CN107603932B

CN107603932B - Method for improving yield of amino acid of corynebacterium glutamicum and application of method

Info

Publication number: CN107603932B
Application number: CN201610546762.0A
Authority: CN
Inventors: 温廷益; 张宇; 张芸; 商秀玲; 刘树文; 王博
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2016-07-12
Filing date: 2016-07-12
Publication date: 2020-07-21
Anticipated expiration: 2036-07-12
Also published as: CN107603932A

Abstract

The invention provides a method for improving the yield of amino acid of corynebacterium glutamicum, which comprises the following steps of 1) obtaining reaction data, metabolite data and annotated gene data required by a corynebacterium glutamicum genome-scale metabolic network model, constructing the corynebacterium glutamicum genome-scale metabolic network model, verifying the accuracy of the corynebacterium glutamicum genome-scale metabolic network model, 2) predicting metabolic flux and metabolic flux regulation modes required to be correspondingly regulated for improving the yield of amino acid according to the corynebacterium glutamicum genome-scale metabolic network model verified in the step 1), 3) determining a target gene according to the metabolic flux and metabolic flux regulation modes required to be regulated and the annotated gene data, carrying out genetic modification on the target gene, and constructing engineering bacteria.

Description

Method for improving yield of amino acid of corynebacterium glutamicum and application of method

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving the yield of amino acid of corynebacterium glutamicum and application thereof.

Background

At present, microorganisms play an important and irreplaceable role in solving the problems of food, health, resource, environmental protection and the like of human beings. In modern fermentation industrial production, all original strains need to be improved by adopting breeding technology, so that the fermentation production efficiency is greatly improved, and the fermentation production cost is reduced. Metabolic engineering (Metabolic engineering) also called Pathway engineering (Pathway engineering) was proposed in the middle of the 90 s of the 20 th century and defined as: the process of utilizing recombination technology to perform genetic operation on enzymatic reaction, substance transportation and regulation functions of cells and further improve the biological activity of the cells is purposefully changed on the basis of the analysis of an intracellular metabolic pathway network system so as to better utilize the cell metabolism to perform chemical transformation, energy conversion synthesis and molecular assembly.

With the development of genome and its related technologies, the whole genome sequences of almost all important industrial microorganism model strains have been published, and the research of microbial manufacturing has entered the post-genome era. The microbial production in the post-genome era has the following characteristics: 1) the accumulation of proteome data derived from microbial genomes makes it easier to recognize, rationally design and directionally change the performance of enzymes; 2) the accumulation of transcriptomic and metabolomic data contributes to the increased ability of industrial microorganisms to withstand the harsh environment of a microbial manufacturing process; 3) from the local research on the functions of individual genes or proteins in microorganisms, the research is shifted to the industrial microorganism physiological research taking all genes, mRNA, proteins and metabolites in cells as research objects; 4) based on the construction, simulation and analysis of a genome-scale gene regulation network, a signal transduction network, a protein interaction network and a metabolic network of bioinformatics, the metabolic engineering is gradually pushed into a more rational system metabolic engineering era; 5) the metabolic pathway is accurately controlled by adopting the synthetic biology technology, the target protein is synthesized, the artificial cell is constructed, and the manufacturing efficiency of the microorganism is obviously improved. It has been mentioned previously that since genes and proteins tend to interact in groups through the network to influence microbial cell function, studies on understanding and global regulation of the physiological functions of industrial microorganisms must construct and analyze networks of their interactions. These molecular and gene interaction networks include gene regulatory networks, signal transduction networks, protein interaction networks, metabolic networks, and the like. The genome annotation-based metabolic network constructs all biochemical reactions in microbial cells into a network model, and reflects the interaction relationship among all compounds participating in metabolic processes and all catalytic enzymes.

The Genome scale metabolic network model (GSMM) comprises the vast majority of the biochemical reactions that occur in a given microbial cell. The regulation of microbial cell metabolism occurs at the level of gene-gene, gene-protein, protein-metabolite, and physical interactions. GSMM serves to fully understand the regulatory mechanisms within microbial cells through integration with other omics data, such as transcriptome, proteome, etc. Therefore, the genome-scale metabolic network model can provide an efficient platform for understanding the physiological metabolic functions of microorganisms from the global level. The BIGG database indicates that the metabolic network of prokaryotic microorganisms contains more than 1000 metabolites, more than 1200 genes and more than 2000 biochemical reactions (e.coli as an example); and the eukaryotic microorganism metabolic network model comprises 1200 metabolites, 1000 genes and 1500 biochemical reactions (taking s. cerevisiae as an example). The genome-scale metabolic network model typically comprises about 6% to 15% (eukaryotic microorganisms) and 25% (prokaryotic microorganisms) Open Reading Frames (ORFs). Currently, GSMM is widely used to qualitatively and quantitatively predict cell growth phenotypes under different metabolic or environmental perturbation conditions. The method comprises the following steps: 1) predicting a global relationship among different nutrient absorption rates, metabolic byproduct synthesis rates and cell growth rates by adopting Flow Balance Analysis (FBA); 2) predicting cell yield and specific growth rate on different types of media; 3) predicting the effect of Gene deletion on cell growth phenotype based on Gene-protein-reaction (GPR) principles; 4) predicting and constructing a gene set essential for the growth (or synthesis of a target metabolite) of the microorganism; 5) quantitatively predicting the growth phenotype of the microorganism under different environments or metabolic disturbances.

The study and modification of industrial strains is not without understanding and understanding the cell network, and the gene transcription regulation and metabolic network of C.glutamicum has been the focus of attention. Ikeda et al and Kalinowski et al have respectively completed the genome sequencing of C.glutamicumAATCC 13032 strain, bringing the study of C.glutamicbacteria into a new era of systems biology. Kjeldsen et al (Kjeld)

Kjeldsen, Jens Nielsen (2009) InSilo Genome-Scale Regulation and variation of the Corynebacterium Genome network.Biotechnol. Bioeng.,102: 583. sup. 597.) and Yohei et al (Yohei Shinfuku, Natee Sorpipotron, Masahino, Chikara Furusawa, Takashiras Hiras 1and Hiroshi Shimi (2009) Development and experimental Verificaiof a Genome-colloidal model for Corynebacterium glutamicum microorganism Factors, 8:43) use the annotated database to construct a model containing about 500 coryneform Genome, but the metabolic number of the coryneform Genome is less than that of the medium reactions, and the more comprehensive reactions of the Corynebacterium metabolism including the medium reactions are not beneficial. Therefore, the further research on the Corynebacterium glutamicum metabolic network and the application of metabolic network models to improve strains have important significance for industrial production.

Disclosure of Invention

The invention provides a method for improving the yield of amino acid of corynebacterium glutamicum and application thereof, solves the problems that the existing corynebacterium glutamicum genome metabolic network model cannot comprehensively reflect the real growth and metabolism conditions of thalli and the prediction is not accurate enough, and successfully constructs a recombinant bacterium for improving the yield of L-proline according to the prediction result.

In one aspect of the present invention, there is provided a method for increasing the production of amino acids from corynebacterium glutamicum, comprising the steps of:

1) acquiring reaction data, metabolite data and annotated gene data required in a corynebacterium glutamicum genome-scale metabolic network model, constructing the corynebacterium glutamicum genome-scale metabolic network model, and verifying the accuracy of the corynebacterium glutamicum genome-scale metabolic network model;

2) predicting metabolic flux required to be correspondingly adjusted for improving the yield of the amino acid and an adjusting mode of the metabolic flux according to the genome-scale metabolic network model of the corynebacterium glutamicum verified in the step 1);

3) and determining a target gene according to the metabolic flux needing to be regulated and the regulation mode of the metabolic flux in combination with the annotated gene data, and carrying out genetic modification on the target gene to construct engineering bacteria.

In the above method, the reaction data required in step 1) include transport reaction, biomass reaction, exchange reaction, sugar metabolism reaction, amino acid metabolism reaction, vitamin and cofactor metabolism reaction, complex lipid metabolism reaction, nucleotide metabolism reaction, lipid metabolism reaction, energy metabolism reaction, and other carbon metabolism reaction.

In another aspect of the present invention, there is also provided a use of the method described above for increasing the production of L-proline, wherein the target gene in step 3) is putA, and the genetic modification is to knock out the putA gene in the genome of corynebacterium glutamicum.

The use as described above, wherein the target gene in step 3) further comprises acn, and the genetic modification further comprises enhancing expression of acn gene in the genome of corynebacterium glutamicum.

For the above-mentioned use, the step of knocking out the putA gene comprises:

1) amplifying an upstream homology arm and a downstream homology arm of the putA gene by using a corynebacterium glutamicum genome as a template through primers, and fusing the upstream homology arm and the downstream homology arm of the putA gene;

2) the upstream homologous arm fragment and the downstream homologous arm fragment fused in the step 1) are subjected to double enzyme digestion by EcoR I and Hind III, and then are connected with a vector pK18mobsacB subjected to the same double enzyme digestion treatment;

3) transforming the connecting product in the step 2) into escherichia coli, screening and verifying positive transformants in a culture medium containing kanamycin to obtain a recombinant vector pK18 mobsacB-delta putA;

4) transforming the recombinant vector pK18 mobsacB-delta putA into corynebacterium glutamicum, obtaining a bacterial colony of which the recombinant vector pK18 mobsacB-delta putA is integrated on a chromosome through forward screening in a culture medium containing kanamycin, obtaining a bacterial colony which generates the second homologous recombination through reverse screening in a culture medium containing cane sugar, and verifying to obtain the recombinant bacterium CG413 of which the putA gene is knocked out.

The use as described above, wherein the enhancement of the expression of acn gene comprises replacing the promoter P of acn gene_acnReplacing the RBS of the acn gene with a conserved RBS sequence of a corynebacterium glutamicum high-expression gene and replacing the start codon TTG of the acn gene with ATG, and specifically comprises the following steps:

1) acn gene promoter upstream homology arm, P, are amplified by primer using corynebacterium glutamicum genome DNA as template_eftuA promoter, acn gene initiation region (containing RBS sequence and initiation codon), acn gene initiation region downstream homology arm, acn gene promoter upstream homology arm, P_eftuPromoter, acn gene initiation region and homology arms downstream of acn gene initiation region;

2) the acn gene promoter upstream homology arm, P fused in the step 1)_eftuThe promoter, the acn gene initiation region and the acn gene initiation region downstream homologous arm fragment are subjected to double enzyme digestion by Hind III and EcoR I, and then are connected with a homologous recombination vector pK18mobsacB subjected to the same double enzyme digestion treatment;

3) transforming the ligation product in the step 2) into escherichia coli, screening positive transformants in a culture medium containing kanamycin, and verifying to obtain a recombinant vector pK18mobsacB-P_eftu::P_acn-RBS-acn^T1A；

4) The recombinant vector pK18mobsacB-P is added_eftu::P_acn-RBS-acn^T1AThe recombinant bacterium CG413 of which the putA gene is knocked out is transformed, and a recombinant vector pK18mobsacB-P is obtained by positive screening in a culture medium containing kanamycin_eftu::P_acn-RBS-acn^T1AThe colony integrated on the chromosome is reversely screened in a culture medium containing cane sugar to obtain a colony which generates the second homologous recombination and is verified, and the obtained acn gene promoter is replaced by a corynebacterium glutamicum endogenous strong promoter P_eftuThe RBS of the acn gene was replaced with the conserved RBS sequence of the highly expressed gene of C.glutamicum while the start codon TTG of the acn gene was replaced with the ATG of high expression intensity of C.glutamicum.

The application is that in the step 1), P15 and P16 are used as primers for PCR amplification of the upstream homology arm of the promoter of the putA gene, P17 and P18 are used as primers for PCR amplification of the downstream homology arm of the putA gene, and the primer sequences are respectively as follows:

P15：5’-CCCAAGCTTGGTCAATGTCGGTGATGATCCT-3’

P16：5’-CCATGCGCAAAACGAGGTGGTTCTCCTTCAAGATCAG-3’

P17：5’-TGAAGGAGAACCACCTCGTTTTGCGCATG-3’

P18：5’-ACGCGTCGACACGGTCACGCCGTGCTCCA-3’。

the application is that in the step 1), P21 and P22 are used as primers to amplify the upstream homology arm of the acn promoter; p amplification with P23 and P24 as primers_eftuPromoter and acn gene initiation region; the downstream homology arms of the acn gene initiation region are amplified by taking P25 and P26 as primers, and the sequences of the primers are respectively as follows:

P21：5’-CCGGAATTCAAAATCTGATTCCTTTGCA-3’

P22：5’-TTCGCAGGGTAACGGCCACTTCATTATCCTAACAGTACAA-3’

P23：5’-GTACTGTTAGGATAATGAAGTGGCCGTTACCCTGCGA-3’

P24：5’-AGTCACAGTGAGCTCCATTTCTATCCTCCTTTTGTATGTCCTCCTG-3’

P25：5’-ATACAAAAGGAGGATAGAAATGGAGCTCACTGTGACTGAA-3’

P26：5’-CCCAAGCTTTGGTGGTGTGGGAGTCG-3’。

in the application, the corynebacterium glutamicum is corynebacterium glutamicum containing a proB gene with site-directed mutation, wherein the site-directed mutation is to mutate the 149 th glycine into aspartic acid.

The use as described above, wherein the C.glutamicum is a C.glutamicum which overexpresses the site-directed mutated proB gene.

Corynebacterium glutamicum with improved production of L-proline constructed in any of the applications described above.

Compared with the existing model, the Corynebacterium glutamicum genome-scale metabolic network model has the following advantages:

(1) the reaction number, the metabolite number and the annotated gene number are increased, the reaction number reaches 1487, the metabolite number reaches 1194, the annotated gene number reaches 772, certain specific proteins (such as acetyl carrier proteins) and tRNAs are added into the genome-scale metabolic network model, the intermediate reaction number is increased, for example, the intermediate reactions of a synthesis part of a cell wall and a fatty acid synthesis part are increased, the details of a maximized reaction path are favorable for finding out restriction points of metabolic regulation, so that the metabolic network model of corynebacterium glutamicum is more complete compared with the prior art, and a theoretical basis is provided for strain modification.

(2) The direction of the increase reaction in (1) was determined: for an uncertain reaction of new addition, the reaction direction must be determined, and we inquire the thermodynamic parameters of the reaction by four ways: the E.coli network, the BRENDA website, the SEED website, and the eQuilibator website. Since the intracellular pH values of both Escherichia coli and Corynebacterium glutamicum were 7.0, the thermodynamic constant Δ of the enzyme reaction_rG' is pH-dependent, so that the E.coli.DELTA.is directly utilized_rG', the response specific to C.glutamicum was determined by querying the BRENDA and SEED websites.

(3) Feedback inhibition module by amino acid addition: the upper limit of the flux of some amino acids with a net accumulation of 0 after feedback inhibition was set to 0 in the model, which makes the model closer to the actual physiological metabolism of the wild type of C.glutamicum.

According to the prediction result of the Corynebacterium glutamicum genome scale metabolic network model, a target gene putA is determined, the putA gene is knocked out from the Corynebacterium glutamicum genome, so that the yield of L-proline is improved by 27.326%, the expression of acn gene is enhanced according to the prediction result, so that the yield of L-proline of Corynebacterium glutamicum is further improved by 41.038%, and the L-proline yield of the L-proline engineering bacterium constructed by the invention is 10-120 g/L at the end of fermentation, and the production intensity is 0.1-2 g/L/h.

Drawings

FIG. 1 is a schematic diagram of core metabolic pathways of a Corynebacterium glutamicum genome-scale metabolic network model provided in example 1 of the present invention;

FIG. 2 is a diagram for quantitatively predicting a growth phenotype of Corynebacterium glutamicum using a genome-scale metabolic network model constructed in example 1;

FIG. 3 FBA data (dotted line box) and data of genome-scale metabolic network model constructed in example 1¹³C metabolic flux analysis data comparison (solid line box);

FIG. 4OptForce algorithm combined with genome-scale metabolic network model prediction constructed in example 1 to realize L-proline overproduction metabolic flux map required to be adjusted;

FIG. 5 is a robustness analysis of P5CD and EX-pro-L (e) with biomass as the objective function;

FIG. 6 is a robust analysis of P5CD and EX-pro-L (e) with L-proline as the objective function;

FIG. 7 is a robust analysis of P5CD and EX-pro-L (e) with both biomass and L-proline as objective functions;

FIG. 8 is a robustness analysis of the biomass as an objective function, ACONTA (b) and EX-pro-L (e);

FIG. 9 is a robustness analysis with L-proline as the objective function, ACONTA (b) and EX-pro-L (e);

FIG. 10 is a robust analysis of both biomass and L-proline as objective functions, ACONTA (b) and EX-pro-L (e);

FIG. 11 is a schematic diagram of recombinant plasmid pWYE 1403;

FIG. 12 shows the growth of strain ATCC13032 and its knockout putA strain;

FIG. 13 is a specific growth rate analysis of strain ATCC13032 and its knockout putA strain;

FIG. 14 is a graph of acn transcript levels in CG 421;

FIG. 15 is a liquid phase diagram of a supernatant of a fermentation product in example 4 of the present invention;

FIG. 16 is a plot of a shake flask fermentation process for ATCC 13032;

FIG. 17 is a graph of a shake flask fermentation process for CG 415;

FIG. 18 is a graph of a shake flask fermentation process for CG 413;

FIG. 19 is a graph of a shaking flask fermentation process for CG 421;

FIG. 20 is a graph of a shake flask fermentation process for CG 430;

FIG. 21 is a graph of fermentation process in a CG430 fermenter.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 construction of a model of the metabolic network of Corynebacterium glutamicum genome size

In this embodiment, a bioinformatics website (see table 1) is used as a tool to perform preliminary analysis on a metabolic network of corynebacterium glutamicum, so as to obtain reaction data, metabolite data and annotated gene data required in a genome-scale metabolic network model of corynebacterium glutamicum, and a gene-enzyme-reaction relationship is used as an interface to integrate a transcription control network and the metabolic network, so as to construct the genome-scale metabolic network model of corynebacterium glutamicum.

TABLE 1 genome-Scale Metabolic network modeling of the required database

In the originally obtained metabolic network model, the simulated growth rate is 0, and the modification method is (a) to look at each reaction flux at this time, start from the main carbon source, observe the metabolic flow path of carbon in the network, find the breakpoint in the network, analyze the cause of the breakpoint and modify it, (b) to look at whether each biocomponent precursor substance is synthesized, growth rate is 0 indicates that at least one biocomponent precursor substance cannot be synthesized, in the experiment, add a Demand reaction to each biocomponent precursor substance cyclically and perform optimization calculation with each Demand reaction as an objective function, the calculation result is 0 to indicate that the precursor substance cannot be synthesized, and then to look at where the breakpoint occurs in the metabolic flux flow for synthesizing the precursor substance, or whether the culture medium component is missing, etc., the modification is performed (the main simulation and analysis tool used in this example is referred to danielhydiduke, Jan Schellenberger, Richard qu, ronn flash, inc. 3583. native, book, inc. 3532. fig. 7.

This example establishes a network with 1487 reactions, 1194 metabolites and 772 genes through a series of successive analyses, the core metabolic pathways of which are shown in fig. 1.

In this example, to obtain a complete metabolic network model of corynebacterium glutamicum, the following operations were performed during the modeling process:

(1) some specific proteins (e.g., acetyl carrier proteins) and tRNAs were added to the metabolic network model.

(2) Compartment division: three separate compartments are divided during reconstitution: intracellular, periplasmic space and extracellular. Each metabolite in the network is classified as either intracellular, periplasmic space or extracellular, and each substance entering the network is the process from extracellular to intracellular through the periplasmic space.

(3) Increase in metabolic pathway details: details of the reaction pathway are maximized in the construction process, such as the increase of cell wall synthesis and fatty acid synthesis (see table 2), and the details of the reaction pathway are favorable for finding out the restriction point of metabolic regulation, so that a solid theoretical basis is provided for the prediction of subsequent metabolic engineering.

TABLE 2 increased cell membrane Synthesis response (part)

(4) Thermodynamics of the addition reaction: the reaction catalyzed by the enzyme needs to follow the reaction thermodynamic definite rate, for the uncertain reaction added newly, the reaction direction must be determined, and we have four ways to inquire the reaction thermodynamic parameters: the E.coli network, the BRENDA website, the SEED website, and the eQuilibator website. Since the intracellular pH values of both Escherichia coli and Corynebacterium glutamicum were 7.0, the thermodynamic constant Δ of the enzyme reaction_rG' is pH-dependent, so that the E.coli.DELTA.is directly utilized_rG', responses specific to C.glutamicum (lactic acid producing responses, see Table 3) were determined by querying the BRENDA and SEED websites.

TABLE 3 reaction (part) with fresh addition

(5) In order to more closely approximate the actual growth of the wild type strain of C.glutamicum, we set the upper flux limit of some amino acids with a net accumulation of 0 under feedback inhibition to 0, such as L-phenylalanine, L-proline, L-serine (see Table 4).

TABLE 4 amino acid efflux reaction (section)

Example 2 verification of the model of the metabolic network of Corynebacterium glutamicum genome size

In the simulation calculation, the current constraint-based optimization algorithm is the most common analysis method for analyzing the metabolic network. These constraint-based algorithms generally consist of constraint conditions, decision variables, and objective functions. For example Flux Balance Analysis (FBA), it is assumed that the organism is in a quasi-steady state, i.e. the concentration of the respective intermediary metabolites remains unchanged. The calculation principle of FBA can be expressed by the following equation:

Maximize:C^T·V

Subject to:S·V＝0

V_min≤V≤V_max

wherein C is^TIs the value of the objective function expressed as a function of the respective reaction fluxes, S is a stoichiometric matrix of order m × n, V represents the vector of the reaction fluxes, V_maxDenotes the upper flux limit, V, of each reaction_minRepresents the lower flux limit of each reaction.

1. Carbon source growth phenotype analysis

Three typical carbon sources (such as glucose, fructose and sucrose) were selected, and the growth phenotype of Corynebacterium glutamicum was quantitatively predicted by using the genome-scale metabolic network model constructed in example 1, and the results are shown in FIG. 2. The actual experimental data in the literature is used as an x-axis, and the data calculated by using the metabolic network model of the invention is used as a y-axis to be plotted, wherein the closer the point is to the diagonal line y, the closer the point is to the x, the closer the experimental value is proved. Linear regression was performed on the points y-x, and the data was closer to 1and closer to y-x, so that the growth of the genome-scale metabolic network model constructed in example 1 on different carbon sources was very close to the experimental data (see fig. 2).

2. Generating metabolite analysis

Qualitative analysis of the genome-scale metabolic network model constructed in example 1 revealed that 20 amino acids and organic acids such as succinic acid, acetic acid, pyruvic acid, citric acid, lactic acid, ethanol, α -ketoglutaric acid could be produced and transported extracellularly by corynebacterium glutamicum.

3. Intracellular metabolic pathway analysis

To further validate the genome-scale metabolic network model constructed in example 1, the results of FBA were compared with those reported in the literature¹³Results of the C metabolic flux analysis are compared and shown in FIG. 3. Three data sets in the solid line box in FIG. 3 are from different literature wild-type strains¹³C metabolic flux analysis data, data in the dotted line box are predictive data of the genome-scale metabolic network model constructed in example 1. It can be seen from the figure that the data of the genome-scale metabolic network model constructed in example 1 are close to the experimental values in the literature.

The prediction and the analysis and verification show that the model can accurately reflect the actual growth and metabolism phenotype of the corynebacterium glutamicum and can further perform more complex calculation.

Example 3 prediction of engineered targets for the synthesis of L-proline, L-glutamic acid, L-lysine and L-valine Using a model of the genomic-scale metabolic network of C.glutamicum

Firstly, predicting L-proline synthesis modification target by using Corynebacterium glutamicum genome-scale metabolic network model

1. Prediction of L-proline using OptForce

The metabolic engineering modification target point of L-proline accumulation can be promoted by adopting an OptForce algorithm and a genome-scale metabolic network model prediction (Ranganathan S, suters PF, Maranas CD. OptForce: an optimization process for identifying all genetic engineering modification. Compout Biol,2010,6(4): e1000744) constructed in the embodiment 1, the metabolic flow needing to be regulated in the prediction result is shown in FIG. 4, in order to realize the regulation of the metabolic flow, two gene targets are selected in corresponding metabolic pathways to be operated, i.e. a putout of a putA, and b. the expression of acn is improved.

2. Single point analysis for putA (P5CD, Inject response in network)

In E.coli, proline dehydrogenase (encoded by putA) catalyzes L-proline decomposition reaction, L-proline can be decomposed into carbon or nitrogen source available to E.coli, and homologous sequence alignment shows that there is a homologous protein of PutA (amino acid sequence homology is about 19.02%) in C.glutamicum. it has been reported in the literature that C.glutamicum can use L-proline as carbon or nitrogen source, and based on KEGG annotation, it is assumed to have the same function as PutA of E.coli, and then a single point analysis is performed thereon.Biomass (FIG. 5), L-proline (FIG. 6) and Biomass and L-proline (FIG. 7) are used as objective functions, respectively, and the efflux relationship between L-proline flux and P5CD flux (1pyr5 [ c ] +2h2o [ c ] + nad [ c ] - > glu-L [ c ] + h [ c ] + nadh [ c ]. 5 shows that efflux flux of 42-proline is 0 under normal conditions, and that efflux of P5-proline is regulated by a robust pattern of 890-84, and thus the efflux of proline is increased as shown in FIG. 7-8236.

3. Single point analysis of acn (ACONTA/ACONTb, injection reaction in network)

The aconitase (Acn-encoded) is the second-step reaction catalytic enzyme on the TCA cycle, the results of OptForce show that increased Acn flux can increase the efflux flux of L-proline, which is then analyzed in a single point, as shown in fig. 8, the efflux flux of L-proline and the flux of acota (C > < > acon-C [ C ] + h2o [ C ], aconb: acont-C [ C ] + h2 [ C ]) are observed as a function of the biomass (fig. 8), L-proline (fig. 9) and biomass and L-proline (fig. 10), respectively, the robust relationship between the efflux flux of acota (C > < > acon-C ] + h2 [ C ] + 8292 [ C ]) is observed, fig. 8 shows that the efflux flux of acota (b) is 0 under normal conditions, when the efflux flux of acota (b) is around 1, fig. 9 shows that the efflux flux of acata (b) must be increased to such a level that the efflux flux of acata (733) is increased, and the expression of acata (p) is increased as shown in a diagram 5848325, if the efflux flux is to maximize the mode.

Second, predicting L-glutamic acid, L-lysine and L-valine synthesis modification targets by using Corynebacterium glutamicum genome-scale metabolic network model

The metabolic engineering target point capable of promoting L-glutamic acid accumulation can be predicted by adopting an OptForce algorithm and combining a genome-scale metabolic network model prediction (Ranganathan S, Suthers PF, Maranas CD, OptForce: an optimization processing procedure for identifying all genetic engineering, Compout Biol,2010,6(4): e1000744), and the metabolic target points consistent with the existing literature reports in the prediction result are a target point-isocitrate dehydrogenase (icd) needing to be up-regulated and a target point-2-ketoglutarate dehydrogenase (kgd) needing to be down-regulated.

The metabolic engineering targets capable of promoting L-lysine accumulation are predicted by using OptForce algorithm in combination with genome-scale metabolic network model prediction (Ranganathan S, suters PF, Maranas CD. OptForce: an optimization process for identification all genetic engineering targets) constructed in example 1, and the metabolic targets consistent with the existing literature reports in the prediction results are aspartate kinase (lysC), diaminopimelate dehydrogenase (ddh), dihydropicolinate reductase (dapB), dihydropicolinate synthase (dapA) and diaminopimelate decarboxylase (lysA) which need to be up-regulated, homoserine dehydrogenase (hom), isocitrate dehydrogenase (icd) and cis-aconitase (acn) which need to be down-regulated.

The metabolic engineering targets capable of promoting L-valine accumulation were predicted by using the OptForce algorithm in combination with the genome-scale metabolic network model prediction constructed in example 1 (Ranganathan S, suters PF, Maranas CD. OptForce: an optimization process for identifying all genetic engineering targets, Compout Biol,2010,6(4): e1000744), and the metabolic targets consistent with the existing literature reports in the prediction results are acetolactate synthase (ilvBN), ketol acid reductoisomerase (ilvC), dihydroxy acid dehydratase (ilvD), threonine deaminase (ilvA) and pyruvate dehydrogenase (aceE), 3-methyl-2-oxobutyrate hydroxymethyltransferase (panB) and pantothenate-alanine ligase (panC), which need to be up-regulated.

From the perspective of metabolic engineering, the target point of modification predicted by using the genome-scale metabolic network model constructed in example 1 is consistent with the experimental results reported in the prior literature.

Example 4 metabolic engineering of L-proline guided by the Corynebacterium glutamicum genome-scale metabolic network model

Construction of L-proline-containing basidiomycetes

According to the metabolic regulation network of L-proline, 5-phosphoglutamate kinase (proB code) which is the first enzyme in the L-proline synthesis pathway is regulated by feedback inhibition of L-proline which is the final product, in this example, glycine at position 149 of proB is subjected to point mutation to be aspartic acid according to the method described in patent (CN101084312A), a wild type strain ATCC13032 is taken as a starting strain, and Chassis bacteria CG415 capable of accumulating L-proline is constructed, and the specific construction steps of the strain are as follows:

1. site-directed mutagenesis of proB gene on chromosome to obtain L-proline Chassis engineering bacterium CG415

The site-directed mutagenesis of the chromosome proB gene adopts a two-step replacement method, firstly, the proB gene is knocked out, and then the proB gene of the site-directed mutagenesis is inserted into the chromosome.

1) Knockout of proB gene: primers were first designed based on the proB gene of Corynebacterium glutamicum ATCC13032 and the upstream and downstream sequences thereof, respectively, in Genbank.

PCR amplifying proB gene upstream homology arm by taking Corynebacterium glutamicum ATCC13032 genome DNA as a template and P1 and P2 as primers; and amplifying the downstream homology arms of the proB gene by using P3 and P4 as primers. Then, the purified PCR product is used as a template, P1 and P4 are used as primers, and an overlap extension PCR (SOE) technology is adopted for amplification to obtain a 918bp fragment (SEQ ID NO: 1) containing the upstream and downstream homology arms of the gene proB to be knocked out. Wherein, SEQ ID NO: 1 from the 5' end, nucleotides 1 to 509 are upstream homology arms of a gene proB to be knocked out, and SEQ ID NO: 1 nucleotide 510-918 from the 5' end is the downstream homology arm of the gene proB to be knocked out.

The PCR product which is purified and recovered is subjected to double enzyme digestion by EcoR I and HindIII and then is connected with a homologous recombination vector pK18mobsacB which is subjected to the same double enzyme digestion treatment, the connection product is converted into escherichia coli DH5 α by adopting a chemical conversion method, transformants are screened on a L B plate containing kanamycin (50 mug/m L), after the transformants are subcultured for three generations, the transformants are identified by adopting colony PCR (polymerase chain reaction) by taking P5 and P6 as primers, 1130bp of transformants are positive transformants are obtained, plasmids are extracted from the transformants which are identified correctly, and the plasmids are subjected to double enzyme digestion identification by EcoR I and HindIII to obtain 918bp of transformants which are positive transformants, and further sequence determination verifies that the construction of the recombination plasmid pK18 mobsacB-delta proB is successful, and a vector which is obtained by inserting a fragment (SEQ ID NO: 1) containing the upstream and downstream homologous arms of the gene proB to be knocked into the vector pK I and HindIII enzyme digestion sites of the vector 18mobsacB is obtained.

The primer sequences used above were as follows (5 '→ 3'):

P1：CCGGAATTCCAAGTTGGGCATTGAGGACG(EcoR I)(SEQ ID NO：6)

P2：CAGCAGGCCCGCGCTTCCGGATTCATGTCCGTAT(SEQ ID NO：7)

P3：GGACATGAATCCGGAAGCGCGGGCCTGCTGGTGGCGG(SEQ ID NO：8)

P4：CCCAAGCTTGGCCGCACGCTCCACG(HindⅢ)(SEQ ID NO：9)

P5：ATGTGCTGCAAGGCGATTAA(SEQ ID NO：10)

P6：TATGCTTCCGGCTCGTATGT(SEQ ID NO：11)

P7：ATCACCGCACTAAGGGGCAGTTCCA(SEQ ID NO：12)

P8：GGACGACCAGAGTTATTAACCGCAA(SEQ ID NO：13)

the homologous recombinant plasmid pK18 mobsacB-delta proB with correct sequence determination is electrically transformed into Corynebacterium glutamicum ATCC13032, colonies with the recombinant plasmid integrated onto the chromosome are obtained by kanamycin resistance forward screening, and colonies with the second homologous recombination are obtained by sucrose lethal reverse screening. Genomic DNA extraction and PCR amplification identification are carried out on the colonies by taking P7 and P8 as primers, 1200bp is obtained as positive, and the colony is named as CG405 (WT-delta proB).

CG405(WT- Δ proB) was further sequenced, and as a result, the knockout of the proB gene on chromosome ATCC13032 was successful, and the construction of CG405 was successful.

2) Insertion of site-directed mutated proB gene: PCR was carried out using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P1 and P9 as primers to amplify the upstream fragment of the proB gene containing the G446A (glycine at position 149 is changed to aspartic acid) mutation site, and P10 and P4 as primers to amplify the downstream fragment of the proB gene containing the G446A (glycine at position 149 is changed to aspartic acid) mutation site. And then using the purified PCR product as a template and P1 and P4 as primers, and adopting an overlap extension PCR (SOE) technology to amplify to obtain a 2028bp long fragment (SEQ ID NO: 2) containing upstream and downstream homology arms of the proB gene mutation fragment. Wherein, SEQ ID NO: 2 from the 5' end, nucleotides 1 to 509 are proB gene upstream fragments, SEQ ID NO: 2 from the 5' end, the 510-th 1609 th nucleotide is a point mutant proB gene, and the sequence shown in SEQ ID NO: 2 from the 5' end, nucleotide 1610-2028 is a downstream fragment of the proB gene with point mutation.

The primer sequences used above were as follows (5 '→ 3'):

P9：GTCACCAAAATTCACATCGGTGGTTGCCACGGT(SEQ ID NO：14)

P10：ACCGTGGCAACCACCGATGTGAATTTTGGTGAC(SEQ ID NO：15)

the purified and recovered PCR product is double digested with EcoR I and HindIII and then connected with homologous recombination vector pK18mobsacB which is treated by the same double digestion, the connection product is transformed into Escherichia coli DH5 α by a chemical transformation method, transformants are screened on a L B plate containing kanamycin (50 mug/m L), after the transformants are subcultured for three generations, the transformants are identified by colony PCR with P5 and P6 as primers to obtain a transformant with 2240bp as positive, plasmids are extracted from the transformants with correct identification, and the plasmids are double digested with EcoR I and HindIII to obtain a transformant with 2028bp as positive, the sequence determination and verification are further carried out, and the recombination plasmid pK18mobsacB-proB is connected with the homologous recombination vector pK18mobsacB which is treated by the same double digestion^G446AThe construction was successful.

The homologous recombinant plasmid pK18mobsacB-proB with correct sequence determination^G446AElectrotransformation is carried out to Corynebacterium glutamicum CG405, a colony with recombinant plasmid integrated on chromosome is obtained through kanamycin resistance forward screening, and positive bacteria with two homologous recombination are obtained through sucrose lethal reverse screening.

Carrying out PCR amplification identification on positive bacteria by taking P7 and P8 as primers to obtain 2310bp recombinant bacteria WT-proB^G446ADesignated as Corynebacterium glutamicum CG415 (WT-proB)^G446A)。

The recombinant strain extracts genomic DNA for sequencing, and as a result, G446A point mutation is successfully carried out on the chromosomal proB gene of Corynebacterium glutamicum ATCC13032, and the Corynebacterium glutamicum CG415 (WT-proB)^G446A) The construction was successful. The G446A point mutation of the proB gene changed the 149 th glycine of the protein encoded by the proB gene into aspartic acid.

2. Construction of L-proline-producing recombinant bacterium CG409 containing plasmid

PCR amplification of proB Using genomic DNA of Strain CG415 as template and P11 and P12 as primers, respectively^G446AObtaining 1142bp PCR product as proB^G446AFragment (SEQ ID NO: 3).

The PCR product is subjected to double enzyme digestion by Xba I and Hind III, and then is connected with a Corynebacterium glutamicum-Escherichia coli shuttle expression plasmid pXMJ19 (purchased from Biovector Science L ab, Inc, product number SMD1168H) subjected to the same double enzyme digestion treatment, the connection product is transformed into Escherichia coli DH5 α by a chemical transformation method, a L B plate containing chloramphenicol (20 mu g/m L) is screened, after the three generations of subculture, colony PCR is adopted by taking P13 and P14 as primers to identify a transformant, 1338bp is a positive transformant, a plasmid is extracted from the correctly identified transformant, the plasmid is subjected to double enzyme digestion identification by Xba I and Hind III to obtain 1142bp which is positive, and the plasmid is named as a recombinant plasmid pXMJ WYE1403(pXMJ19-proB H)^G446A) (shown in FIG. 11).

pWYE1403 was further sequenced and the plasmid was a plasmid encoding proB^G446AThe fragment (SEQ ID NO: 3) was inserted into the vector between the Xba I and HindIII cleavage sites of plasmid pXMJ 19.

Transforming the plasmid pWYE1403 into the chassis engineering bacteria CG415 constructed above, identifying transformants by colony PCR with P13 and P14 as primers to obtain 1338bp positive transformants, extracting plasmids from correctly identified transformants and identifying to further confirm that the over-expression plasmids are successfully transformed into engineering bacteria, namely L-proline engineering bacteria CG409 (WT-proB)^G446A/pXMJ19-proB^G446A) The construction was successful.

The primer sequences used above were as follows (5 '→ 3'):

P11：CCCAAGCTTAAAGGAGGACCGGAATGCGTGAG(HindⅢ)(SEQ ID NO：16)

P12：GATTCTAGATTACGCGCGGCTGGCGTAGT(Xba I)(SEQ ID NO：17)

P13：CAATTAATCATCGGCTCGTA(SEQ ID NO：18)

P14：ACCGCTTCTGCGTTCTGATT(SEQ ID NO：19)

second, knockout of the putA gene

The function of PutA in corynebacterium glutamicum has not been verified, so we knocked out the PutA gene in the wild-type strain ATCC13032, constructed the strain ATCC13032 Δ PutA, and preliminarily identified the function of the PutA gene by a growth experiment using L-proline as a sole nitrogen source.

The ATCC 13032. delta. putA was constructed as follows: primers were designed based on the putA gene of Corynebacterium glutamicum ATCC13032 in Genbank and the upstream and downstream sequences thereof, respectively.

PCR amplification of the upstream homology arm of the putA gene was carried out using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P15 and P16 as primers; the downstream homology arms of the putA gene were amplified using P17 and P18 as primers. And then using the purified PCR product as a template, using P15 and P18 as primers, and adopting an overlap extension PCR (SOE) technology to amplify to obtain a 1019bp fragment (SEQ ID NO: 4) containing the upstream and downstream homology arms of the gene putA to be knocked out. Wherein, SEQ ID NO: 4 nucleotides 1 to 509 from the 5' end are upstream homology arms of the gene putA to be knocked out, and SEQ ID NO: 4 nucleotide 510-1019 from the 5' end is the downstream homologous arm of the desired knockout gene putA.

The purified and recovered PCR product is double digested by EcoR I and HindIII and then connected with homologous recombination vector pK18mobsacB which is treated by the same double digestion, the connection product is transformed to Escherichia coli DH5 α by a chemical transformation method, transformants are screened on L B plates containing kanamycin (50 mug/m L) after the transformants are subcultured for three generations, the transformants are identified by colony PCR with P5 and P6 as primers to obtain 1231bp as positive transformants, plasmids are extracted from the identified correct transformants, Sal I and HindIII double digestion identification are carried out on the plasmids to obtain 1019bp as positive transformants, further sequence determination verifies that the recombinant plasmid pK18 mobsacB-delta putA is successfully constructed, and the vector III is obtained by inserting a fragment (IDNO: 4) containing the upstream and downstream homologous arms of the gene putA to be knocked out into the Sal I and HindIII digestion sites of the vector pK18 mobsacB.

The primer sequences used above were as follows (5 '→ 3'):

P15：CCCAAGCTTGGTCAATGTCGGTGATGATCCT(HindⅢ)(SEQ ID NO：20)

P16：CCATGCGCAAAACGAGGTGGTTCTCCTTCAAGATCAG(SEQ ID NO：21)

P17：TGAAGGAGAACCACCTCGTTTTGCGCATG(SEQ ID NO：22)

P18：ACGCGTCGACACGGTCACGCCGTGCTCCA(Sal I)(SEQ ID NO：23)

P19：CTAGGCCAATGGCTTGAGCTGCGGT(SEQ ID NO：24)

P20：GCTCCCGCTCCGACTCGCCACCCTC(SEQ ID NO：25)

the homologous recombinant plasmid pK18 mobsacB-delta putA with correct sequence determination is electrically transformed into Corynebacterium glutamicum ATCC13032, colonies with the recombinant plasmid integrated onto the chromosome are obtained by kanamycin resistance forward screening, and colonies with the second homologous recombination are obtained by sucrose lethal reverse screening. Genomic DNA extraction and PCR amplification identification were performed on colonies using P19 and P20 as primers to obtain 1365bp positive, which was designated ATCC 13032. delta. putA (WT-. delta. putA).

Further sequence determination analysis of ATCC 13032. delta. putA (WT-. delta. putA) revealed successful knockout of the chromosomal putA gene and successful construction of ATCC 13032. delta. putA (WT- Δ putA).

Growth experiments were carried out with the wild type strain ATCC 13032. delta. putA and L-proline as the sole nitrogen source.

The seed culture medium comprises 10 g/L of glucose, 5 g/L of yeast powder and 10 g/L10 of peptone, 10 g/L.

Basic fermentation medium (nitrogen source is L-proline), glucose 40, L-proline 20 g/L₂PO₄0.5g/L，K₂HPO₄·3H₂O 0.5g/L，MgSO₄·7H₂O 0.25g/L，FeSO₄·7H₂O 0.01g/L，MnSO₄·H₂O 0.01g/L，ZnSO₄·7H₂O 0.001g/L，CuSO₄0.0002g/L，NiCl₂·6H₂O0.00002 g/L, biotin 0.0002 g/L, pH7.0-7.2, 2% CaCO₃And autoclaving at 121 deg.C for 20 min. Glucose was separately sterilized and autoclaved at 115 ℃ for 15 min. MgSO (MgSO)₄·7H₂O, and inorganic salt ions are separately sterilized, and then sterilized under high pressure at 121 ℃ for 20min, and the vitamins and L-proline are sterilized by filtration through a sterile filter membrane of 0.22 mu m.

The growth experiment comprises the following specific steps:

1) culturing Corynebacterium glutamicum with seed culture medium to logarithmic phase, centrifuging at 4 deg.C and 4000 × g for 5min, collecting thallus, discarding supernatant, washing thallus with basic fermentation culture medium for 2 times, re-suspending thallus, and correcting OD of suspension of each strain₆₀₀To be consistent.

2) The bacterial suspension of each strain is equivalently inoculated into a basic fermentation culture medium of 30m L with L-proline as a unique nitrogen source, the mixture is subjected to shaking culture at 30 ℃ and 220r/min for 36h, sampling is carried out at certain intervals, and OD (optical density) is measured₆₀₀。

Growth curves and specific growth rates of the respective strains are shown in FIGS. 12 and 13, and the specific growth rate of the strain in which putA is knocked out is reduced by 19.023%, so that it can be preliminarily confirmed that putA has the activity of proline dehydrogenase.

Knockout of the putA gene in Chassis CG415 yields the strain CG413 (WT-proB)^G446AΔ putA), which was constructed in the same manner as the strain ATCC13032 Δ putA.

The method described in the first embodiment of the present invention is adopted to transform plasmid pWYE1403 into engineering bacterium CG413 to obtain recombinant bacterium engineering bacterium CG417 (WT-proB)^G446AΔputA/pXMJ19-proB^G446A)。

Thirdly, enhancing the expression of acn gene

In order to further improve the accumulation of L-proline and enhance the expression of acn gene, the promoter P of acn is added on the basis of CG413_acnPromoter P substituted for transcription elongation factor_eftuThe strain CG421 was constructed by replacing the RBS of the acn gene with the conserved RBS sequence of the highly expressed gene of Corynebacterium glutamicum (AAAGGAGGA) and replacing the initial codon TTG of acn with ATG. The method comprises the following specific steps:

according to Genbank middle valleyP of Corynebacterium glutamicum ATCC13032_acnUpstream and downstream sequences, acn start region and P_eftuThe promoter sequences were designed as primers, respectively.

Amplifying an upstream homologous arm of a acn promoter by using a genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and P21 and P22 as primers; p amplification with P23 and P24 as primers_eftuPromoter and acn initiation region; the homology arms downstream of the acn initiation region were amplified with primers P25 and P26. Then, the purified PCR product is used as a template, P21 and P26 are used as primers, and the overlapping extension PCR technology (SOE) is adopted for amplification to obtain a 1263bp PCR product which is a PCR product containing the upstream homologous arm and P of acn promoter_eftuThe promoter, the acn initiation region, and a homologous arm fragment downstream of the acn initiation region (SEQ ID NO: 5).

Wherein, the 1 st to 400 th nucleotides from the 5' end of the sequence 9 are replaced promoters P_acnThe upstream homology arm of (1), nucleotide 401-615 from the 5' end of the sequence 9 is promoter P_eftuAnd acn start region, the 617-1263 th nucleotide of the 5' end of the sequence 9 is the homologous arm downstream of the acn start region.

The PCR product of 1263bp is subjected to double enzyme digestion by Hind III and EcoR I, and then is connected with a homologous recombination vector pK18mobsacB subjected to the same double enzyme digestion treatment, the connection product is transformed into escherichia coli DH5 α by adopting a chemical transformation method, transformants are screened on a L B plate containing kanamycin (50 mug/m L), after the transformants are subcultured for three generations, colony PCR identification is adopted by taking P5 and P6 as primers, 1475bp is obtained as a positive transformant, plasmids are extracted from the transformants which are correctly identified, and Hind III and EcoR I double enzyme digestion identification is carried out on the plasmids, so that 1263bp is obtained as a positive transformant.

And (3) sending the positive plasmid to be sequenced, and obtaining the result that the plasmid is the plasmid obtained by converting SEQ ID NO: 5 into the vector pK18mobsacB, named pK18mobsacB-P_eftu::P_acn-RBS-acn^T1A。

The primer sequences used above were as follows (5 '→ 3'):

P21：CCGGAATTCAAAATCTGATTCCTTTGCA(EcoRI)(SEQ ID NO：26)

P22：TTCGCAGGGTAACGGCCACTTCATTATCCTAACAGTACAA(SEQ ID NO：27)

P23：GTACTGTTAGGATAATGAAGTGGCCGTTACCCTGCGA(SEQ ID NO：28)

P24：AGTCACAGTGAGCTCCATTTCTATCCTCCTTTTGTATGTCCTCCTG(SEQ ID NO：29)

P25：ATACAAAAGGAGGATAGAAATGGAGCTCACTGTGACTGAA(SEQ ID NO：30)

P26：CCCAAGCTTTGGTGGTGTGGGAGTCG(HindⅢ)(SEQ ID NO：31)

P27：TAATCAGTGGTCCCAAGCAAATCAT(SEQ ID NO：32)

P28：CGTCGATTGGGAACATCGCACAGGT(SEQ ID NO：33)

the homologous recombinant plasmid pK18mobsacB-P with correct sequence determination_eftu::P_acn-RBS-acn^T1AElectrotransformation is carried out to L-proline recombinant bacteria CG413, bacterial colonies with recombinant plasmids integrated to chromosomes are obtained through kanamycin resistance forward screening, positive bacterial colonies with two homologous recombination are obtained through sucrose lethal reverse screening, PCR amplification identification is carried out on the positive bacterial colonies by taking P27 and P28 as primers, and 1052bp of recombinant bacteria WT-proB is obtained^G446A-RBS-acn^T1A-P_eftu::P_acn- Δ putA, named CG 421.

The recombinant bacterium extracts genome DNA for sequencing, and the result proves that the promoter of the acn gene is successfully replaced by the endogenous strong promoter P of corynebacterium glutamicum_eftuReplacing the RBS of acn gene with the conserved RBS sequence of highly expressed gene of Corynebacterium glutamicum (AAAGGAGGA), replacing the start codon TTG of acn gene with ATG with high expression intensity, Corynebacterium glutamicum CG421 (WT-proB)^G446A-P_eftu::P_acn-RBS-acn^T1AΔ putA) was successfully constructed.

Testing the acn transcript level in CG421, as shown in FIG. 14, the result showed that the acn transcript level was increased 3.5-fold.

The method described in the first embodiment of the present invention is adopted to transform plasmid pWYE1403 into engineering bacterium CG421 to obtain recombinant bacterium CG430 (WT-proB)^G446A-P_eftu::P_acn-RBS-acn^T1AΔputA/pXMJ19-proB^G446A)。

Application of engineering bacteria of tetra, L-proline in production of L-proline

1. Shake flask fermentation of plasmid-free L-proline engineering bacteria

The culture medium related to the fermentation of the engineering bacteria in the above embodiment and the steps are as follows:

the fermentation medium adopted by the shake flask fermentation is glucose 40 g/L, (NH)₄)₂SO₄20g/L，KH₂PO₄0.5g/L，K₂HPO₄·3H₂O 0.5g/L，MgSO₄·7H₂O 0.25g/L，FeSO₄·7H₂O 0.01g/L，MnSO₄·H₂O 0.01g/L，ZnSO₄·7H₂O 0.001g/L，CuSO₄0.0002g/L，NiCl₂·6H₂O0.00002 g/L, biotin 0.0002 g/L, pH7.0-7.2, 2% CaCO₃And autoclaving at 121 deg.C for 20 min. Glucose was separately sterilized and autoclaved at 115 ℃ for 15 min. MgSO (MgSO)₄·7H₂O, and inorganic salt ions, and autoclaving at 121 deg.C for 20 min. The vitamins are sterilized by filtration through a sterile 0.22 μm filter membrane.

The specific steps of shaking flask fermentation are as follows:

1) obtaining seed liquid

Inoculating the engineering bacteria CG415, CG413 and CG421 into seed culture medium respectively, culturing with seed liquid at 30 deg.C and shaking table rotation speed of 220r/min for 12 hr to obtain seed liquid, OD₆₀₀May be 20.

2) Fermenting the mixture

Inoculating the seed solution into a fermentation medium (the liquid loading amount of a 500m L baffle triangular flask is 30m L) according to the volume percentage content of 3 percent, culturing at the temperature of 30 ℃ for 220r/min for 60h, intermittently adding concentrated ammonia water to control the pH of the fermentation liquid to be 7.0-7.2, adding glucose mother liquor with the concentration of 400 g/L according to the condition of residual sugar, and controlling the residual sugar of the fermentation liquid to be 5-10 g/L.

Collecting 12000 × g of fermentation product, centrifuging for 5min, and collecting supernatant.

3) Detecting L-proline content

By adopting a high-efficiency liquid phase method,the specific method comprises (2, 4-dinitrofluorobenzene pre-column derivatization high performance liquid phase method) collecting 50 μ L supernatant, placing in 2m L centrifuge tube, adding 200 μ L NaHCO₃Aqueous solution (0.5 mol/L, pH 9.0) and 100. mu. L1% 2, 4-dinitrofluorobenzene-acetonitrile solution (by volume) were heated in a water bath at 60 ℃ in the dark for 60min, then cooled to 25 ℃ and 650. mu. L KH was added₂PO₄The aqueous solution (0.01 mol/L, pH 7.2 + -0.05, pH adjusted with NaOH aqueous solution, standing for 15min, and sampling with 5 μ L.

The chromatographic column used was a C18 column (ZORBAX Eclipse XDB-C18, 4.6 mm 150mm, Agilent, USA), the column temperature was 40 deg.C, the UV detection wavelength was 360nm, and the mobile phase A was 0.04 mol/L KH₂PO₄Aqueous solution (pH 7.2. + -. 0.05, pH adjusted with 40 g/L KOH aqueous solution), mobile phase B was 55% acetonitrile aqueous solution (volume ratio), mobile phase flow rate was 1m L/min, elution process is shown in Table 5 below, and liquid phase diagram is shown in FIG. 15:

TABLE 5 elution procedure

Wild type strain c.glutamicum ATCC13032 was used as a control.

The results are shown in Table 6.

Table 6 shows the maximum OD of L-proline engineering bacteria CG415, CG413 and CG421 in the shake flask fermentation experiment₆₀₀Specific growth rate and L-proline yield

TABLE 6 growth and L-proline yield of shake flask fermentation of engineering bacteria

In a shake flask fermentation experiment, fermentation is carried out for 60 hours, the accumulation of L-proline is not detected by a wild type strain C.glutamicum ATCC13032, the fermentation process is shown in figure 16, the yield of L-proline of Chassis bacteria CG415 reaches 1.376 g/L within 24 hours, then the yield is reduced, the fermentation process is shown in figure 17, the yield of L-proline of an engineering bacteria CG413 only subjected to L-proline catabolic pathway modification is 1.752 g/L, the fermentation process is shown in figure 18, on the basis, the yield of L-proline of an engineering bacteria CG421 with increased acn gene expression is 2.471 g/L, and the fermentation process is shown in figure 19, and is 41.038% higher than that of the strain CG413 before modification.

2. Shaking flask fermentation of high-yield L-proline engineering bacteria containing plasmids

1) Obtaining seed liquid

The plasmid-containing engineering bacteria CG409, CG417 and CG430 were inoculated according to the method of 1) in step 1) of this example, but the culture medium was supplemented with chloramphenicol to a final concentration of 10. mu.g/ml, and the culture conditions were the same.

2) Fermenting the mixture

The seed solution was fermented according to the method of step 1) of this example, except that chloramphenicol was added to the fermentation medium at a final concentration of 10. mu.g/ml, and isopropyl- β -D-thiogalactopyranoside (IPTG) was added to the medium at a final concentration of 1 mmol/L for induced expression of the desired gene at 6 hours of fermentation.

3) Detecting L-proline content

The L-proline content in the supernatant was determined according to the method of 3) in step 1 of this example.

Wild type strain c.glutamicum ATCC13032 was used as a control.

The results are shown in Table 7.

Table 7 shows the maximum OD of L-proline engineering bacteria CG409, CG417 and CG430 in the shake flask fermentation experiment₆₀₀Specific growth rate and L-proline yield

TABLE 7 growth and L-proline yield of shake flask fermentation of engineering bacteria

In a shake flask fermentation experiment, the L-proline yield of CG409 reaches 11.256 g/L within 24h, the L-proline yield of plasmid-containing engineering bacteria CG417 which is only subjected to L-proline catabolism pathway modification is 15.488 g/L, on the basis, the L-proline yield of acn gene expression-containing plasmid-containing engineering bacteria CG430 is 18.710 g/L, and compared with a strain CG413 before modification, the yield is 20.803% higher, and the fermentation process is shown in FIG. 20.

3, L-proline engineering bacterium CG430 fermentation tank for producing L-proline by fermentation

The seed culture medium comprises glucose 20 g/L, ammonium sulfate 5 g/L, yeast powder 5 g/L, and peptone 10 g/L10 g/L.

The fermentation medium used for fermentation comprises glucose 20 g/L, ammonium sulfate 20 g/L₂PO₄0.5g/L，K₂HPO₄·3H₂O0.5g/L，MgSO₄·7H₂O 0.25g/L，FeSO₄·7H₂O 0.01g/L，MnSO₄·H₂O 0.01g/L，ZnSO₄·7H₂O 0.001g/L，CuSO₄0.0002g/L，NiCl₂·6H₂O0.00002 g/L, biotin 0.0002 g/L, pH 7.0-7.2.

1) Obtaining seed liquid

Inoculating engineering bacteria CG430 into seed culture medium, culturing at 30 deg.C with shaking table rotation speed of 220r/min for 12 hr to obtain seed solution OD₆₀₀May be 20.

2) Fermenting the mixture

The seed solution was inoculated to a fermentation medium containing 10. mu.g/ml chloramphenicol at a final concentration of 10% by volume.

The adopted fermentation tank is a 7.5L fermentation tank (BioFlo115, NBS), a constant-speed programmable control pump is arranged in the fermentation tank, constant-speed material feeding can be realized, 800 g/L of glucose is supplemented through a peristaltic pump in the fermentation process, the concentration of the glucose in a fermentation system is controlled to be 0-5 g/L, the fermentation temperature is controlled to be maintained at 32 ℃ through a heating jacket and cooling water, dissolved oxygen is provided through air, the rotation speed and the dissolved oxygen signal are in cascade connection to control the dissolved oxygen to be maintained at 30%, concentrated ammonia water is supplemented to regulate the pH to be maintained at about 6.9, the fermentation is continuously carried out for 60 hours when the OD is reached₆₀₀When the concentration was 4-5, IPTG (final concentration: 0.4 mmol/L) was added to induce expression of the gene carried by the recombinant plasmid.

3) Detecting L-proline content

The content of L-proline in the supernatant was determined by the method of step 3) in this example, and as shown in FIG. 21, it can be seen that the highest yield of L-proline in the engineered bacteria was 66.427 g/L and the production intensity was 1.107 g/L/h after 60h of fermentation.

Finally, it should be noted that: it should be understood that the above examples are only for clearly illustrating the present invention and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the scope of the invention.

Claims

1. The application of the method for improving the yield of amino acid of corynebacterium glutamicum in improving the yield of L-proline is characterized in that,

the method comprises the following steps:

3) determining a target gene according to the metabolic flux needing to be regulated and the regulation mode of the metabolic flux in combination with the annotated gene data, and carrying out genetic modification on the target gene to construct engineering bacteria;

the target genes in the step 3) are putA and acn, the genetic modification is to knock out the putA gene in a corynebacterium glutamicum genome and enhance the expression of a acn gene in the corynebacterium glutamicum genome, the corynebacterium glutamicum is a corynebacterium glutamicum containing a proB gene with site-directed mutation, and the site-directed mutation is to mutate the 149 th glycine to aspartic acid.

2. The use of claim 1, wherein the reaction data required in step 1) comprises transport reactions, biomass reactions, exchange reactions, sugar metabolism reactions, amino acid metabolism reactions, vitamin and cofactor metabolism reactions, complex lipid metabolism reactions, nucleotide metabolism reactions, lipid metabolism reactions, energy metabolism reactions, other carbon metabolism reactions.

3. The use according to claim 1, wherein the step of knocking out the putA gene comprises:

4. The use as claimed in claim 3, wherein in step 1), the upstream homology arm of the promoter of the putA gene is PCR amplified by using P15 and P16 as primers, and the downstream homology arm of the putA gene is PCR amplified by using P17 and P18 as primers, wherein the primer sequences are as follows:

P15：5’-CCCAAGCTTGGTCAATGTCGGTGATGATCCT-3’

P16：5’-CCATGCGCAAAACGAGGTGGTTCTCCTTCAAGATCAG-3’

P17：5’-TGAAGGAGAACCACCTCGTTTTGCGCATG-3’

P18：5’-ACGCGTCGACACGGTCACGCCGTGCTCCA-3’。

5. the use of claim 1, wherein said enhancing expression of acn gene comprises replacing promoter P of acn gene_acnReplacing RBS of the acn gene with a conserved RBS sequence of a corynebacterium glutamicum high-expression gene and replacing an initiation codon TTG of the acn gene with ATG, and specifically comprises the following steps:

1) acn gene promoter upstream homology arm, P, are amplified by primer using corynebacterium glutamicum genome DNA as template_eftuPromoter, acn gene initiation region, acn gene initiation region downstream homology arm, fusion of acn gene promoter upstream homology arm, P_eftuPromoter, acn gene initiation region and homology arms downstream of acn gene initiation region;

2) the acn gene promoter upstream fused in the step 1)Homology arm, P_eftuThe promoter, the acn gene initiation region and the acn gene initiation region downstream homologous arm fragment are subjected to double enzyme digestion by Hind III and EcoR I, and then are connected with a homologous recombination vector pK18mobsacB subjected to the same double enzyme digestion treatment;

6. The use of claim 5, wherein: amplifying an upstream homologous arm of a acn promoter by taking P21 and P22 as primers in the step 1); p amplification with P23 and P24 as primers_eftuPromoter and acn gene initiation region; the downstream homology arms of the acn gene initiation region are amplified by taking P25 and P26 as primers, and the sequences of the primers are respectively as follows:

P21：5’-CCGGAATTCAAAATCTGATTCCTTTGCA-3’

P22：5’-TTCGCAGGGTAACGGCCACTTCATTATCCTAACAGTACAA-3’

P23：5’-GTACTGTTAGGATAATGAAGTGGCCGTTACCCTGCGA-3’

P24：5’-AGTCACAGTGAGCTCCATTTCTATCCTCCTTTTGTATGTCCTCCTG-3’

P25：5’-ATACAAAAGGAGGATAGAAATGGAGCTCACTGTGACTGAA-3’

P26：5’-CCCAAGCTTTGGTGGTGTGGGAGTCG-3’。

7. the use according to claim 1, wherein the C.glutamicum is a C.glutamicum which overexpresses the pro B gene which is mutated in a defined manner.

8. Corynebacterium glutamicum with an increased production of L-proline, constructed for use according to any one of claims 1 to 7.