C, 5%CO2Incubator in cultivated, change the liquid once within every 2 days, every bottle plus 5mL culture medium.
2 are rinsed twice with the 0.01%M kaliumphosphate buffer of 20mL, at 25 DEG C, with the second two for containing 0.28% trypsase
Amine tetraacethyl (1X) digests 5 minutes, takes the logarithmic proliferation phase cell that grows fine.
Cell concentration is adjusted to 2.5*104/mL using blood counting chamber counting by 3, and 150 μ L cell suspensions are added 96
In orifice plate, after culture 1 day, culture medium is drawn, is added and contains various concentration (0 μ g/mL (as a control group), 1 μ g/mL, 10 μ g/
ML, 100 μ g/mL, 1000 μ g/mL) preeminent hickory chick alcohol extract culture medium and containing various concentration, (volume ratio, 0 ‰ (as right
According to group), the culture medium of 0.01 ‰, 0.1 ‰, 1 ‰, 10 ‰) preeminent hickory chick water extracts is cultivated 24 hours.
Under 4 dark conditions, the MTT solution of 30 μ L 5mM, CO is added in every hole2Culture 5h is carried out in incubator, is sucked in hole
Culture medium, be added 150 μ L dimethyl sulfoxide, be protected from light standing after twenty minutes microplate reader detection cell growth status.Result figure
Shown in 11 and Figure 12.
Figure 11 shows shadow of the preeminent hickory chick alcohol extract to three kinds of different human lymphoma cell's proliferation of various concentration
It rings as a result, as shown in figure 11, preeminent hickory chick alcohol extract has the function of that tumour cell such as lymphoma cell is inhibited to be proliferated.It is dense
Degree is bigger to be more obvious human lymphoma cell's inhibiting effect.
Figure 12 shows shadow of the preeminent hickory chick water extract to three kinds of different human lymphoma cell's proliferation of different volumes
It rings as a result, as shown in figure 12, preeminent hickory chick water extract has the function of that tumour cell such as lymphoma cell is inhibited to be proliferated.It is dense
Degree is bigger to be more obvious human lymphoma cell's inhibiting effect.
These results suggest that the preeminent Morchella esculenta extract that embodiment 3 provides is to tumour cell such as human lymphoma cell
Has the function of Inhibit proliferaton, the preeminent Morchella esculenta extract for being indicated above the offer of embodiment 3 can be used for preparing prevention or control
Treat the drug of tumour.
Embodiment 6
The solid provided in this embodiment for being used to cultivate the preeminent hickory chick that deposit number is CCTCC NO:M 2016032
Culture medium contains: murphy juice, poplar leaf extract, glucose, KH2PO4And agar.
Culture medium provided in this embodiment is prepared via a method which:
1 takes potato 200g, and the fritter of 2cm long is cut into peeling, is cooked, filtered through gauze leaves and takes potato filtrate.
2 choose the wild growth poplar old leaf of Qujing of Yunnan or fallen leaves (brown or yellow), dry.It takes and dries Poplar leaves
200g is cut into 1cm*0.5cm strip, and 500mL water, boiling 20min is added, and filtered through gauze leaves and takes filtrate, i.e. Poplar leaves are extracted
Object.
3 mix above two filtrate, and 20g glucose, KH are added thereto2PO41g, agar 15g, adds water to 1L, matches
The culture medium for cultivating the preeminent hickory chick that deposit number is CCTCC NO:M 2016032 is made, also is understood as improveing
PDA culture medium.
Embodiment 7
The culture medium that embodiment 6 provides imitates the culture for the preeminent hickory chick that deposit number is CCTCC NO:M 2016032
Fruit, method are as follows.
Preeminent hickory chick is seeded on the culture medium that embodiment 6 provides, as experimental group, with common PDA culture medium work
For control, the growing state of preeminent hickory chick is observed.As a result it see the table below 1.
Table 1
In table: ++ indicate that mycelium growth vigor is general, ++++indicating that mycelium growth vigor is fine, * * indicates that sclerotium quantity is general, * * * *
Indicate that there are many sclerotium quantity.
As seen from the results in Table 1, it is cultivated using the culture medium of embodiment 6, preeminent hickory chick (CCTCC NO:M
2016032) growth such as the dense degree of growing way, the per day speed of growth, mycelia, full plate time, Sclerotia forming time, sclerotium quantity
Index is superior to common PDA culture medium.
Morphologic observation is the results show that on the culture medium that embodiment 6 provides, and 6h starts to sprout after inoculation, early growth period bacterium
Silk is close to culture medium, grows to culture medium outer rim direction, mycelia color be it is translucent, it is glossy, it is generally unbranched relatively thick
Mycelium, slow growth after 2 days, mycelia darkens, and aerial hyphae increases, and mycelia is white and has " Y " or branching shape point
Branch, after 4 days, mycelia is by faint yellow gradually in sepia, and mycelia is twisted together more, and slabbing is assembled in many places；After 6 days, sclerotium is presented, and is in
Brown, for sclerotium diameter between 1.2-4.3mm, quality is hard, is in dark brown.
Embodiment 8
It present embodiments provides provided in this embodiment for cultivating deposit number as the preeminent of CCTCC NO:M2016032
The fluid nutrient medium of hickory chick, contains: soybean powder, poplar leaf extract, glucose, KH2PO4And agar.
The fluid nutrient medium the preparation method is as follows:
Common poplar old leaf or fallen leaves (brown or yellow) are chosen, are dried；
The Poplar leaves 200g dried is taken, is cut into 1cm*0.5cm strip, is added 500mL water, boiling 20min, filtered through gauze,
Leave and take filtrate；
5g soybean powder is added into filtrate, it is CCTCCNO for cultivating deposit number that 20g glucose, which adds water to 1L:
The fluid nutrient medium of the preeminent hickory chick of M2016032.
Embodiment 9
Training of the fluid nutrient medium that embodiment 8 provides to the preeminent hickory chick that deposit number is CCTCC NO:M 2016032
Effect is supported, method is as follows.
By strain inoculated eugonic in solid slope culture medium to the Liquid Culture for filling 100mL embodiment 8 and providing
In the triangular flask of the 500mL of base, cultivated 4 days under the conditions of 25 DEG C, during culture, 150rpm and stationary culture according to for 24 hours/it is all for 24 hours
Phase carries out, and prevents from forming bacterium ball, observes hypha growth condition；Using common PDA liquid medium as control.As a result such as following table
Shown in 2.
Table 2
In table: ++ indicate that mycelium growth vigor is general, ++++indicate that mycelium growth vigor is fine.
As shown in Table 2, compared with common PDA liquid medium, the fluid nutrient medium culture provided using embodiment 8,
Mycelial growth rate is fast, and biomass is high, and anti-miscellaneous bacteria ability is strong, and pollution rate is few, and it is short that sclerotium generates the time.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Academy of Agricultural Sciences, Shanghai City
<120>a kind of for cultivating the culture medium and cultural method of preeminent hickory chick
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 739
<212> DNA
<213>artificial sequence
<400> 1
ggaagtaaaa gtcgtaacaa ggtttccgta ggtgaacctg cggaaggatc attaccaaga 60
accacacaga aaagggcagc cgaggggcca accagggcta gtagctttac gttgttgaac 120
gtcctggaac ggacccggag ccgcccccat ctaaacactc tgcgtaccca tcccaccttg 180
cttcccccgg ccatccgctg gggggaggaa caacaaccaa aactctttgt gaagaaacag 240
acgtcagaat cataaccaaa aaaaagttaa aactttcaac aacggatctc ttggttccca 300
catcgatgaa gaacgcagcg aaatgcgata agtaatgtga attgcagaat tcagtgaatc 360
atcgaatctt tgaacgcaca ttgcgccctc tggtattccg gggggcatgc ctgttcgagc 420
gtcataaaaa cctcctcccc cttcgggttt gattactatc gttggggggg tattggccta 480
ctgggaaagc gatttggcaa ttgccttccc actgtcctaa atacacttag acccgcctcc 540
agatgcgaca gcaccgaggc catcaaccgt ggagttatgg aataccgttc tccacacgcc 600
gatggcaaac cggtcgcagt tgcgggcgta aattggagcc ctcttcagga ccctcgtggc 660
ctagcatcca ccatacatat tttgacctcg gatcaggtag ggatacccgc tgaacttaag 720
catatcaata agcggagga 739
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
tccgtaggtg aacctgcg 18
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
tcctccgctt attgatatgc 20
<210> 4
<211> 1000
<212> DNA
<213>artificial sequence
<400> 4
ggatcggcag tgattgtata cgactcacta tagggcgaat tgggcccgac gtcgcatgct 60
cccggccgcc atggcggccg cgggaattcg attggatcgc ccttggaagt aaaagtcgta 120
acaaggtttc cgtaggtgaa cctgcggaag gatcattacc aagaaccaca cagaaaaggg 180
cagccgaggg gccaaccagg gctagtagct ttacgttgtt gaacgtcctg gaacggaccc 240
ggagccgccc ccatctaaac actctgcgta cccatcccac cttgcttccc ccggccatcc 300
gctgggggga ggaacaacaa ccaaaactct ttgtgaagaa acagacgtca gaatcataac 360
caaaaaaaag ttaaaacttt caacaacgga tctcttggtt cccacatcga tgaagaacgc 420
agcgaaatgc gataagtaat gtgaattgca gaattcagtg aatcatcgaa tctttgaacg 480
cacattgcgc cctctggtat tccggggggc atgcctgttc gagcgtcata aaaacctcct 540
cccccttcgg gtttgattac tatcgttggg ggggtattgg cctactggga aagcgatttg 600
gcaattgcct tcccactgtc ctaaatacac ttagacccgc ctccagatgc gacagcaccg 660
aggccatcaa ccgtggagtt atggaatacc gttctccaca cgccgatggc aaaccggtcg 720
cagttgcggg cgtaaattgg agccctcttc aggaccctcg tggcctagca tccaccatac 780
atattttgac ctcggatcag gtagggatac ccgctgaact taagcatatc aataagcgga 840
ggaaaagggc gatcccaatc actagtgaat tcgcggccgc ctgcaggtcg accatattgg 900
gagagctccc aacgcgttgg atgcatagct tgagtattct atagtgtcac ctaaatagct 960
tggcgtaatc tgggtcatag ctgtttcctg gggtgaaatt 1000
Claims (5)
1. a kind of method for cultivating preeminent hickory chick, the deposit number of the preeminent hickory chick is CCTCC NO:M 2016032,
It is characterized in that, it uses culture medium culture；
The preeminent hickory chick for being CCTCC NO:M 2016032 containing poplar leaf extract and deposit number in the culture medium.
2. the method according to claim 1, wherein the poplar leaf extract is Poplar leaves water extract.
3. according to the method described in claim 2, it is characterized in that, the Poplar leaves water extract is prepared by the following method
It arrives:
Poplar leaves are decocted with water, filtering takes filtrate up to the Poplar leaves water extract.
4. method according to claim 1-3, which is characterized in that the culture medium also contains: glucose and
KH2PO4。
5. according to the method described in claim 4, it is characterized in that, the culture medium contains based on every L: 18-22g glucose
With 0.8-1.1g KH2PO4。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711126323.5A CN107653194B (en) | 2017-11-14 | 2017-11-14 | It is a kind of for cultivating the culture medium and cultural method of preeminent hickory chick |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711126323.5A CN107653194B (en) | 2017-11-14 | 2017-11-14 | It is a kind of for cultivating the culture medium and cultural method of preeminent hickory chick |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107653194A CN107653194A (en) | 2018-02-02 |
| CN107653194B true CN107653194B (en) | 2019-09-27 |
Family
ID=61121618
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711126323.5A Active CN107653194B (en) | 2017-11-14 | 2017-11-14 | It is a kind of for cultivating the culture medium and cultural method of preeminent hickory chick |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107653194B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108901589A (en) * | 2018-04-18 | 2018-11-30 | 上海沃施生物科技有限公司 | A kind of separation method of wild delicious lactarius strain |
| CN109566272B (en) * | 2019-01-23 | 2022-09-20 | 上海市农业科学院 | Method for culturing morchella mycelium and culture medium thereof |
| CN109504612A (en) * | 2019-01-23 | 2019-03-22 | 上海市农业科学院 | A kind of cultural method and its culture medium of Morchella esculenta (L.) Pers mycelium |
| CN109504613A (en) * | 2019-01-23 | 2019-03-22 | 上海市农业科学院 | A kind of cultural method and its culture medium of Morchella esculenta (L.) Pers mycelium |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101946634A (en) * | 2010-09-13 | 2011-01-19 | 云南省农业科学院高山经济植物研究所 | Manufacturing method for morchella mother culture |
-
2017
- 2017-11-14 CN CN201711126323.5A patent/CN107653194B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101946634A (en) * | 2010-09-13 | 2011-01-19 | 云南省农业科学院高山经济植物研究所 | Manufacturing method for morchella mother culture |
Non-Patent Citations (2)
| Title |
|---|
| 我国羊肚菌产业发展的现状及趋势;刘伟等;《食药用菌》;20170430;第25卷(第2期);第77-83页 * |
| 羊肚菌生活史周期、人工栽培及功效研究进展;熊川等;《中国食用菌》;20150131;第34卷(第1期);第7-12页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107653194A (en) | 2018-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107653194B (en) | It is a kind of for cultivating the culture medium and cultural method of preeminent hickory chick | |
| CN106613350B (en) | Schizophyllum commune and domestication and cultivation method and application thereof | |
| You et al. | Morphological and molecular differences in two strains of Ustilago esculenta | |
| CN109452088A (en) | Needle mushroom X18 and its cultural method | |
| CN103430855A (en) | Low temperature resistance straw mushroom bacterial and breeding method thereof | |
| CN110699486A (en) | Colloidal gold visual detection method for micropterus salmoides iridovirus and probe used by same | |
| CN109082382A (en) | Cordyceps sinensis Hirsutella sinensis ZJB18002 and its application | |
| CN109097289A (en) | One plant of white Uricularia polytricha bacterial strain | |
| KR101200399B1 (en) | KFRI 1212 and in vitro germination method of Gastrodia elata seeds using the KFRI 1212 | |
| Dung et al. | Morphological and genetic characteristics of Oyster mushrooms and conditions effecting on its spawn growing. | |
| CN102747068B (en) | Method for regulating cloning and transcription of lignin metabolism-related ethylene response factors (ERFs) in Eriobotrya japonica Lindl. | |
| CN106434371A (en) | Neopestalotiopsis zerumbet and method of using same to identify Alpinia zerumbet leaf diseases | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| CN109452089B (en) | White beech mushroom H7 and cultivation method thereof | |
| CN107711296A (en) | A kind of preeminent hickory chick and its authentication method | |
| CN107823225A (en) | The application of preeminent hickory chick | |
| CN109619207A (en) | A kind of fresh adding oil preserved bean curd and preparation method thereof | |
| CN107043708B (en) | Hericium erinaceus strain (beautiful monkey No. 1) | |
| Zohmangaiha et al. | Ganoderma Species of Mizoram, India | |
| CN109055248A (en) | A kind of bio-control yeast bacterium activated freeze dried powder and preparation method thereof | |
| CN108359745A (en) | The dual RT-PCR method of synchronous detection wheat dwarf virus and Wheat Yellow strip virus | |
| CN104313151B (en) | For the identification of primer pair and the test kit of Acremonium terricola mutant strain MKL18 | |
| Zhou et al. | Semiaquilegia danxiashanensis (Ranunculaceae), a new species from Danxia Shan in Guangdong, southern China | |
| CN103667471B (en) | Method for detecting allergenic protein GlymBd28K in soybeans, and its special primer | |
| CN102021172A (en) | Tilapia mossambica white blood cell inducible cAMP early repressor (ICER) gene sequence and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |