CN106480191A - A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification - Google Patents

A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification Download PDF

Info

Publication number
CN106480191A
CN106480191A CN201610910960.0A CN201610910960A CN106480191A CN 106480191 A CN106480191 A CN 106480191A CN 201610910960 A CN201610910960 A CN 201610910960A CN 106480191 A CN106480191 A CN 106480191A
Authority
CN
China
Prior art keywords
freshwater mussel
razor clam
river
mitochondrial genome
lt
Prior art date
Application number
CN201610910960.0A
Other languages
Chinese (zh)
Inventor
欧阳珊
黄晓晨
吴小平
周春花
Original Assignee
南昌大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 南昌大学 filed Critical 南昌大学
Priority to CN201610910960.0A priority Critical patent/CN106480191A/en
Publication of CN106480191A publication Critical patent/CN106480191A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing

Abstract

A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification, including extracting genome DNA, regular-PCR amplification and sequencing, design long segment primer, LA PCR amplification and sequencing, sequence assembly and gene annotation.Present invention obtains river razor clam freshwater mussel F type mitochondrial genome complete sequence, for the Identification of Species of river razor clam freshwater mussel, the phylogenetics of Unionidae, compare and evolution genomics, pedigree genomics, plasm resource protection, sustainable and reasonably important using establishing offer basic material.

Description

A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification

Technical field

The present invention relates to biological technical field, it is related to the amplification method of genome sequence.

Background technology

River razor clam freshwater mussel(Solenaia rivularis)It is under the jurisdiction of Mollusca, lamellibranchiata, freshwater mussel mesh, Unionidae, razor clam freshwater mussel genus.River Razor clam freshwater mussel is only limitted to Asia distribution, is the New Record Species in Jiangxi.The powerful muscle of foot of river razor clam freshwater mussel makes body be stabilized and supports Resist the washing away of strong current, in addition, forcefully muscle of foot often keeps down excavation, optimal to maintain housing to be in all the time Life position.Bivalves has very big economic worth, such as extracts antineoplastic component;Former as artwares such as manufacture button shell carvings Material, the spiral shells that nacreous layer can be used to manufacture various finenesses are thin, vessel and furniture etc.;Bivalves software part is available for people and eats or make For feedstuff;Mussel plays the role of to Cu, Zn and Cd in water environment to remove and accumulation, absorbs enriching heavy metal, improves water quality.Freshwater mussel Section animal is a maximum section of freshwater shellfish, and including 674 species, fresh water bivalves is that in Freshwater ecosystems, a class is important Aquatile, as feeder, water quality can be improved by filter food nutrient substance, Organic substance and plankton, to water ring Border also has the effect of biological monitoring.Fresh water bivalves is indispensable in Freshwater ecosystems, and its Biomass and density often all exist Preponderate in zoobenthos, Freshwater ecosystems are played an important role, if the fresh water bivalves in freshwater lake or river Disappear, it will cause a series of ecological problem.Sum it up, fresh water bivalves is most important to Freshwater ecosystems, to water body Water quality, material circulation and energy Flow effect huge, and there is higher nutrition, economy and the ecological value.Because of edible need Ask and fish in a large number, and in recent years due to destruction and the change of habitat(As adopted sand, building dam, environmental pollution etc.), river razor clam freshwater mussel divides Cloth narrow scope, population fragmentation, have been in the danger state that is seriously subject to.

Mitochondrial genome DNA is exposed double-strand superhelix virus covalently closed circular molecule, and minority is linear molecule (as former Lively thing paramecium and the mtDNA of tetrahymena), it is the second hereditary information system of eukaryotic cell, or claim dna extranuclear gene and its table Reach system.With respect to core DNA, mtDNA has that molecular weight is little, polymorphism is high, structure is simple, base mutation rate height, maternal inheritance, The features such as tempo of evolution is fast, has been widely used in physiological and pathological, clinical diagnosises, hereditary variation, molecular marker, phyletic evolution etc. Many research, the research related to mitochondrion and mitochondrial genome has become Evolutionary Biology, genomics, biological letter Breath is learned and the study hotspot of life science and the forward positions such as conservation biology.

The heredity of Unionidae animal mitochondria is not merely maternal inheritance, also there is a kind of special of mitochondrial genome heredity The double monolepsis phenomenon of example(Doubly-Uniparental Inheritance, DUI).This mode of inheritance makes offspring Middle female mtDNA only is from maternal(female-transmitted, F type), similar to strict maternal inheritance;And it is male MtDNA be derived from parents, there is F type mtDNA in male somatic cell, there is paternal mtDNA in spermary(male- transmitted, M type).Therefore, set up a kind of method of stable amplification river razor clam freshwater mussel F type mitochondrial genome complete sequence Compare with the research such as the sustainable use of evolution genomics, conservation biology and data in have very important application valency Value.

Content of the invention

It is an object of the invention to provide a kind of stable, method of rapid amplifying river razor clam freshwater mussel F type mitochondrial genome complete sequence.

To achieve these goals, the present invention employs the following technical solutions to realize.

A kind of method of river of the present invention razor clam freshwater mussel F type mitochondrial genome complete sequence amplification, comprises the following steps:

(1)Extracting genome DNA;

(2)Regular-PCR amplification and sequencing:Employ three pairs of universal primers altogether as follows:

COIP1: GGT CAA CAA ATC ATA AAG ATA TTG G

COIP2: TAA ACT TCA GGG TGA CCA AAA AAT CA

16SP1: CGC CTG TTT ATC AAA AAC AT

16SP2: CCG GTC TGA ACT CAG ATC ACG T

ND1P1: TGGCAGAAAAGTGCATCAGATTAAAGC

ND1P2: CCTGCTTGGAAGGCAAGTGTACT

(3)Design long segment primer:It is as follows that the present invention devises three pairs of long segment primers:

F COI-16sP1: GCACCCAGGATAGAAGAAGCA

F COI-16sP2:CTTGGTGGTTCCGAGATTGC

F 16s-ND1 P1:GGCAATCTCGGAACCACCA

F 16s-ND1 P2:CCGTACTCGACGTTGAACCC

F ND1-COI P1:ATACCAACCGCCATACTGCTT

F ND1-COI P2: CCGCCGTTATCTGGAAATG

(4)LA-PCR amplification and sequencing;

(5)Sequence assembly;

(6)Gene annotation.

Present invention firstly discloses river razor clam freshwater mussel F type mitochondrial genome complete sequence, it is also to make public for the first time a kind of amplification river The method of razor clam freshwater mussel F type mitochondrial genome sequence, can be that mitochondrial genome research and the plasm resource protection of Unionidae carries For important basic material.

Beneficial effects of the present invention:By designing specificity long segment primer, by LA-PCR technology to river razor clam freshwater mussel F molded line Mitochondrial genes group is expanded, then is sequenced, is spliced and is corrected, and obtains river razor clam freshwater mussel F type mitochondrial genome complete sequence;This Invention is strict to experiment condition requirement, experiment has the advantages that repeatability, operating time are relatively short.The present invention obtains River razor clam freshwater mussel F type mitochondrial genome sequence, can be carried out to river razor clam freshwater mussel F type mitochondrial genome point from the angle of the Nomenclature Composition and Structure of Complexes Analysis, can enrich Unionidae mitochondrial gene group information, be the phylogeny of bivalves, plasm resource protection, sustainable and reasonably Using establishing important molecular genetics theoretical basiss.

Specific embodiment

Below in conjunction with the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described. Described embodiment is only a part of embodiment of the present invention, rather than whole embodiments.Based on the embodiment in the present invention, The every other embodiment that those of ordinary skill in the art are obtained under the premise of not making creative work, broadly falls into this The scope of bright protection.

A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification, comprises the steps.

1st, extracting genome DNA.

Using the marine animal tissue gene group DNA extraction kit purchased from Tiangeng biochemical technology company limited, extract river The STb gene of razor clam freshwater mussel, comprises the following steps.

(1)Take fresh muscular tissue 50mg of river razor clam freshwater mussel, be placed in 1.5ml sterile centrifugation tube, with clean bacterium of having gone out Shears fully shred in the centrifuge tube put into equipped with 200 l GA buffer, vortex oscillation 15sec.

(2)Add 20 l proteinase K (20mg/ml) solution, be vortexed and mix, brief centrifugation is to remove cap wall The globule.Place at 56 DEG C, until tissue is completely dissolved, brief centrifugation is to remove the globule of cap wall.

(3)Add 200 l buffer GB, fully reverse mix, 70 DEG C of placement 10min, solution strain is limpid, briefly from The heart is to remove the globule of cap wall.

(4)Add 200 l dehydrated alcohol, fully reverse mix, now it is possible that flocculent deposit, brief centrifugation with Remove the globule of cap wall.

(5)Previous step resulting solution and flocculent deposit are all added in an adsorption column CB3 (adsorption column puts into collecting pipe In), 12000rpm (~ 13400*g) is centrifuged 30sec, outwells waste liquid, adsorption column CB3 is put back in collecting pipe.

(6)500 l buffer GD (having added dehydrated alcohol in GD) are added in adsorption column CB3,12000rpm (~ 13400*g) it is centrifuged 30sec, outwell waste liquid, adsorption column CB3 is put back in collecting pipe.

(7)600 l rinsing liquid PW (having added dehydrated alcohol in PW) are added in adsorption column CB3,12000rpm (~ 13400*g) it is centrifuged 30sec, outwell waste liquid, adsorption column CB3 is put back in collecting pipe.

(8)Repetitive operation step(7).

(9)Adsorption column CB3 is put back in collecting pipe, 12000rpm (~ 13400*g) is centrifuged 2min, outwells waste liquid, will adsorb Post CB3 is placed in room temperature and places several minutes, thoroughly to dry remaining rinsing liquid in adsorbing material.

(10)Adsorption column CB3 is proceeded in a clean centrifuge tube, to hanging Deca 50- in middle part of adsorbed film 200 μ l elution buffer TE, room temperature places 2-5min, and 12000rpm (~ 13400*g) is centrifuged 2min, and solution is collected centrifugation Guan Zhong.

(11)The good mitochondrial DNA of purification is placed in -20 DEG C of preservations, for future use.

2nd, regular-PCR amplification and sequencing.

Mitochondrial for river razor clam freshwater mussel F typecox1、16SrRNAWithnad1The amplification of Gene Partial sequence is respectively adopted as follows Primer amplification.Amplified production send Sangon Biotech (Shanghai) Co., Ltd. to be sequenced.Including following step:

(1)Mitochondrial for expanding river razor clam freshwater mussel F typecox1、16SrRNAWithnad1The primer of Gene Partial sequence is general drawing Thing is as follows:

COIP1: GGT CAA CAA ATC ATA AAG ATA TTG G

COIP2: TAA ACT TCA GGG TGA CCA AAA AAT CA

16SP1: CGC CTG TTT ATC AAA AAC AT

16SP2: CCG GTC TGA ACT CAG ATC ACG T

ND1P1: TGGCAGAAAAGTGCATCAGATTAAAGC

ND1P2: CCTGCTTGGAAGGCAAGTGTACT

(2)The PCR reaction of three gene fragment amplifications:The template of reaction is the genome of the river razor clam freshwater mussel of said extracted DNA100ng, reaction total system is 50 μ l, wherein 10 × Ex Taq PCR Buffer 5 μ l, dNTPs4 μ l, each 2.5mmol/L, The each 2 μ l of primer, 0.4 μm of ol/L, Ex Taq enzyme 1U;

PCR reaction condition is:98 DEG C of denaturations 10sec;94 DEG C of degeneration 1min, 50 DEG C of annealing 1min, 72 DEG C of extension 2min, circulation 35 times;Last 72 DEG C of extension 7min.

3rd, design long segment primer.

?cox1、16SrRNAWithnad1The sequencing result of the Partial Fragment of gene carries out nucleotide in NCBI Blast, determination is all Unionidae animal mitochondria DNA genetic fragment and is positive-sense strand.Will be front using Primer premier5.0 Phase obtainscox1、16SrRNAWithnad1Three sections of sequences of genetic fragment for stencil design three to long PCR primer result are:

F COI-16sP1: GCACCCAGGATAGAAGAAGCA

F COI-16sP2:CTTGGTGGTTCCGAGATTGC

F 16s-ND1 P1:GGCAATCTCGGAACCACCA

F 16s-ND1 P2:CCGTACTCGACGTTGAACCC

F ND1-COI P1:ATACCAACCGCCATACTGCTT

F ND1-COI P2: CCGCCGTTATCTGGAAATG

4th, LA-PCR amplification and sequencing.

Expanded using the long PCR primer of three couples of design and the LA Taq polymerase of TaKaRa biotech firm:Reaction Template is the genomic DNA 100ng of the river razor clam freshwater mussel of said extracted, and reaction total system is 50 μ l, wherein 10 × LA Taq PCR Buffer 5 μ l, dNTPs4 μ l, each 2.5mmol/L, each 2 μ l of primer, 0.4 μm of ol/L, LA Taq enzyme 1U;

LA-PCR reaction condition is:94 DEG C of denaturations 2min;94 DEG C of degeneration 30sec, 54 DEG C of annealing 30sec, 68 DEG C of extension 5min, 30 circulations;Last 72 DEG C of extension 10min.LA-PCR product detects through 1% agarose gel electrophoresiies, has clearly band;Product Sangon Biotech (Shanghai) Co., Ltd. is sent to be sequenced.

5th, sequence assembly.

The full sequence fragment of experiment gained is spliced using the SeqMan assembly in DNASTAR7.1 software, assembling Become an end to end sequence, and go through, afoul site in comparison sequencing peak figure manual synchronizing sequence, correct Recycle SeqMan that the repetitive sequence of head and the tail is removed afterwards one of, finally give complete mitochondrial DNA complete sequence.

6th, gene annotation.

The annotation of river razor clam freshwater mussel F molded line mitochondrial DNA complete sequence has surveyed the F type mitochondrial genome of species with reference to pearl oyster subfamily DNA, with online tool ORF Finder (http://www.ncbi.nlm.nih.gov/projects/gorf/) and Blast Search 13 protein genes of mitochondrial genome, using online tool ARWEN (http://130.235.46.10/ ) and MITOS (http ARWEN://mtos.biinf.unileizig.de/help. py) search 22 tRNA genes and 2 RRNA gene and control zone (Control Region, CR).This sequence overall length 16613bp, including 13 coded proteins, 22 Individual tRNA, 2 rRNA and 1 FORF, complete genome sequence does not also upload GenBank.

Ultimate principle, principal character and the advantages of the present invention of the present invention have been shown and described above.The technology of the industry , it should be appreciated that the present invention is not restricted to the described embodiments, the simply explanation described in above-described embodiment and description is originally for personnel Invention principle, without departing from the spirit and scope of the present invention the present invention also have various changes and modifications, these change Change and improvement both falls within scope of the claimed invention.Claimed scope by appending claims and its Equivalent defines.

SEQUENCE LISTING

<110>University Of Nanchang

<120>A kind of amplification method of river razor clam freshwater mussel F molded line plastochondria whole genome sequence

<130> 2016

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213>Artificial sequence

<400> 1

gcacccagga tagaagaagc a 21

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

cttggtggtt ccgagattgc 20

<210> 3

<211> 19

<212> DNA

<213>Artificial sequence

<400> 3

ggcaatctcg gaaccacca 19

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

ccgtactcga cgttgaaccc 20

<210> 5

<211> 21

<212> DNA

<213>Artificial sequence

<400> 5

ataccaaccg ccatactgct t 21

<210> 6

<211> 19

<212> DNA

<213>Artificial sequence

<400> 6

ccgccgttat ctggaaatg 19

<210> 7

<211> 16613

<212> DNA

<213>Artificial sequence

<400> 7

ctacctagac aacaacacaa ctttagcaat ttgcccgttt gaatgaaacg aagctggaaa 60

aatcccatcc tgccactcaa aagaagtcct caacgctctt ccccagacaa cagaccgctg 120

agagacaaaa gactctaaca acataaacat aaataataac acagaaacaa aagaaattaa 180

agacccccaa gaagacacca catttcactg tgcaaaccta tcagggtaat cagaatatcg 240

acgaggcatc ccagctaacc ccaaaaaatg ctgcgggaaa aaggttagat taacaccaac 300

aaacatcaag ataaaatgaa cctttcttca aacagcgtga aaagtaacac cagaaattag 360

aggataccaa tagctgaaag cactaaacaa tgcaaaaaca gcccctattc tcaaaacata 420

gtggaaatgg gccaccacat aataagtatc gtgtaacaca atatcaagag aagagttgga 480

taaaacaatc ccagttaacc caccaaccgt aaacaaaaaa ataaaaccta aagcccatat 540

aataggaggc tcagtcttat taacaaaccc atggattgta gccaaccaac taaacacctt 600

aatcccagtg ggcacagcaa taatcatagt ggcagcagta aagtaagctc gagtatccac 660

atccatccca actgtaaaca tatgatgagc ccaaacaata aaacccaaaa ccccaataga 720

gacaatagca taaaccatcc ccaaataacc aaaaacttgc tttttcccag cataatgcat 780

aacaatgtgt gaaattatcc caaatccagg caaaatcaaa atgtacactt cgggatgccc 840

aaaaaaccaa aacaaatgca tatacaaaat aggatcccca ccaccagtag ggtcaaaaaa 900

agacgtattc aaattccgat cagtcaacag cattgtaata gcacccgcca acacaggcaa 960

cgccgcaacc aacaaaaccg ctgttaccgt cacagcccac acaaataacg gaatccgctc 1020

agcaactagc ccaggagatc gcatattccc aacagttgaa ataaagttaa tagcacccag 1080

gatagaagaa gcacccgcaa ggtgcaaaga aaaaatagcc aaatcgaccg aagccccgga 1140

atgagcaaca tttccagata acggcggata cacagtccac cctgtcccaa caccactctc 1200

caccaaagaa gatctcaaca acaaaaaaag agccggcaca agtaaccaaa accttaaatt 1260

attcagacgt ggaaaagcca tatcaggtgc cccaatcata aggggaataa gtcaattccc 1320

aaaacccccg attatcattg gcatcaccaa aaagaaaatt attataaaag catgagccgt 1380

aacaatcaca ttatataatt gatcatcccc caacaatctt ccaggctgcc ccaactccgc 1440

ccggatcaaa agacttaaag ccaacccaat caaaccagat cacaaagcta acaataagta 1500

caacgtacca atatccttat gattcgtaga acacaatcac cgcaaataat taaacaagct 1560

aattaaccca ttaatcaaga ataaaaaaca tccggagaaa ccccctctac cccaataggc 1620

ataaaagagt ggttcacacc gcaaatttca ctacactgcc caaacatcac acccgaccca 1680

atcaaatgca ccgctaattg attaatacga cctggaatag catcaacctt cacccccata 1740

gaaggaagag cccaagcatg aatcacatca gcagacctga caagaactcg cctgtcaacc 1800

ccataaggca acacacatcg attatcaacc tccaacaaac gataaccccc ctccccaaca 1860

tcaccagccc tcactatata tgaatcaaac ccaactgacc tacccccatc atcatactca 1920

tactctcagt accactgatg cccaacagcc ttcatcctaa ccgcaggccc ccccacctca 1980

tctaacaaat acaacaaccg aacagacgga atagccaaaa ttagcaaaag caaccccgga 2040

atcacagtcc aagccgcctc aagcgcctga gcctccacaa gaaaccgaga agataaccta 2100

ctcttcaaca gacacaacat catgtaacca acaaacgaag acaccattac aagaacaaac 2160

atagcatgat catggaaaaa agttaactca gaactcaaag cactaaaact atcctgaaac 2220

cctaattgac ctcaaaagct catttattag cttactccgc tactccaccc tcacaaccac 2280

tcgacaaccc ccctctaaac ctaacgaaaa gatctcccca tctatagaac cacaatctat 2340

tgttttccct taaactattc gttaccttta atcaaaaaac tccgtttact actatttaaa 2400

atttttaccc taattaaact taccctatac tagagagaga gggaaagaaa caaaaaataa 2460

acaataaaca aacaccagag aagtagccga gcttatatga ggcttctaac cacataaaga 2520

gaggtttaac tcctttcact tctctttaaa ccacacccaa tgaaatcacc ccacaaattt 2580

ttattcttat tcctgataat agcaagcacc tgcatagtct tatcctcgtc caactgacta 2640

atgacatgaa taggcttaga gattaatatg ctggggttta tccccctcat atacataaaa 2700

gacactgcca acgaatcaga aacagtagta aaatacttaa tcccccaatc ccttggctcc 2760

accgtcttca ttgcctccgc cacaatctcc cttcatctcg acaacattca atcgctcata 2820

gcactagcca tatgcctaaa gctgggggcc gcaccatttc acttctgatt cccgcctgtg 2880

atagcaggtc tcccactact accagccttc attcttctga cttgacagaa aattgctccg 2940

attttcacca tcagggccat cagcccaaca cttataagca agattatgct agttgcaaga 3000

atcagggccc tatggggagg cattggcgga ataaaccaga cagacattcg ctccctacta 3060

acctactcct caatcgcaca caccggatga atactggcca gcatcaatag cgccgcccct 3120

gtgctgaggg tgtacatcat agcatatgtg ctcatcaacc tctcaatctt cacagcccta 3180

acctcaacct ccacaaaatt ccacaaacag ctacttaccc caaaagagcc ctacaactcc 3240

ctcttgctag ctgccagcat tctctccctg gggggcctcc cccctcttac agggttcatt 3300

ataaagctac tagttattag ctacacccaa accagactct tcgttatctt caccctaatt 3360

ctcggggccc taattagtct attttactac ctctctctaa ccttttcccc actgctagaa 3420

ctaaccaaaa cacgcctaaa taaatctcac atctcaaaac cctccatagt attttttctt 3480

gcccaaattc taccactatc caccctaata tttttattct aagtgggata agctaatctc 3540

ataagctgtt gggctcataa cccaaaaata gatatattct tcccaccaaa taaacaacca 3600

ccctataaca ctcccctaaa aaagctaaaa ttaaaccaaa aactgtcgtc tacctttccc 3660

actctaaaga cccctcccgc cactcatgaa taacccccac aaacaacaac accaaaaaaa 3720

acaacaatgt taaacaacca ccaacccaca ttaaaggtct cccaactacc atcacagccg 3780

gaaacagtaa aacaatctcc acatcaaaga ccacaaaaat aacagccaac agaaagaatc 3840

gcaaggaaaa aggcactcga gaagacccaa ccggatcaaa cccacattca aatggcctag 3900

acttttctcg gccaataaac aaagaaaacc ctaaaaatag accaacaacc aatagcacaa 3960

aacccaacat cgctgataat aaaacactca ctacaacttt ttccatatac cttgctaggc 4020

aacacgccac actcaccccc ccccccactc atctgaccca ccaaccccac caaatcgact 4080

taattaaaag tcacccattt attaatttcc gcaaaatctc ctttaactaa aaaattctga 4140

ttaaataagt aaaggttcta tactttaatt aaaagatctg atttgcaatc aaccattgag 4200

tgccaacttc aacactctag aactacccaa aacaaaggac ctcggagaat atttgccttg 4260

aaatcaaaca gaaagtgttc gactcactta tccttttagt ccttcgctaa ttaagtgttt 4320

actagcacat tgacttttcg cgtcaaaggg gcataccaat gcatttggct caaaatcaac 4380

tataccctta aaccccccac agtagtaaac ctgctctggc ttagctttac cgtccttacg 4440

ccgctattgc tccttaacag ctgagacacc caatcggttt tagctaacga cccaccaaca 4500

gacttccctc aaacccaaga cctaataaga agtggtggag acacaccaat cgctgcagcc 4560

tcaggggact atccagtaac caccagccaa gcacacacta atattactca accataagac 4620

taccgcgcca caaacatacc caaaccaaag tatactcgaa agatttaagt taagtaaact 4680

aatagccttc aaagctttaa ttgatctaca atcaatcttt acaacctaaa acaagaaact 4740

ctagtgttat ggtttcggcc cataaaaagg cacaagttgt gcccttgttt tcacaaatat 4800

ttcattgacg taccaagtta acttcactaa ttaaactaca tatggtagcc cacacacatt 4860

gtgccttacg gttagtccgc ttggggattt ttaatagacc cccaaacaac ttaatcgagg 4920

acttcacccg ttaaagtcca aggtttatat cccacaacac caatgtccta tattaggtta 4980

gctaggagac taggccctag aaaacaagta tttaggggtg gcaaaaatgg tgccagcagt 5040

cgcggttata ccattacctc aagctaacta acacaaagtg ggaccaacca caagactaaa 5100

agattaactt cctacgtaaa aaataaatta caaccaaacc caaccaagtc atccactaaa 5160

agtcccaaca aaccacaacc tcaaaacccg gattagatac ccgactattg tgtggcccaa 5220

caaaaagaat actacaagcg aaagctcaaa cctcaaacaa tgtggcggtg cttaactcct 5280

catcagggga tcctgtggct taaaccgata atccacgaat accttagctc ttctagctct 5340

cagcttatgt atggccgttt acgcttgctc aaaaaagatc acaaaaggaa gcaatggggc 5400

cattccccgc caattcaggt gacatatagc caacgaaaag ctgactcatg ggatacaaat 5460

aaaccaacta ccagacttaa aagttaaacc ttttaataaa ggaggacttg aaagtaaggc 5520

tcacaccaaa taaagccagc ctgaacaaga acttaagcgc gcacaaatcg cccgtcactc 5580

cggcagtaaa gtcggataag tcgtaacata gtaggggtaa tggaaattgc ccctatcacg 5640

tccgaggtgg ccgagacccc aggcatcgag cttttaactc gaccacagta attactccag 5700

gacagctttg agaagctaat tagcatcggt cttgtaaacc gaagacaggc tataaatctc 5760

cccaaagctt agcaaagtgg ccgagagcag gcgaaagatt gtagctcttt acacggatca 5820

tcccctttgc aaacaacact accaacaata aaacagaact caagaaaata accacctcgc 5880

tcagtacccc atcaaaatag ctattgcctc tagacccgca agggtaaacc atccgtacac 5940

cacagaaaag cttacaactt gtcccttttg catcatggag aagcaacaca aacctaacaa 6000

cttaagctcc cgaataacta tgagctacta aaccttaaaa atcaatgtcg cacaattgat 6060

aaattaacct ttagtagaag taacaagcct ttcatatagt tagatagctg gctttcccct 6120

caaagcatca aagtgctgcc ccgtagacta actcctctgg gacactaaat aactacgcgg 6180

gttaactttt cgaggattag ctcgaaaaga caacaaaaat atagaaaacc ccaccaccaa 6240

aagtaggctt aaaaacagcc acctaacagc gttctagtta atggccccac acaccaacaa 6300

tattaaaacc ccaatttacc aaaatagggg aacttggagc caaacacaaa gcaccactga 6360

accggcattc tattagtatt aacatcacca agccccaaga actccagact aattgggcca 6420

ccacaaagcg actaaagcta aaactataaa aagtgaactc ggcaacaaag ttctctgcct 6480

gtttaccaaa aacatcgtct tttgagccat cgcataaaag ataatgcctg cccagtgaaa 6540

tacttaaacg gccgcgttag cgtgagcgtg ctaaggtagc gtaataaata gcctctcaat 6600

tggaggccag tgaatggcaa gactaagaac acctttacct tttatattag aaaaactttt 6660

cgtctaagtg aaaagactta gataatgaag gaagacgaaa agaccccgcg gaactttact 6720

ttttcttacg cttacaccca aaagtacaaa gcgccaaaag tttgattggg gcaatctcgg 6780

aaccaccaag cttccgatca ctacaataaa acatctaaaa tatggtatgg acaaaacaga 6840

agttaccccg gggataacag cgttatccaa cttaagagta catatcgaaa gttgggtttg 6900

cgacctcgat gttggcttaa ggacatccac attagtgcaa ccgctatgga aggatagtct 6960

gttcgactat tataccctta cacgagctga gttaagaccg gcgtaagcta ggttggtttc 7020

tatctccttt acaaacacac ctcttgattg tacgaaagga ccccaaaaga tgcacaaaaa 7080

agcacacctt aaacaattat ccaattagct caagcataaa caaaacccca atgtgagtta 7140

gtataataat accactgact taggatcagt aaataagtaa ccacttactc accaaaaggg 7200

aaagaagcta caattagcaa ttagctgtta cctaatggat agtgagcaac tcacctaccc 7260

taaccaacca ccagaaaata gtttaacaaa aacaaaaact ttgggagttt tagacttagg 7320

cactctaatt ttctgaatca aaccatcaat acgaaaaact caccccattg ccaaaatctt 7380

aaataactcc ctctacgatc tcccagcccc aactaactta tcaacctgat gaaatttcgg 7440

atctctctta ggcctatgtc taggaacaca aattgtcaca ggcctcttcc tggccataca 7500

ctacacatca agcgtagacc ttgcttttta ctcagtctcc cacatctcac gagacgtaaa 7560

ctttggctga ctaatacgag ccattcatgc aaacggcgcc tcatttttct tcgtttgcct 7620

ctatatgcac tcaggacgag gaatgtatta cggctcatac ttagccactg aaacttgaaa 7680

catcggggtt attctaatac tcctaaccat agcaacagct ttcctcggat atgttcttcc 7740

atggggacaa atgtcttttt ggggcgccac cgtaattacc aacctactat cagcaattcc 7800

atacgtggga aaaaccctgg tttactgact gtggggtggc ttctcagtgt ctaatgcaac 7860

cctaaatcga ttttttgtgt tgcactttgt gctcccattt gctatcgcag catttgctgt 7920

aatccaccta ttgtttctac acgaaagcgg gtctaacaac ccactaggta tctcctcaaa 7980

cgcaagcctt atccccttcc acatctacta cacagtaaaa gatgtggtgg gattcatctt 8040

tctcctgggc ctgctaacaa gcatttgctt cttctcacca aacctgctaa cagaccccga 8100

aaacttcatc ccagcaaacc ccctaagaac tcctgtacac attcaaccag agtgatattt 8160

cttatttgca tacgcaatcc tgcgatccat ccctaataag ttagggggtg ttcttgcact 8220

actactgtct attctaatct taactattat accactaacc cactttaata ccatacgctc 8280

tattagattc tacccgctta accaaatctt attctgaggg tttatcagaa ccttcctaat 8340

tctaacctga attggtaaac aaccagtcga agacccattt atttgggttg gacaaacttt 8400

ctccacccta tactttatat actttttgct agccccctta atcgccaaac tctgggacac 8460

cctggtattc taccaaccac gctaaatcgc cctcaactcg ctggacaagt agtttaacca 8520

taaaacataa cgctgaaaat gttaaaatga catccgtcct tttccaaaaa ccttatttct 8580

aatcatctaa caaaaaacaa ttatacatac tataaaaaag ctatccctac cagtgaaaaa 8640

acaacaaaaa taataaaaac ccgaacaaac actaacaacc tattcctctg cagcataaaa 8700

gaaaacctaa cccccttccc caaaacctta aacataccct gcccgccaaa aacctctatt 8760

cacccctgat ccaaatgcat atgagccaac acaccacccc tcaaaccagt acctgccatt 8820

aaccttccag aaaccaaatt cataaatcac attctggata aaaattgcct aaaccaacta 8880

acacgcttta gaccaaattt ccaaactctc acatacctaa cagccccata gattagccca 8940

gcaaacgtaa caagcacaat aatcgccttc ccaaaagacc caaccacatc aaacccattc 9000

acagacaccc aaaccccctg caaaagtcac ccacccaaaa tcgcccctac tgctaacacc 9060

aaaatagaag ccagcatata tttactctca gagccgcaag agagcaaaga accgccaaaa 9120

ctctgcccaa acacagccac caacagaata cgcaagctat acaccaaact caaccccgcc 9180

cccatcaata caactacaat ctccaaccca ccactcaacc cgctaaaagc cccctccaga 9240

atcaaatcct tagagtaaaa ccccctaaga aaaggcatac cgcataaaga cgcactcctc 9300

atgattaaac acccccttct aaatggcaac agtaaactaa caccccccaa aattcgacca 9360

tcctgcgtgt ccccagtaga atgaataata gaaccagcac atagaaacaa caaagcctta 9420

aataaagcgt gtgtaaacaa gtgaaaaaca gccacagtcg gatagccaac accaaccgta 9480

aacattataa gccccaactg cctcaaagta gacaaggcaa tgatcttctt caaatcaacc 9540

tcaaaacaag cccttaaccc cgccattaac atagtcaaac cacccacttt ccttaaagcc 9600

cacaaaacct caggtctctc tagcaaagat ctgtaaaaac gaatcactaa gtaaacacct 9660

gccgtaacca aagtagacga atggacaaga gctgataccg gagtgggagc agccattgct 9720

gccggtaacc aggcagaaaa gggaatttgc gcccttttag ttatagcccc aactaccacc 9780

aaaaaacaaa tcaacacccc aaacccacca aacaaaccaa aaccaaaacg ccactccccc 9840

caattaacta gaaaacaaat agctaaaatt aacaaagcat caccaatacg attaaccaaa 9900

acagttaaca tcccagcagc caaagacttt ttattctggt aataaataac caaggcaaaa 9960

gaaacaatgc ctaggccatc ccaacccaaa agaaccgtaa ctagcctagg aacaaaaata 10020

agtaaattta tagacccaac aaaccccata atcaacaaca tgaaccgtcg aataaacacc 10080

tctctttcca tataggacac gctaaacaag gacaccgacc cagaaattaa acaaacaaaa 10140

caacaaaaga tgaccctaac ataatcaaca ataatcggca aagtccattc tcttctacat 10200

aacgaaaaaa actgccactc aattaaataa cctcccccac tgtagacaac ccctcaaacc 10260

ccaaccaccc acataaacac cctaacaaaa aaaaggaaaa tcgacgagaa caagggagcc 10320

cccaaaactt ttaaaatttt cacatagcac cacgaactcg ctcgcaaagc aaccacaaca 10380

agccactcct taacctctac ctatgctact tactcctata caagtatact agagacctat 10440

aatccctact ctttatgtat tcttaccccc ctctaccagg aacactcctt aacctctacc 10500

tatgctactt actcctatac aagtatacta gagacctata atccctactc tttatgtatt 10560

cttacccccc tctaccagga acactcctta acctctacct atgctactta ctcctataca 10620

agtatactag agacctataa tccctactct ttatgtattc ttacccccct ctaccaggaa 10680

cactccttaa cctctaccta tgctacttac tcctatacaa gtatactaga gacctataat 10740

ccctactctt tatgtattct tacccccctc taccaggaac actccttaac ctctacctat 10800

gctacttact cctatacaag tatactagag acctataatc cctactcttt atgtattctt 10860

acccccctct accaggaaca ctccttaacc tctacctatg ctacttactc ctatacaagt 10920

atactagaga cctataatcc ctactcttta tgtattctta cccccctcta ccaggaacac 10980

tccttaacct ctacctatgc tacttactcc tatacaagta tactagagac ctataatccc 11040

tactctttat gtattcttac ccccctctac caggaacact ccttaacctc tacctatgct 11100

acttactcct atacaagtat actagagacc tataatccct actctttatg tattcttacc 11160

cccctctacc ttctattact atcttcacta tacctatact actatcattc cacttctact 11220

aagcttaacc cagcttttcc acttcctcac ctattatatt aaaatcaatt attataaggc 11280

acaactaatt aagtaaacga aataattacg atcagagaga gagagagaga gaaactgaag 11340

gctagtgttt tcacgaatga gtttggatca ttagatggag ttaaacctcc gcctccaagc 11400

cactcaaact ataacaactt gtcttgtagt atataaaaca cattactgta aactgcaact 11460

ttaccaaagc aatagccaag acatccaacc ccagtatcac gccggaagaa cggactaccc 11520

tgatgaggca gaacataggc ctgtgccttg atacttactc aaaaggtagt atattcatta 11580

caacttgctt acaccaagta aaaggtccct ggcccctctt gaagtaaagt ggcagaaaag 11640

tgcctcaggt ttaagccctg atcagggaga ttactccctt tactaatcgt tcagcacatt 11700

atttcaaccc ttatcacata tctcttaatc ctactcggtg tggccttctt caccctgttg 11760

gagcgcaaag ccctagggta tttccaaatc cgaaaaggcc cgaataaagt cggaatcatt 11820

gggattccac aaccactagc cgatgcccta aaactcttcg taaaggaatg agtcataccc 11880

ctatcctcta actaccttcc atttatttta accccaacaa ccatattaat tttagccctt 11940

agtttatggc aactattccc ctcatttatg acctcctctt acataacctt aggcatactt 12000

ctctttctgt gcatctcctc cctagccgtt tacacgaccc taatagcggg atgatcctcc 12060

aactctaagt atgccttatt gggtgccatc cgagcaatag cccagactat ctcatacgaa 12120

gtaaccataa cactaatcat tctcttttac ttattcttaa gaataaaaat agacctggta 12180

acaattcgcc taattaatca atcaatacca accgccatac tacttctccc actaacaatt 12240

atatgaacag cggtcatctt agctgagaca aaccgagccc cattcgactt tgctgaaggc 12300

gaatcagaat tagtgtctgg gttcaacgtc gagtacgggg gagccggttt cgctttttta 12360

tttatagccg aatacagaaa catcctcata atgagactta tcacatcctg cctcataaca 12420

ggcactctaa ctgcagccat cccagtagca gtgatatttc tctgggctcg agccaccctc 12480

ccacggtatc ggtatgatct ccttatagca atggcctgaa aatctttcct accagtaagc 12540

ctaacaattt taacctgcct aaccccactc ctgtttctat aggacccaac acagatagta 12600

tacaagtaca gctgccttcc aagcagaaag cccaaacctg gtcagtgtaa ttacacttct 12660

aattttatca actttgtgat tatactccat actcacaata gccctcccaa tacacccatt 12720

atccctaggc ataataatct tagtgctagc cttcatcaac tgcaccctca tcgcctcgat 12780

aagaccatga tacgcctata tactgttttt tatctttatc ggcggaatac tggtaatatt 12840

tgcctatatt gcatcactct caccaaatac cacattttca ctaaacagac aagcaatacc 12900

aattattata acagctaccc ttcttgcctt ctccaccagc ttaggcccga gctcaaacta 12960

cctcactaac ccagaacttg accttagcct gaaagcctca agtcaggcct taagatccct 13020

atacctatac aatagaggca actcctgcgt aatcctttta gcctgtgtgc tgcttttcac 13080

catggtcgcc agagtgaaga tttgtaaacc aaaaatagga gcactacgcc cgtacctgta 13140

aggctactca ttaatccagc aaataattca aaactaaaca ccttatacaa aagctattag 13200

tgacacccca actccgccca aaggcaacac tagtacaaac ctaactaaaa gaccgataaa 13260

ctcctccacc acaatacccc tacgcaccca aatggggcac tgaccatgtt gagtggcaga 13320

ataaacatac caggagtaca agccacttaa gaaggttata gccccggtaa aaacagcaaa 13380

aaccgtcgaa taagataaaa cagagatacc taacatcaac tccccccaca aattcaaaga 13440

cggcggagca gccatattaa tagcacacat taaaaaccaa cacaaagcaa ccccagggac 13500

caaaactagc ccacctttca ccaagtacaa cctccgagtt ttgtagcacc tgtaagtctc 13560

cctggccaaa aaaaacatcc cagaagagca cagcccatga gcaaccatta ttagcaaaca 13620

gcctaatcac ccccaatcag tatttgaaaa tactccgcct aaaaccaatc tcatgtgccc 13680

cacagaagaa taagccacta aggcttttac atcattctgg gcaaaacaca ccatcctagc 13740

aacaaccccc ccacctaaac ctaagcaaaa caccaaagta gtagtcaaag acccaaacac 13800

ccccaaccca caaaaaacac ggattaaacc atacccaccc aacttcaaca aaacaccggc 13860

taagatcata gacccggcca caggggcttc tacatgagcc tttggcagcc acaaatgaaa 13920

cccgtaaatg ggcaacttaa ccaaaaaggc caatgaacca cataaagtaa ctaaccaacc 13980

ccatctaaag cccccataac tccaccccca aaagacagac cccccctcaa acaaaaccag 14040

taaaatcaat accagcaagg gaagagaagc actcacagta tataacatca tgtacttgcc 14100

cgcctgcaat cgctcaggct gatagcctca ccctaaaatg attaacaaaa ttggaatcag 14160

cctgaactcg aacatgacgt agaagttgag taaagaccta aacctaaaac aaaaaataag 14220

caccaaagtt agtaccaaaa cccaagccac aaacccaaca ctcctattcc cagatttctg 14280

aatgtcccgc acccttgcta acaccctcaa cctagagacc aagatagtca atgacacaag 14340

accaaaagaa aaattatcaa caaccaaccc ctgaccccaa cacccagcca gcccaatcga 14400

cctaaaccac aactcaaacc tcaacaataa cataacaacg caaccccaaa caaaccccca 14460

ccaaaataca gctggtctaa acaaaccaac caaagccaca atcatccctg taaccaacaa 14520

cctaaaaatg cccagaaacc aacctaccca cgtaatcact accagtgcta cgaaccaaag 14580

aaactaacac cctgagcccc aacgctgcct cacatacccc aaacctcaaa aataacagac 14640

aagcacttgt caaccttccc gaaaatcaaa ccacactaaa aatcataata taaaccctca 14700

aagtaaaaac ctccattctc aagagagccc caaaaagcct ttttcgctga gacattaaac 14760

acaccccgcc aatcaacacc ccaataaccc ccacacccac agctgggaaa aacctcatac 14820

caactacttc ttcagcccta aaccccccct aaaacctcac ctaaccccct tcttactagt 14880

tgcacccact ttaacgcctt tacaaaccct atactctttg cgagcccttc accaaaaaac 14940

taccataatt gaaattcaac aaaccaaaaa aagtaaaaac actatcaccc atgacatagg 15000

acttaattga ggcactaaag aatgccgcac aggcaatcca agcttgacaa gcttaagtta 15060

ttagttaact aattctttat agcgtcaaca ctaatgccct gcccccattg ggtgatcagt 15120

agagtacaac ccaactaaca aaacaaaaac ataggcctgc aaaaatctaa cagcaaactc 15180

aaacaacaca taaccccaca ttaccaaact ccctagcacc cccccagtaa atgacgcact 15240

aaataaaaac ccaaccaaat actcaccaat aacatgaagc ataaggtgcc ccatagtaat 15300

gtttgcagcc aatcgaaccc ccaaggtaat cggccggatt aaaatcctaa ccctttcaat 15360

tagtactagc aaaggaatta acccaaccgg cctcccccta ggaaccaaat gagccgccct 15420

ttgacctcaa gaataactcc atcccctaaa aatcaaacaa aaccacacaa ctctagccaa 15480

cacaaaagtc aaagacaaat gactagtagg actaaaaaca tcaggtacca tcccagaaat 15540

atttacaata aaaagcacta taaataaaga cacttgaccc aaagcaaatc cgccaaaaaa 15600

cttaccagaa caatttttaa ctaatcccct aaccaactca attaacagag aggaaacaac 15660

cccaacccca gaaaccccaa cccacagctg gaccagagaa actaccaaac caagaaaccc 15720

gcttagccaa ataaagcccc aaaggctaaa actagaatgc ataccagcgt ctaaagacga 15780

aaaaatatct atcaacatta cctcagccta cctaagaccc tcaccaataa atgcacaaat 15840

aaagaaaaat ccaaacaaca tcaacaaaat gccagtacca cgcagcagcc tcaaaaccaa 15900

aatggtgagt gacagaaaaa tgatgcaaat aacaacgaac agtgcaaaca accagaaaag 15960

ccctcccgat taaaacatgc aacccatgaa acccagttat aacaaaaaaa gtagagccgt 16020

aaaccctatc agcaacacta aaagaggcct cctcatactc cccccactga agcacagtaa 16080

aatacacccc caacaacaca gtcaacctca aaccatataa agcctcctca cgattccccg 16140

ccatcagtcc atgatgcgcc caagtaaccc tcacacccga ccccaacaac acagccgtgt 16200

tcaacaacgg aaccttaaaa gcatttaacg gcatgatacc aacaggtggc caaacacaac 16260

ctaattcaac tgtcggaaca agtctcctgt gaaaaaaccc ccaaaaaaaa gcaaaaaaaa 16320

agcatacctc agaaaaaata aacaaaacca tcccccaacg aagatttata ccaacccaac 16380

tagtatgata accttgataa gtcccctccc gaaccacatc ccgtcatcac tgcaccatag 16440

ttaaaacaat taccaaaata cctaagacca tcaaactcaa gcccttgcca tgaaatcacc 16500

taaccaaacc aaccgttaaa aataaagccc ctctcgctgc agtaaatggc caaggactaa 16560

gctccactaa atgaaaagga ttacgtaaca tttactttct caacaaccag ttt 16613

Claims (1)

1. a kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification, is characterized in that comprising the following steps:
(1)Extracting genome DNA;
(2)Regular-PCR amplification and sequencing:Employ three pairs of universal primers altogether as follows:
COIP1: GGT CAA CAA ATC ATA AAG ATA TTG G
COIP2: TAA ACT TCA GGG TGA CCA AAA AAT CA
16SP1: CGC CTG TTT ATC AAA AAC AT
16SP2: CCG GTC TGA ACT CAG ATC ACG T
ND1P1: TGGCAGAAAAGTGCATCAGATTAAAGC
ND1P2: CCTGCTTGGAAGGCAAGTGTACT
(3)Design long segment primer:Devise three pairs of long segment primers as follows:
F COI-16sP1: GCACCCAGGATAGAAGAAGCA
F COI-16sP2:CTTGGTGGTTCCGAGATTGC
F 16s-ND1 P1:GGCAATCTCGGAACCACCA
F 16s-ND1 P2:CCGTACTCGACGTTGAACCC
F ND1-COI P1:ATACCAACCGCCATACTGCTT
F ND1-COI P2: CCGCCGTTATCTGGAAATG
(4)LA-PCR amplification and sequencing;
(5)Sequence assembly;
(6)Gene annotation.
CN201610910960.0A 2016-10-20 2016-10-20 A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification CN106480191A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610910960.0A CN106480191A (en) 2016-10-20 2016-10-20 A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610910960.0A CN106480191A (en) 2016-10-20 2016-10-20 A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification

Publications (1)

Publication Number Publication Date
CN106480191A true CN106480191A (en) 2017-03-08

Family

ID=58269802

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610910960.0A CN106480191A (en) 2016-10-20 2016-10-20 A kind of method of river razor clam freshwater mussel F type mitochondrial genome complete sequence amplification

Country Status (1)

Country Link
CN (1) CN106480191A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2302070A2 (en) * 2005-06-23 2011-03-30 Keygene N.V. Strategies for high throughput identification and detection fo polymorpisms
CN104988135A (en) * 2015-06-16 2015-10-21 南昌大学 Method for amplifying Tianjin tip lamprotula F-type mitochondrial genome sequence

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2302070A2 (en) * 2005-06-23 2011-03-30 Keygene N.V. Strategies for high throughput identification and detection fo polymorpisms
CN104988135A (en) * 2015-06-16 2015-10-21 南昌大学 Method for amplifying Tianjin tip lamprotula F-type mitochondrial genome sequence

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
黄晓晨: "中国蛏蚌属的父系与母系线粒体基因组全序列及淡水蚌类系统发育基因组学研究", 《中国优秀硕士学位论文全文数据库农业科技辑》 *

Similar Documents

Publication Publication Date Title
Liu et al. An AFLP-based genetic linkage map of channel catfish (Ictalurus punctatus) constructed by using an interspecific hybrid resource family
Sessions et al. A high-throughput Arabidopsis reverse genetics system
Stöck et al. Ever-young sex chromosomes in European tree frogs
Nicholas Introduction to veterinary genetics
Zhao et al. Dispersed repetitive DNA has spread to new genomes since polyploid formation in cotton
Nekrasov et al. Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease
Raizada et al. Somatic and germinal mobility of the RescueMu transposon in transgenic maize
Kvon et al. Progressive loss of function in a limb enhancer during snake evolution
Sidell et al. Variable expression of myoglobin among the hemoglobinless Antarctic icefishes
Cheng et al. Cloning and characterization of maize B chromosome sequences derived from microdissection
DE60129593T2 (en) Compositions and method for extraction of a nucleic acid
Okumuş et al. Fish population genetics and molecular markers: II-molecular markers and their applications in fisheries and aquaculture
Ames et al. The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species–Calliphora vicina and Calliphora vomitoria
Sanetra et al. A microsatellite-based genetic linkage map of the cichlid fish, Astatotilapia burtoni (Teleostei): a comparison of genomic architectures among rapidly speciating cichlids
Chong et al. Identification and characterization of Malaysian river catfish, Mystus nemurus (C&V): RAPD and AFLP analysis
Krzywinski et al. Isolation and characterization of Y chromosome sequences from the African malaria mosquito Anopheles gambiae
Sebastio et al. Identification of anchovy (Engraulis encrasicholus L.) and gilt sardine (Sardinella aurita) by polymerase chain reaction, sequence of their mitochondrial cytochrome b gene, and restriction analysis of polymerase chain reaction products in semipreserves
EP0550491B1 (en) Test to determine an organism&#39;s species and/or population identity by direct nucleotide sequence analysis of defined segments of its genome
Schielzeth et al. Challenges and prospects in genome wide QTL mapping of standing genetic variation in natural populations.
Kalhor et al. Developmental barcoding of whole mouse via homing CRISPR
McPherson et al. Isolation of nine novel tetranucleotide microsatellites in Atlantic herring (Clupea harengus)
Glöckner et al. Phylogeny and Identification In Situ ofNevskia ramosa
CN104846010B (en) A kind of method for deleting transgenic paddy rice riddled basins
Tang et al. An effective method for isolation of DNA from pig faeces and comparison of five different methods
CN101712996A (en) Method for quickly identifying categories of meat and dried meat products of five domestic animals

Legal Events

Date Code Title Description
PB01 Publication
C06 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination