CN106613972A - Production method of club-root-resisting brassica oleracea-Chinese cabbage distant hybrid - Google Patents

Abstract

The invention discloses a method for creating a clubroot-resistant cabbage-Chinese cabbage distant hybrid. The method uses Chinese cabbage resistant to clubroot as the female parent and cabbage as the male parent to carry out artificial cross breeding, adopts repeated pollination and in vitro culture to rescue young embryos, artificially doubles colchicine on the regenerated plants obtained, and then Combined with morphology, relative content of cellular DNA and clubroot resistance identification, a new clubroot-resistant interspecific hybrid germplasm was obtained. The method of the invention has important theoretical research and practical application value for promoting the improvement of cabbage varieties.

Description

A method for creating a clubroot-resistant cabbage-Chinese cabbage distant hybrid

technical field

The invention belongs to the field of biotechnology breeding, and relates to a method for creating a clubroot-resistant cabbage-Chinese cabbage distant hybrid.

Background technique

Clubroot is a very contagious soil disease caused by Plasmodiophora brassicae Woron. infestation of Brassicaceae crops, head cabbage (Brassica oleracea L.Var. Capitata, 2n=2x=CC=18, referred to as cabbage) is one of the hosts seriously damaged by it; currently there is a shortage of clubroot resistant cabbage varieties in production. The resistance of cabbage to clubroot belongs to quantitative trait inheritance, which is controlled by multiple genes and is easily affected by the environment; moreover, it is mainly a recessive gene, which makes it difficult and slow to improve the resistance of cabbage clubroot by conventional breeding methods. The domestic and foreign studies on clubroot resistance of Chinese cabbage showed that the infection of Chinese cabbage to clubroot was mostly controlled by a dominant single gene. Among them, the CRb gene located in linkage group A3 showed resistance to Plasmodium race 2, 4 and 8, and was an excellent resistance gene.

Contents of the invention

The purpose of the present invention is to provide a set of methods for obtaining distant hybrids of cabbage-Chinese cabbage by using embryo rescue to create a batch of clubroot-resistant cabbage- Distant hybrids of Chinese cabbage; at the same time, in order to expand the gene pool of cabbage, excellent target traits (genes) in related species are introduced to form a set of methods for improving cabbage varieties.

In order to realize the object of the present invention, a kind of clubroot-resistant cabbage-Chinese cabbage remote hybrid creation method of the present invention comprises the following steps:

(1) Pollination method: use Chinese cabbage resistant to clubroot as the female parent, cabbage as the male parent, configure a hybrid combination, and adopt the method of manual peeling and emasculation for repeated pollination. Take fresh pollen from the male parent and smear it on the female parent. on the flower bud stigma;

(2) Ovule culture: Disinfect and sterilize the ovaries 10 days after pollination, strip the ovules from the ovary and inoculate them on the embryo rescue medium, at an environment of 25±0.5°C, with a light intensity of 50-100 μmol m ^–2 s ^-1 , cultured under the condition of 12-14h·d ^-1 light for 25-30d, the embryo rescue medium is: MS+0.1mg/L NAA+0.2mg/L 6-BA+0.6g/L hydrolyzed casein Protein+7g/L agar+25g/L sucrose, pH 5.90～5.95;

(3) Differentiation culture: when the immature embryo grows to the cotyledon-shaped embryo, insert the differentiation medium to induce the differentiation of adventitious buds. The differentiation medium is: MS+0.1mg/L NAA+1mg/L 6-BA+6g /L agar+28g/L sucrose, pH 5.90～5.95;

(4) Subculture: transfer to subculture after 20-30 days, the subculture medium is: MS+0.1mg/LNAA+0.2mg/L6-BA+7g/L agar+25g/L sucrose, pH 5.90 ~5.95;

(5) rooting culture: after subculture for 2 weeks, insert rooting medium to induce rooting, and described rooting medium is: 1/2MS+0.1mg/L NAA+0.1mg/L IBA+20g/L sugar+7g/ L agar, pH 5.90-5.95;

(6) Artificial doubling: the pruned plant roots are soaked in the prepared colchicine solution to doubling, and the treatment condition is that the colchicine solution containing 2% dimethyl sulfoxide and 0.4% is treated for 18 -20h, after the treatment is completed, the colchicine residue in the root is rinsed, and finally planted in a plug containing peat soil, perlite and vermiculite;

(7) Morphological identification: observe the main morphological characteristics of the seedling vegetative growth stage and reproductive growth stage;

(8) Determination of relative cellular DNA content: use flow cytometry to measure the relative cellular DNA content of the offspring doubling plants;

(9) Identification of clubroot resistance: identification of clubroot resistance through the combination of bacterial soil inoculation identification and molecular marker verification of the clubroot resistance gene CRb. After the matrix is sterilized, 0.001 g diseased roots, and then directly sow the identification materials in fungal soil, cultivate them at 25-28°C, pull out the seedlings after 2 months, wash off the impurities in the roots, and observe the disease situation; The genetically closely linked SSR primer TCR13 was used to carry out molecular marker identification on the progeny plants. When the specific bands of clubroot resistant Chinese cabbage appeared in the amplified bands of the progeny materials, it could be determined that they were true hybrids carrying the CRb gene .

Wherein, the configuration of the hybrid combination described in step (1) is: Chinese cabbage resistant to clubroot is the female parent, and cabbage is the male parent. The female parent is an imported Chinese cabbage material that is immune to clubroot and carries CRb gene.

The ovary disinfection and sterilization method in step (2) is: sterilize with 75% (volume fraction) ethanol for 1min, then sterilize with 7% (volume fraction) sodium hypochlorite for 15min, then rinse 3 times with sterile water, 5 minutes each time.

When the colchicine solution is doubled in step (6), the roots must be submerged.

The volume ratio of peat soil, perlite and vermiculite in step (6) is 8:1:1.

The upstream primer sequence of the SSR primer TCR13 closely linked to the Chinese cabbage clubroot resistance CRb gene described in step (9) is TGTTGATTGTGGATTTTTGTGA (SEQ ID NO.1), and the downstream primer sequence is CCAAACTAGCCAATAACCATTGTA (SEQ ID NO.2).

In step (9), when the 313bp specific band of clubroot resistant Chinese cabbage appears in the amplification band of the progeny material, it can be determined that it is a true hybrid carrying the CRb gene.

Beneficial effect

The present invention uses clubroot resistant Chinese cabbage and cabbage as materials, adopts immature embryo rescue technology to improve cabbage resistance, promotes genetic hybridization between Chinese cabbage and cabbage, combines excellent genes of the two species, and obtains a batch of excellent The new interspecific germplasm lays the foundation for further introgression transfer and utilization of clubroot resistance genes and improvement of cabbage varieties. A new germplasm creation method for distant hybridization of Chinese cabbage and cabbage provided by the invention has the following advantages and positive effects compared with the prior art:

(1) The present invention utilizes the Chinese cabbage resistance source carrying the CRb gene, which is identified as a very ideal resistance source material for its resistance to clubroot at an immune level.

(2) The present invention adds 0.1 mg/L NAA+0.2 mg/L 6-BA+0.6 g/L hydrolyzed casein to the MS medium for embryo rescue, which improves the embryo rescue rate and induction rate.

(3) The treatment used in the artificial doubling of the present invention is 18 hours in a 0.4% colchicine solution containing 2% dimethyl sulfoxide (DMSO), which improves the doubling rate of interspecific hybrids.

Description of drawings

Figure 1 Morphological identification of distant hybrid F ₁ .

(a) Phenotype of cabbage (left), hybrid F ₁ (middle), and Chinese cabbage (right) in vegetative growth period; (b) Phenotype of cabbage (left), hybrid F ₁ (middle), Chinese cabbage (right) in reproductive growth period (c) Seed phenotypes of cabbage (left), hybrid F ₁ (middle), and Chinese cabbage (right);

Figure 2 Amplification result of primer TCR13 for identification of distant hybrid F ₁

1-4 are female Chinese cabbage, 5-10 and 13-17 are true hybrids carrying CRb gene, 11-12 are pseudo hybrids, and 18-19 are male cabbage. Arrows indicate the resistance bands linked to CRb gene

specific implementation plan

A method for creating a clubroot-resistant cabbage-Chinese cabbage distant hybrid provided by the present invention is further described in detail by the following examples, but the content of the present invention is not limited thereto:

1. Obtaining offspring materials of Brassica cabbage-Chinese cabbage interspecific hybrids

1.1 Material selection

Cabbage is diploid high-generation homozygous material of different genotypes, and Chinese cabbage is diploid material resistant to clubroot.

1.2 Rescue of immature embryos and hybridization

(1) Pollination method: Hybridization is carried out in a plastic greenhouse. Cabbage and Chinese cabbage are crossed as parents. The buds are peeled and emasculated 1 to 2 days before the female parent blooms, and the pollen of the male parent is given and bagged for isolation. The next day began to adopt the repeated pollination method to carry out artificial pollination (pollination once a day, repeated three times). The results showed that the rescue rate of immature embryos with Chinese cabbage as female parent was higher than that with cabbage as female parent.

(2) Rescue immature embryos: take the ovaries 7d, 10d, and 12d after pollination, sterilize with 75% (volume fraction) ethanol for 1min, then sterilize with 7% (volume fraction) sodium hypochlorite for 15min, and then use aseptic Rinse with water 3 times, 5min each time. The ovules from the ovary were stripped and inoculated on embryo rescue medium for 28 days under the conditions of ambient temperature 25±0.5°C, light intensity 75 μmol·m ^–2 s ^–1 , light duration 14h. The embryo rescue medium treatment is: 0 (CK, MS+7g/L agar+25g/L sucrose, pH 5.95), adding 0.1mg/L NAA+0.2mg/L 6-BA, adding 0.6g/L L hydrolyzed casein, add 0.1mg/L NAA+0.2mg/L 6-BA+0.6g/L hydrolyzed casein. The results showed that 10 days after pollination, the highest induction rate was obtained when the MS medium was supplemented with 0.1mg/L NAA+0.2mg/L 6-BA+0.6g/L hydrolyzed casein and the pH was 5.95.

(3) Differentiation culture: when the immature embryo grows to the cotyledon-shaped embryo, insert the differentiation medium to induce the differentiation of adventitious buds. The differentiation medium is: MS+0.1mg/L NAA+1mg/L 6-BA+6g /L agar+28g/L sucrose, the pH is 5.95.

(4) Subculture: transfer to subculture after 25 days, the subculture medium is MS+0.1mg/LNAA+0.2mg/L 6-BA+7g/L agar+25g/L sucrose, and the pH is 5.95.

(5) rooting culture: after subculture for 2 weeks, insert rooting medium to induce rooting, and described rooting medium is: 1/2MS+0.1mg/L NAA+0.1mg/L IBA+20g/L sugar+7g/ L agar, pH 5.95.

(6) Artificial chromosome doubling using colchicine

First remove the plants to be treated from the rooting medium, rinse the roots under the tap water pipe, cut the roots to a length of 1-2 cm with scissors, and then soak the trimmed roots in the prepared 2% dimethyl The concentration of sulfoxide (DMSO) is 0.4% colchicine solution (the colchicine solution must be submerged in the root). 4-5 plants per treatment. The processing time is 12h, 18h, 24h, 30h. The treated plants were placed under the conditions of 25°C, ventilation and light. The results showed that when the treatment time was 18h, the plant doubling rate was the highest. After the treatment, the plants are taken away from the colchicine solution, and the colchicine residue in the roots is washed away under the tap water pipe. Finally, it was planted in a plug containing peat soil, perlite and vermiculite (8:1:1). When the plants grow to 4-5 leaves, they are transplanted to the field.

2. Identification of interspecific amphidiploid hybrids

( ₁ ) Morphological identification From the emergence of F1 to flowering and seeding, the main morphological characteristics of F1 were observed and photographed. The results showed that: the growth potential of F1 in the vegetative growth stage was greater _than that of the parents, and the comprehensive traits were between the parents. ; The initial stage of bolting is similar to that of Chinese cabbage, the whole growth form of the seed plant is between the parents, and the growth potential is greater than that of the parents. The seeds harvested after self-pollination were dark brown, larger than the seeds of their parents, and the overall traits had a superparent advantage.

(2) Analysis of relative DNA content: The relative DNA content of leaf cells of F ₁ , which was identified as a distant hybrid by both parents and morphologically identified, was determined and compared by flow cytometry. The results showed that the highest peaks of cellular DNA of the diploid plants of Chinese cabbage and cabbage all appeared at the relative position of abscissa 200, while the highest peaks of cellular DNA of the obtained offspring plants all appeared at the relative position of 400, which indicated that The relative content of cell DNA in the offspring doubled plant is doubled compared with its diploid parent, that is, the chromosomes of the offspring plant have been doubled.

(3) Identification of clubroot resistance: the identification of clubroot resistance was carried out by combining the inoculation identification with fungal soil method and the molecular marker verification of the clubroot resistance gene CRb. After the substrate is sterilized, inoculate 0.001g of diseased root per gram of sterilized soil, then directly sow the identification materials in the fungal soil, cultivate at 25-28°C, pull out the seedlings after 2 months, wash off the impurities in the roots, and observe Incidence. At the same time, the SSR primer TCR13, which is closely linked to the clubroot resistance CRb gene of Chinese cabbage, was used to identify the molecular markers of the doubled amphidiploid plants of the offspring. The DNA of the parents and offspring was extracted, and then amplified by PCR and separated by 6% denatured polyacrylamide gel electrophoresis to obtain the amplified bands. When the 313bp specific band of clubroot resistant Chinese cabbage appeared in the amplified band of the progeny material, it could be determined that it was a true hybrid carrying the CRb gene.

In summary, when Chinese cabbage and cabbage are hybridized, it is best to use Chinese cabbage as the female parent; after sterilizing the ovary 10 days after pollination, place the ovules in the following conditions: MS+0.1mg/L NAA+0.2 mg/L 6-BA+0.6g/L hydrolyzed casein+7g/L agar+25g/L sucrose, cultured in a pH of 5.95; when the immature embryos grow to cotyledon-shaped embryos, insert MS+0.1mg/L NAA+1mg/L6-BA+6g/L agar+28g/L sucrose, the pH is 5.95. Induce adventitious bud differentiation in differentiation medium; after 20-30 days, transfer to MS+0.1mg/LNAA+0.2mg/L 6-BA+7g/L agar+25g/L sucrose, pH 5.95 subculture medium for relaying subculture; after 2 weeks of subculture, insert 1/2MS+0.1mg/L NAA+0.1mg/L IBA+20g/L sugar+7g/L agar, the pH is 5.95. Rooting medium was used to induce rooting; before emergence, the plants were artificially doubled under the condition of 0.4% colchicine for 18 hours, and then the hybrids were further identified by morphological characteristics, flow cytometry and clubroot resistance.

<110> Jiangsu Academy of Agricultural Sciences

<120> Method for creating a clubroot-resistant cabbage-Chinese cabbage distant hybrid

<160> 2

<210> 1

<211> 22

<212>DNA

<213> Artificial sequence

<220>

<223> TCR13 upstream primer sequence

<400> 1

tgttgattgt ggatttttgt ga 22

<210> 2

<211> 24

<212>DNA

<213> Artificial sequence

<220>

<223> TCR13 downstream primer sequence

<400> 2

ccaaactagc caataaccat tgta 24

Claims (7)

1. a method for creating a clubroot-resistant cabbage-Chinese cabbage distant hybrid, characterized in that it comprises the following steps: (1) Pollination method: use Chinese cabbage resistant to clubroot as the female parent, cabbage as the male parent, configure a hybrid combination, and adopt the method of manual peeling and emasculation for repeated pollination. Take fresh pollen from the male parent and smear it on the female parent. on the flower bud stigma; (2) Ovule culture: Disinfect and sterilize the ovaries 10 days after pollination, strip the ovules from the ovary and inoculate them on the embryo rescue medium, at an environment of 25±0.5°C, with a light intensity of 50-100 μmol m ^–2 s ^-1 , cultured under the condition of 12-14h·d ^-1 light for 25-30d, the embryo rescue medium is: MS+0.1mg/L NAA+0.2mg/L 6-BA+0.6g/L hydrolyzed casein Protein+7g/L agar+25g/L sucrose, pH 5.90～5.95; (3) Differentiation culture: when the immature embryo grows to the cotyledon-shaped embryo, insert the differentiation medium to induce the differentiation of adventitious buds. The differentiation medium is: MS+0.1mg/L NAA+1mg/L 6-BA+6g /L agar+28g/L sucrose, pH 5.90～5.95; (4) Subculture: transfer to subculture after 20-30 days, the subculture medium is: MS+0.1mg/LNAA+0.2mg/L6-BA+7g/L agar+25g/L sucrose, pH 5.90 ~5.95; (5) rooting culture: after subculture for 2 weeks, insert rooting medium to induce rooting, and described rooting medium is: 1/2MS+0.1mg/L NAA+0.1mg/L IBA+20g/L sugar+7g/ L agar, pH 5.90-5.95; (6) Artificial doubling: the pruned plant roots are soaked in the prepared colchicine solution to doubling, and the treatment condition is that the colchicine solution containing 2% dimethyl sulfoxide and 0.4% is treated for 18 -20h, after the treatment is completed, the colchicine residue in the root is rinsed, and finally planted in a plug containing peat soil, perlite and vermiculite; (7) Morphological identification: observe the main morphological characteristics of the seedling vegetative growth stage and reproductive growth stage; (8) Determination of relative cellular DNA content: use flow cytometry to measure the relative cellular DNA content of the offspring doubling plants; (9) Identification of clubroot resistance: identification of clubroot resistance through the combination of bacterial soil inoculation identification and molecular marker verification of the clubroot resistance gene CRb. After the matrix is sterilized, 0.001 g diseased roots, and then directly sow the identification materials in fungal soil, cultivate them at 25-28°C, pull out the seedlings after 2 months, wash off the impurities in the roots, and observe the disease situation; The genetically closely linked SSR primer TCR13 was used to carry out molecular marker identification on the progeny plants. When the specific bands of clubroot resistant Chinese cabbage appeared in the amplified bands of the progeny materials, it could be determined that they were true hybrids carrying the CRb gene . 2. The method according to claim 1, characterized in that the configuration of the hybrid combination described in step (1) is: clubroot resistant Chinese cabbage is the female parent, and cabbage is the male parent. The female parent is an imported Chinese cabbage material that is immune to clubroot and carries CRb gene. 3. method according to claim 1, it is characterized in that step (2) middle ovary sterilization method is: with 75% ethanol sterilization 1min, then with the sodium hypochlorite sterilization 15min of 7% (volume fraction), then Rinse 3 times with sterile water, 5 minutes each time. 4. The method according to claim 1, characterized in that the colchicine solution in step (6) must not cross the root when it is doubled. 5. The method according to claim 1, characterized in that the volume ratio of peat soil, perlite and vermiculite in step (6) is 8:1:1. 6. The method according to claim 1, characterized in that the SSR primer TCR13 upstream primer sequence closely linked with the Chinese cabbage clubroot CRb gene described in the step (9) is as shown in SEQ ID NO.1, the downstream The primer sequence is shown in SEQ ID NO.2. 7. The method according to claim 1, characterized in that in step (9), when the 313bp specific band of anti-clubroot Chinese cabbage appears in the amplified band of the progeny material, it can be determined that it is carrying A true hybrid of the CRb gene.