CN106434420A - Method for purifying marine aquaculture wastewater by adopting bacterium with nitrification function - Google Patents
Method for purifying marine aquaculture wastewater by adopting bacterium with nitrification function Download PDFInfo
- Publication number
- CN106434420A CN106434420A CN201610652564.2A CN201610652564A CN106434420A CN 106434420 A CN106434420 A CN 106434420A CN 201610652564 A CN201610652564 A CN 201610652564A CN 106434420 A CN106434420 A CN 106434420A
- Authority
- CN
- China
- Prior art keywords
- culture
- nitrogen
- nitrification
- marine
- wastewater
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/30—Organic compounds
- C02F2101/34—Organic compounds containing oxygen
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2101/00—Nature of the contaminant
- C02F2101/30—Organic compounds
- C02F2101/38—Organic compounds containing nitrogen
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
- C02F2103/08—Seawater, e.g. for desalination
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Hydrology & Water Resources (AREA)
- Environmental & Geological Engineering (AREA)
- Water Supply & Treatment (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention relates to a method for purifying marine aquaculture wastewater by adopting the bacterium with the nitrification function. The method comprises the following steps: inoculating bacterial strain culture solutions to 500mL of aquaculture wastewater respectively; carrying out sterilization for 20min at 121 DEG C; placing the sterilized culture solutions in a constant-temperature oscillator for culturing; and under the aseptic condition, testing the contents of ammonia and nitrogen, nitrite nitrogen and nitrate nitrogen of a sample. The method provided by the invention is non-toxic and harmless to cultured animals, the process is simple, no secondary pollution is caused, and the adopted nitrifying bacteria is obtained through sludge produced by the marine aquaculture system. The bacterium with the nitrification function belongs to Bacillus sp., is named as nitrification-HN07 strain, is preserved in the Guangdong Microbiological Culture Collection Center on June 1, 2016, and is assessed with the accession number of GDMCC NO.60043.
Description
Technical field
The present invention relates to breeding wastewater administers field, specifically a kind of have nitrification function using the salt tolerant being obtained
Bacteriological purification marine culture wastewater method.The method is used for removing breeding wastewater ammonia nitrogen and total nitrogen content, is sea-farming
The biological restoration of the inorganic polluted by nitrogen of waste water provides theories integration, is adapted to promoting the use of of coastal cultivation industry.
Background technology
Sea-farming developing history for many years, the demand of China's marine product is increasing in recent years, and sea is fished for
Amount has been insufficient for the demand in market, therefore mariculture industry fast development, and tends to excessive to intensive culture from extensive cultivation.Pollution
Problem also with generation, offshore waters environment severe exacerbation, thus it is unbalance to result in safeguard of coast and marine ecological system, have a strong impact on
Aquaculture ecological safety, the sustainable development of restriction mariculture industry.Marine culture wastewater pollution is mainly derived from remaining
Feedstuff, cultivation body Excreta, all kinds of chemical drugss etc., main pollution-producing is nitrogen, phosphorus and Organic substance.Marine culture wastewater has
Two obvious features, that is, the content of potential pollutant is low, the water yield is big, waste water distribution dispersion.In aquaculture process, water body
The too high caused eutrophication situation of the nutritive element contents such as ammonia, nitrate, nitrite frequently occurs.Ammoniacal nitrogen and nitrous
The toxicity such as hydrochlorate nitrogen are higher to be caused to have a strong impact on to aquatic animal.
At present, sea-farming recovery technique mainly includes three classes：Peripheral doses, chemical redemption and biological restoration.Common thing
Reason reparation has Sediment Dredging, changes water, aeration, screen cloth, spills the methods such as zeolite ash, but this kind of method often need higher investment and
Running expense, and treatment effect is not thorough；Chemical redemption mainly uses improver of water quality, water disinfection agent and algicide etc.
Improve breeding environment.But chemical redemption agent easily produces harmful secondary metabolite so that aquatic ecosystem health status are more disliked
Change, aquatic products quality deterioration；Biological restoration refers to biology especially microbial catalyzed degradation
Environmental contaminants, reduce or eliminate the controlled of environmental pollution or spontaneous process.There are some researches show, caused by microorganism
Nitrification be one of important mechanisms of Nitrogen releasing in water.Nitrobacteria is the chemolithotrophic bacteria that a class has Nitrification
Bacterium, is the microorganism playing a major role in biological nitration, and in sewage, the content of nitrobacteria is proportional with nitrification speeds.Cause
This nitrobacteria has the good effect purifying water, and can be used for sea-farming biological restoration process.
The present invention quotes following lists of references, and all literature content heres are fully incorporated and make reference：
[1] bang ocean, Dai Zhijun. Present Pollution in Chinese Offing analysis and countermeasure [J]. environmental protection science, 2001,27
(4):6-8.
[2] Li Chunhou, Wang Xuefeng, Wang Xiaowei, Lin Lin. Chinese sea water culture environment quality and its ecological reestablishment research
Progress [J]. agro-environment science journal, 2006,25:310-315.
[3] Liu Weidong, Su Hao, Deng Likang. application [J] in aquaculture for the microorganism. aquatic science, 2001,20
(2):28-31.
[4] Zhao Yujie, thanks in fashion, Zhou Ke. application [J] in aquaculture for the microbial ecological agent. sustainable development,
2007,1:27-29.
[5] Li Zhengkui, the Pu training people, Hu Weiping, etc. immobilization bacterium technology and its application in physical-ecological engineering
Immobilization ammonia circulates the reparation [J] to aquatic ecosystem for the antibacterial. Jiangsu's agriculture journal, 2001,17 (4):248-252.
[6] Cui Yuanyuan. the screening of low temperature nitrobacteria and applied research [D]. Harbin Institute of Technology, 2006:6-8.
[7]Madsen E L.Metermining in situ biodegradation:facts and challenges
[J].Evrion Sci Technol,1991,25(10):1663-1672.
The described antibacterial with nitrification function belongs to bacillus (Bacillus sp.), is named as
Nitrification-HN07 bacterial strain, is preserved in Guangdong Province's Culture Collection, deposit number on June 1st, 2016：
GDMCC NO.60043.
Content of the invention
It is an object of the invention to provide a kind of method that salt tolerant has the bacterial treatment marine culture wastewater of nitrification function.
For achieving the above object, the technical solution used in the present invention is：
A kind of method using the bacteriological purification marine culture wastewater with nitrification function, it comprises the steps：
1) inoculate this antibacterial；
2) constant temperature culture.
Preferably, described this antibacterial step of inoculation is：It is that the bacterial isolateses culture fluid of No. 7 is inoculated in by having numbered
In 500mL breeding wastewater, inoculum concentration is 5mL.A breeding wastewater is separately taken to add 5mL sterilized water as comparison.Sterilize at 121 DEG C
20min.
Preferably, described constant temperature culture step is：Sterilized culture fluid is placed in constant temperature oscillator culture, condition is
120r/min, 30 DEG C.
Preferably, methods described comprises the steps：Aseptically, determination sample ammonia nitrogen, nitrite nitrogen, nitric acid
Salt nitrogen content, sample time is 6h after inoculation, 12h, 24h, 36h, 48h；Described determination sample ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content
Using method be respectively：Marine monitoring specification the 4th part：Sea water analysis GB 17378.4-2007 (36.2) hypobromite oxygen
Change method；The mensure spectrophotography GB/T 7493-1987 of water quality nitrite nitrogen；Standard of marine survey the 4th part：Sea water
Learn key element investigation GB/T 12763.4-2007 (11.1) Zinc Cadmium Reduction.
Preferably, a kind of method that salt tolerant has the bacterial treatment marine culture wastewater of nitrification function：
1) it is that the bacterial isolateses culture fluid of No. 7 is inoculated in 500mL breeding wastewater by having numbered, inoculum concentration is 5mL.Separately
One bottle of breeding wastewater is taken to add 5mL sterilized water as comparison.Sterilize at 121 DEG C 20min；
2) above-mentioned sterilized culture fluid is placed in constant temperature oscillator culture, condition is 120r/min, 30 DEG C；
3) sampling all aseptically, determination sample ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content, sample time is
6h after inoculation, 12h, 24h, 36h, 48h.
4) described numbered be No. 7 bacterial isolateses screening from Hainan cabrilla a high position culturing pool at the bottom of pond deposit, institute
State breeding wastewater and pick up from this cabrilla high position culturing pool.
The method that described determination sample ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content adopt is respectively：Marine monitoring specification the 4th part：
Sea water analysis GB 17378.4-2007 (36.2) hypobromite oxidation method；The mensure spectrophotography GB/ of water quality nitrite nitrogen
T 7493-1987；Standard of marine survey the 4th part：Sewater chemistry key element investigation GB/T 12763.4-2007 (11.1) zinc cadmium is also
Former method.
Advantage for present invention：
1st, the present invention has the inorganic polluted by nitrogen of bacterial remediation marine culture wastewater of nitrification function using salt tolerant, has letter
Just the features such as, non-secondary pollution, repairing effect are good.
2nd, the present invention using salt tolerant there is the bacteria screening of nitrification function sink from Hainan cabrilla high position culturing pool at the bottom of pond
Long-pending thing, is purified to the waste discharge of sea farming system using the self-produced heavy mud of sea farming system, with low cost, behaviour
Make simple possible.And (6h) realizes effective removal of ammonia nitrogen in waste water and total nitrogen within a short period of time, coastal cultivation industry is given up
Water harnessing has preferable application prospect.
Brief description
Fig. 1 is ammonia nitrogen in waste water clearance situation under this bacterial treatment；
Fig. 2 is waste water total nitrogen content situation of change under this bacterial treatment；
Fig. 3 is waste water nitrate nitrogen situation of change under this bacterial treatment；
Fig. 4 is waste water nitrite situation of change under this bacterial treatment.
Embodiment
Below by embodiment, the invention will be further described.It should be understood that embodiment of the present invention methods described
It is only used for the present invention is described, rather than limitation of the present invention, to present invention preparation side under the concept thereof of the present invention
The simple modifications of method broadly fall into the scope of protection of present invention.
Embodiment 1：The preparation of this antibacterial
From Hainan cabrilla high position culturing pool at the bottom of pond, (particular location is sample collecting：Hainan Province Wenchang City Hui Wen town Feng
Zheng Sheng plant of village of family).
The key instrument using and equipment have：
Electronic balance (CP124C), Ao Haosi (Shanghai) Instrument Ltd.；
Electric heating constant-temperature blowing drying box (DHG-9140A), Shanghai leaps experimental apparatus company limited；
Vertical pressure steam sterilizer (LDZX-50KBS), Shenan Medical Appliances Factory, Shanghai；
Water-bath constant temperature oscillator (HZS-H), Changzhou Pu Tian instrument manufacturing company limited；
Biological clean bench (BCM-1000A), SuZhou Antai Air Tech Co., Ltd.；
Electric heating constant temperature tank (HH-W600), Shanghai Pudong Physical and Optical Instruments Factory；
Optical microscope, motic Maike Aodi Industry Group Co Ltd；
Bole grads PCR instrument-S1000, Bio-Rad；
Dragon 5mL, 1mL, 200uL, 200uL, 5uL liquid-transfering gun.
Experimentation：
1) enrichment culture：Weigh two parts of 40g sediment samples, aseptic operating platform is inoculated in and sterilizes in advance, built-in
Have in the 200mL nitrite bacteria culture medium of bead and the triangular flask of nitrobacteria culture medium, be placed in water-bath constant temperature oscillator
Interior with constant-temperature shaking culture under 26 DEG C, 160r/min 2 days it is therefore an objective to break up zoogloea, make antibacterial become unicellular to be scattered in
In water.Respectively culture fluid is seeded to new culture medium on aseptic operating platform, inoculum concentration is 5%.Repeat this operation 3 times, altogether
Culture 8 days, stand-by；
Described culture medium is：
Nitrite bacteria medium component is：Every liter of culture medium is by NH4Cl40.4g, K2HPO4·3H2O 8.0g, KH2PO4
1.5g, CH3COONa 4.4g, MgSO4·7H2O 0.1g, trace element solution 1mL, pH are 7.0-7.3.Wherein, trace element：
ZnSO42.2g, CaCl2·2H2O 5.5g, FeSO4·7H2O 5.0g, CuSO4·5H2O 1.57g, CoCl2·6H2O
1.61g, MnCl2·4H2O 5.0g, Na2MoO4·4H2O 1.1g, Na2EDTA 63.7g, deionized water 1000mL form.
PH7.0, at 121 DEG C, sterilizing 20min is standby.
Nitrobacteria medium component is：Every liter of culture medium is by NaNO21.0g, NaCO31.0g, CaCO31.0g,
K2HPO4·3H2O 8.0g, MgSO4·7H2O 0.1g, trace element solution 1mL, pH are 7.0-7.3.Wherein, trace element：
ZnSO42.2g, CaCl2·2H2O 5.5g, FeSO4·7H2O 5.0g, CuSO4·5H2O 1.57g, CoCl2·6H2O
1.61g, MnCl2·4H2O 5.0g, Na2MoO4·4H2O 1.1g, Na2EDTA 63.7g, deionized water 1000mL form.
PH7.0, at 121 DEG C, sterilizing 20min is standby.
2) isolate and purify：The inoculum taking above-mentioned enrichment is rule respectively to nitrite bacteria culture medium and is nitrified thin
Bacterium solid medium.Use inoculating loop picking inoculum first, then (be careful not to draw in the flat lining out making in advance
Broken agar surface).Will trying one's best in the range of being drawn during line, it is full to draw, and then by inoculating loop calcination, is rotated further by certain angle
Another area is drawn in the region connecting line again, finally draws completely whole plate, cultivates at 30 DEG C, 3-4d in constant temperature biochemical cultivation case
Picking single bacterium colony is rule to new flat board, repetitive operation 5 times afterwards, isolates the preferable single bacterium colony of growing way；
3) fungi preservation：Prepare nitrite bacteria and nitrobacteria solid slant culture base respectively, will prepare first
Fluid medium is distributed in 20mL test tube, and every test tube loads the culture medium of 1/3 capacity.After subpackage finishes, need to use tampon
Block bottleneck, the main purpose of stifled tampon was air filtering, it is to avoid pollution.Sterilize after being stoppered tampon standby.Respectively by above-mentioned length
The preferable 10 plants of nitrite bacterias of gesture and nitrobacteria single bacterium colony are rule to slant medium, use inoculating loop picking antibacterial to train first
Then inoculating loop is put in slant medium test tube, gently rules in culture medium by nutrient solution, and inoculation thalline is thereon.During line
To draw closeer parallel lines by bottom, to draw top always, to make full use of inclined-plane area.Constant temperature biochemical culture at 30 DEG C
After culture 3d in case, place 4 DEG C of Refrigerator stores；
4) strain identification：The pure bacterium colony of above-mentioned acquisition is carried out nitrosation acetic bacterial and nitrobacteria identification, selects aerobic
The excellent bacterial strain of Nitrification.Again 16S rDNA identification is carried out to this antibacterial, that is, filter out aerobic nitrification bacterial isolateses.
Nitrite bacteria is identified：Take above-mentioned 10 plants of nitrite bacteria single bacterium colonies to be inoculated in nitrite bacteria culture medium, separately take
A nitrite bacteria culture medium inoculated sterilized water is as comparison.48h is cultivated in 26 DEG C of constant temperature oscillators.Take above-mentioned 10 plants of bacterium
Strain culture fluid and comparison liquid on ceramic whiteware color board, each one with Griess reagent liquid A and liquid B, if with the presence of nitrous acid
Then take on a red color, test result indicate that, No. 7 strain cultured solutions all assume redness, and other bacterial strains and comparison do not have colour developing.Cause
This, No. 7 bacterial strains have ammoxidation, i.e. nitrification activity, and that is, No. 7 bacterial strains are the antibacterial with nitrosation function.
Nitrobacteria is identified：Take above-mentioned 10 plants of nitrobacteria single bacterium colonies to be inoculated in nitrobacteria culture medium, separately take a nitre
Change bacteria culture media inoculation 1.0mL sterilized water as comparison.48h is cultivated in 26 DEG C of constant temperature oscillators.Take above-mentioned nitrification respectively
Inoculum 10mL in test tube, first of all for remove culture fluid in NO-, add acetic acid 5-8 to drip in culture fluid and be allowed to
Acidifying, adds several p-aminobenzene sulfonic acid, when stopping venting, adds a p-aminobenzene sulfonic acid, NO during this-Turn
Turn to nitrogen effusion.Take this culture fluid and comparison liquid respectively on ceramic whiteware color board, be added dropwise over Griess reagent, if not
Assume redness it was demonstrated that nitrous acid is wholly absent.Again plus diphenylamines reagent 2-4 drips, there is nitrobacteria as assumed blue explanation
Exist.Test result indicate that, all blueness not occurring it was demonstrated that not existing the bacterial strain of nitrite-oxidizing one-tenth nitric acid, there is not nitre
Change antibacterial.
16S rDNA identifies：It is characterized in that PCR amplification program, this program is 94 DEG C of denaturations 5min；94 DEG C of degeneration
45s, 55 DEG C of annealing 45s, 72 DEG C of extension 90s, 30 circulations；72 DEG C of extension 10min.Primer is designed according to NCBI and list of references
As follows：
Forward primer F：(5'-CGGAATTCATGATGTCGCCCAATGGCTC-3')；
Downstream primer R：(5'-CCCAAGCTTTCAGGCGGCCGCCTTGCCGC-3').
The PCR primer of the antibacterial that numbering is No. 7 is delivered to Hua Da gene and is sequenced, and the sequence length surveyed is left in 1000bp
The right side, the BLAST through NCBI contrasts as nitrobacteria, and its sequence is as follows：
No. 7 bacterial sequences
GCGGCACATAGAACAGCATCGGCAGCGTGCGGAACTCCGGATGCAACGGCAGCGCGATGCCCCATTTCT
TCACGAACTGG
AAAACCGGGAGACTTCTGCGCAGCCTCGATCTTCGCATCTGGAATCCCGTTCGCCCTCGCGGCGGCGAT
GATCTCCGGAT
CAAACGGATCCTTGATGATGTTGCGCTGAGCCATCACCAGCTGGTCTGCGGCGACTTCGCGGTCTCCTC
GATCGCATCCG
CATCGTAAAGCACGAGGCCGATATACCGGATGCGTCCGACGCAGGAGTGGAAGCACGCCGGCGGCTGGC
CGCTCTCCAGA
CGCGGATAGCACAGGATGCACTTCTCGGCCTTGCCGGTCGACCAGTTGAAGTAGGTCTTCTTGTAGGGG
CAGCCGGAAAC
GCACATGCGCCAGGCGCGGCAGCGTTCCTGGCTCACCAGCACAACGCCGTCCTCACCGCGCTTGTAGAG
CGCGCCCTGCG
GACACGCCGCAACGCATCCCGGATTGAGGCAATGGTTGCAGATGCGCGGCAGATAGAAAAACACCGTGC
TGTTGATCTCG
TTGATCTGGCGCATCTCCTCGTCGGAAGCGCCGTCGAAGTTCGGGTCGTTGTTGGCGTAAACCTGCGAA
CCGCCGAGGTC
GTCGTCCCAGTTCGGACCCGCCTCGATCGTGTCCATGTACTTGCCGGTCACCATCGAGATCGCCCGCGC
AGTCGGCTGCT
CGTCGGCCAGCGGCGCATTGATCAGGTTCTGGTAGTCGTAGGTCCAGGGCTCGAAATAATCGTCGAGCG
TCGGCAGATAG
GGGTTGTAGAAAATGTTCGTCAGCGTGCCCCACTTGCCCTGCAGCCGCAGCCGCAGGCTCTTCTGCCGC
TGACCGTCAAC
CACCCAGCCGCCACGATACTTGGTCTGGTCTTCCCAACGTGTCGGGTAACCCGTACCCGGCTTGGTCTC
CACGTTGTTCC
AGTACATGTACTCGGTGCCCTTGCGATCGGTCCAGATGTTCTTGCACGCGATGCTGCAGGTGTGGCAAC
CGAT
Described nitrobacteria belongs to bacillus (Bacillus sp.), is named as nitrification-HN07 bacterium
Strain, is preserved in Guangdong Province's Culture Collection, deposit number on June 1st, 2016：GDMCC NO.60043.It is such as
Shown in sequence number.
Embodiment 2：Wastewater treatment
In Hainan cabrilla high position culturing pool, (particular location is for wastewater sample collection：Hainan Province Wenchang City Hui Wen town Feng
Zheng Sheng plant of village of family).
The key instrument using and equipment have：
Electronic balance (CP124C), Ao Haosi (Shanghai) Instrument Ltd.；
V-1200 type visible spectrophotometer, Shanghai Mei Puda Instrument Ltd.；
JPSJ-605 type dissolved oxygen instrument (desk-top), Shanghai INESA Scientific Instrument Co., Ltd.；
Electric heating constant-temperature blowing drying box (DHG-9140A), Shanghai leaps experimental apparatus company limited；
Vertical pressure steam sterilizer (LDZX-50KBS), Shenan Medical Appliances Factory, Shanghai；
Biological clean bench (BCM-1000A), SuZhou Antai Air Tech Co., Ltd.；
Electric heating constant temperature tank (HH-W600), Shanghai Pudong Physical and Optical Instruments Factory；
Optical microscope, motic Maike Aodi Industry Group Co Ltd
Dragon 5mL, 1mL, 200uL liquid-transfering gun.
Experimentation：
1) it is that the bacterial isolateses culture fluid of No. 7 is inoculated in 500mL breeding wastewater by having numbered, inoculum concentration is
10mL.One bottle of breeding wastewater is separately taken to add 5mL sterilized water as comparison.Sterilize at 121 DEG C 20min；
2) above-mentioned sterilized culture fluid is placed in constant temperature oscillator culture, condition is 120r/min, 30 DEG C；
3) sample all aseptically, determination sample dissolved oxygen, ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content, sampling
Time is 6h after inoculation, 12h, 24h, 36h, 48h.
The method that determination sample ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content adopt is respectively：Marine monitoring specification the 4th part：Sea water
Analysis GB 17378.4-2007 (36.2) hypobromite oxidation method；The mensure spectrophotography GB/T of water quality nitrite nitrogen
7493-1987；Standard of marine survey the 4th part：Investigation GB/T 12763.4-2007 (11.1) the zinc cadmium reduction of sewater chemistry key element
Method.
Waste water quality such as following table：
Experimental result is as follows：
No. 7 bacterium ammonia nitrogen removal franks in 48h are just, and in 6h highest, ammonia nitrogen removal frank is 48% such as Fig. 1.
Waste water total nitrogen content is 1.996mg/L, and the waste water total nitrogen of No. 7 bacterial strain process assumes minimizing trend, and it is useless that it is processed
Water total nitrogen content is below initial value in 5 sample points, such as Fig. 2.
Waste water nitrate nitrogen content is 0.927mg/L, and the waste water nitrate nitrogen content of No. 7 bacterial strain process is higher than initial value in 6h, 12h,
And to 24,36, its value of 48h less than initial value, such as Fig. 3.
Waste water nitrous nitrogen content is 0.341mg/L, and the waste water nitrous nitrogen content of No. 7 bacterial strain process is differed not with initial value
Greatly, as Fig. 4.Its change is negligible.
From above experimental result, No. 7 nitrobacterias play the role of preferably to remove ammonia nitrogen in marine culture wastewater, its
Ammonia nitrogen removal frank is 48% to the maximum, and time of occurrence is 6h.And its total nitrogen does not increase and reduces on the contrary, No. 7 nitrobacterias are in 6h
Total nitrogen content is compared waste water and has been declined.In processing procedure, waste water nitrous nitrogen content is basically unchanged, and nitrate nitrogen first raises and reduces afterwards,
Speculate that rising is because mineralized nitrogen is nitrate nitrogen, and reduce and then there may be Denitrification so that nitrate nitrogen is escaped with nitrogen form
Go out.It can be seen that No. 7 nitrobacterias can effectively remove content of inorganic nitrogen in marine culture wastewater, effectively repair marine culture wastewater inorganic
Polluted by nitrogen.
Claims (5)
1. a kind of method using the bacteriological purification marine culture wastewater with nitrification function is it is characterised in that include following steps
Suddenly：
1) inoculate this antibacterial；
2) constant temperature culture.
2. method according to claim 1 is it is characterised in that this antibacterial step of described inoculation is：To number is No. 7
Bacterial isolateses culture fluid be inoculated in 500mL breeding wastewater, inoculum concentration is 5mL.A breeding wastewater is separately taken to add 5mL no
Bacterium water is as comparison.Sterilize at 121 DEG C 20min.
3. method according to claim 1 is it is characterised in that described constant temperature culture step is：Sterilized culture fluid is put
In constant temperature oscillator culture, condition is 120r/min, 30 DEG C.
4. according to the arbitrary described method of claim 1-3 it is characterised in that also comprising the steps：Aseptically, survey
Random sample product ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content, sample time is 6h after inoculation, 12h, 24h, 36h, 48h；Described survey
The method that random sample product ammonia nitrogen, nitrite nitrogen, nitrate nitrogen content adopt is respectively：Marine monitoring specification the 4th part：Sea water analysis
GB17378.4-2007 (36.2) hypobromite oxidation method；The mensure spectrophotography GB/T 7493- of water quality nitrite nitrogen
1987；Standard of marine survey the 4th part：Sewater chemistry key element investigates GB/T 12763.4-2007 (11.1) Zinc Cadmium Reduction.
5., according to the arbitrary described method of claim 1-4, described numbering is that the antibacterial with nitrification function of No. 7 belongs to spore
Bacillus (Bacillus sp.), are named as nitrification-HN07 bacterial strain, are preserved in Guangdong Province on June 1st, 2016
Culture Collection, deposit number：GDMCC NO.60043；Shown in its sequence number 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610652564.2A CN106434420A (en) | 2016-08-10 | 2016-08-10 | Method for purifying marine aquaculture wastewater by adopting bacterium with nitrification function |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610652564.2A CN106434420A (en) | 2016-08-10 | 2016-08-10 | Method for purifying marine aquaculture wastewater by adopting bacterium with nitrification function |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434420A true CN106434420A (en) | 2017-02-22 |
Family
ID=58184331
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610652564.2A Pending CN106434420A (en) | 2016-08-10 | 2016-08-10 | Method for purifying marine aquaculture wastewater by adopting bacterium with nitrification function |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434420A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113042503A (en) * | 2021-03-15 | 2021-06-29 | 宣城市安工大工业技术研究院有限公司 | Method for realizing complete recycling of kitchen waste through decomposition and fermentation |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005117923A1 (en) * | 2004-05-27 | 2005-12-15 | Süd-Chemie AG | Bioprotective |
| CN1831113A (en) * | 2006-03-14 | 2006-09-13 | 浙江大学 | Coagulating bacillus strain and use thereof |
| CN102674561A (en) * | 2012-05-30 | 2012-09-19 | 中国海洋大学 | Preparation method for immobilized spherules for mariculture waste water treatment |
| CN102925377A (en) * | 2011-11-28 | 2013-02-13 | 上海海洋大学 | Bacillus licheniformi, screening method and uses thereof |
| CN103773722A (en) * | 2014-01-16 | 2014-05-07 | 中国药科大学 | Salt-tolerance bacillus subtilis with low-temperature biological deamination function and application of bacillus subtilis |
| CN103911361A (en) * | 2014-04-21 | 2014-07-09 | 中国海洋大学 | Biofilm cultivation method taking bagasse as carrier and application thereof |
-
2016
- 2016-08-10 CN CN201610652564.2A patent/CN106434420A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005117923A1 (en) * | 2004-05-27 | 2005-12-15 | Süd-Chemie AG | Bioprotective |
| CN1831113A (en) * | 2006-03-14 | 2006-09-13 | 浙江大学 | Coagulating bacillus strain and use thereof |
| CN102925377A (en) * | 2011-11-28 | 2013-02-13 | 上海海洋大学 | Bacillus licheniformi, screening method and uses thereof |
| CN102674561A (en) * | 2012-05-30 | 2012-09-19 | 中国海洋大学 | Preparation method for immobilized spherules for mariculture waste water treatment |
| CN103773722A (en) * | 2014-01-16 | 2014-05-07 | 中国药科大学 | Salt-tolerance bacillus subtilis with low-temperature biological deamination function and application of bacillus subtilis |
| CN103911361A (en) * | 2014-04-21 | 2014-07-09 | 中国海洋大学 | Biofilm cultivation method taking bagasse as carrier and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 成钰: "海水异养硝化-好氧反硝化芽孢杆菌SLWX2的筛选及脱氮特性", 《环境科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113042503A (en) * | 2021-03-15 | 2021-06-29 | 宣城市安工大工业技术研究院有限公司 | Method for realizing complete recycling of kitchen waste through decomposition and fermentation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754570B (en) | One plant of Pseudomonas stutzeri and its application | |
| CN104911130B (en) | One plant of Halomonas with denitrification ability and its application | |
| CN104673710B (en) | Rhodococcus strain and its application | |
| CN107201325A (en) | Pseudomonad strain and its cultural method and application | |
| CN104845920B (en) | One plant of ocean Zhuo Beier Salmonella and its application | |
| CN101397545B (en) | O-nitrobenzaldehyde degrading bacteria and use thereof | |
| CN103103153B (en) | Anaerobic denitrification phosphorus-accumulating bacteria strain with denitrification and phosphorous removal effects and application thereof | |
| CN111733113B (en) | COD (chemical oxygen demand) degrading strain and application thereof | |
| CN103382049B (en) | Sequencing batch activated sludge reactor for sewage treatment and treatment process | |
| KR20150037909A (en) | Method and device for treating ammonia nitrogen-containing water at low temperature | |
| Naz et al. | Performance evaluation of stone-media pro-type pilot-scale trickling biofilter system for municipal wastewater treatment | |
| CN115386520B (en) | Rhodococcus pyridine-philic RL-GZ01 strain and application thereof | |
| CN102153250A (en) | Coking wastewater treatment system and method | |
| CN104862260A (en) | Arthrobacter with aerobic denitrification capability and application thereof | |
| CN103114062A (en) | Denitrifying phosphate-accumulating organism with nitrogen and phosphorus removal functions and applications thereof | |
| CN108486013A (en) | Application of the adhesion sword bacterium in sewage purification | |
| CN109706096A (en) | One plant of brevibacterium frigoritolerans and its application with denitrogenation and efficient flocculating ability | |
| G Madkour et al. | Removal of ammonia and orthophosphate from domestic wastewater using marine actinomycetes | |
| CN106434420A (en) | Method for purifying marine aquaculture wastewater by adopting bacterium with nitrification function | |
| CN106591181B (en) | A kind of Mysore arthrobacterium and its application in purifying sea water cultivation nitrogenous effluent | |
| CN101993838A (en) | Delftia tsuruhatensis strain H1 with chloroaniline degradation capacity and application thereof | |
| CN109825450A (en) | One plant of resistance to high ammonia nitrogen allotrophic nitrobacteria and its application | |
| CN104745515A (en) | Acinetobacter sp. for degrading polycyclic aromatic hydrocarbon and application of acinetobacter sp. | |
| CN108408921A (en) | A kind of probiotics and preparation method thereof promoting breeding water body transparency | |
| CN104164389B (en) | One fluorescent pseudomonads and the application in aquaculture thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170222 |