CN106432465A - Human tumor-inhibiting protein variant and application thereof - Google Patents

Abstract

The invention provides a human tumor-inhibiting protein variant. Compared with a wild type, the protein variant has a higher effect of inhibiting the growth of tumor cells. The variant protein and derivatives thereof can be applied to treatment of various tumors.

Description

A kind of human tumor inhibiting protein variant and its application

Technical field

The invention belongs to biological technical field, specifically, the present invention relates to tumor suppressor protein variant.

Background technology

KIAA0157 is positioned 10q26.13 (NM_032182.), mRNA total length 3008bp, cDNA1248bp, encodes 416 Individual aminoacid (sequence 2), molecular weight is the protein of 47KD.The KIAA0157 homology of mice, rat and people up to 90% with On, illustrate that it is highly conserved during evolution, important biological function may be played.Shown using bioinformatic analysis Show, there is a coiled coil domain at KIAA0157 active site of protein 215-266 amino acids, this domain is usual It is present in monomeric protein, and highly conserved, the interaction between usual mediating proteins and albumen.To anti-apoptotic proteins In the interaction protein screening process of BPE (BRCA complex subunit 4), KIAA0157 is screened to.This gene and albumen are Full cell distribution, and substantially lower expression in kinds of tumors tissue.High expressing K IAA0157 can suppress including hepatoma carcinoma cell lung Cancerous cell neuroblastoma cell growth, and lead to cell occur the G0/G1 phase block.

In the prior art, in order to improve the activity of albumen, for albumen avtive spot carry out specific mutation and Replace, thus finding the higher variant of activity is conventional way.In order to improve the biological activity of this albumen, applicant further By substantial amounts of experiment, carry out point mutation for site specific in KIAA0157 aminoacid sequence, thus obtaining ratio KIAA0157 albumen has the variant of higher inhibitory activity in itself.

Detailed Description Of The Invention

The present invention relates to the detached variant of Parent Protease, it corresponds to SEQ ID NO at least one:1 maturation is many The position I40H of peptide, H57Q, K85P, W94Q, Q110S, H113G, H141Y, N151A, S159P, L160P, K190I, Y213I, V220F、A222Y、R232P、V241Q、R260P、S267T、D276E、S286L、D298S、D303L、Y308K、P313K、 The position of Q316S, T319H, H322S, S328A, M331Q, R333R, G338A, P359I, G366F, S372I and P383L comprises Modify.Specifically, the variant of the present invention has the inhibitory activity of improvement.

Preferably, the protein variant of heat stability and inhibitory activity be applied to the method for the present invention, assuming improvement comprises At least 2 kinds arbitrary following modifications：I40H/A222Y、H57Q/V220F、K85P/H322S、W94Q/S328A、Q110S/H113G、 H141Y/P383L、N151A/G366F、L160P/P383L、K190I/D298S、K85P/R232P、V241Q/S286L、H57Q/ R260P、S286L/P383L、W94Q/D298S、Y213I/D303L、Q316S/S372I、Q110S/G338A.

The invention still further relates to the method producing the protein variant of the present invention, cultivate host cell including (a)；(b) reclaim Described protein variant.

In the production method of the present invention, it is being suitable for producing the nutrition training of described polypeptide using method well known in the art Cultured cells in foster base.For example, it is possible to by suitable culture medium and under conditions of permission expression and/or the described polypeptide of separation Small-scale in the shake-flask culture carrying out, and laboratory or industrial fermentation tank or large scale fermentation (include continuous, in batches, feed supplement In batches or solid fermentation) carry out cultured cells.Cultivated in suitable Nutrient medium using methods known in the art, institute State Nutrient medium and comprise carbon source and nitrogen source and inorganic salt.Suitable culture medium can obtain from commercial supplier or can basis Disclosed composition prepares (for example, in the catalogue of American type culture collection).If polypeptide is secreted into nutrition culture In base, this polypeptide directly can reclaim from described culture medium.If polypeptide is not secreted, it can be from cell lysate (lysate) reclaim.

Gained polypeptide can be reclaimed using methods known in the art.For example, polypeptide can be by conventional method from nutrition Reclaim in culture medium, described conventional method is including but not limited to centrifuged, filters, extracting, being spray-dried, evaporating or precipitation.

The polypeptide of the present invention can be by multiple methods known in the art purification, and methods described includes but is not limited to chromatograph (for example, ion exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoresis method (for example, preparative (preparative) isoelectrofocusing), differential solubility (for example, ammonium sulfate precipitation), SDS-PAGE or extract (see, e.g., Protein Purification, J.-C.Janson and Lars Ryden compiles, VCH Publishers, New York, and 1989).

The polypeptide of the present invention is used for preparing corresponding medicine, for treating cancer it is preferred that treating hepatocarcinoma.

Specific embodiment

Embodiment 1：The acquisition of KIAA0157 gene

Propose human bone marrow cell's total serum IgE, carry out reverse transcription by reverse transcription reagent box (Promega company) description.Take 1 μ g RNA after quantitation, the benefit that adds water to 10.5 μ l, 70 DEG C, 10min, add the 10 × buffer of 2 μ l, the MgCl2 of 2 μ l, 2 μ l DNTP, the oligo dT of 1 μ l, the rRNasin of 1 μ l, the AMV (15U) of 1.5 μ l, reaction system totally 20 μ l；42℃、1h；94℃、 5min；4℃、5min.RNA is reverse transcription is cDNA.With 5 '-CGGAATTCAATGTCCTACAG AGAGCAGGTT-3 '；5’- GGGGATCCTTAAATCTGGGAGG TCTGAGTG-3 ' expands purpose fragment for primer PCR.PCR condition is：

Cycle 1(1x)

94℃ 5min

Cycle 2(30x)

94℃ 1min

55℃ 30s

72℃ 1min

Cycle 3(1x)

72℃ 10min

PCR primer carries out 1% agarose gel electrophoresiies, and result produces special DNA band, by this DNA fragmentation and PMD- 18-T carrier (TAKARA biotech firm) connects, and connection product Transformed E .coli JM109, bacterium colony PCR are accredited as positive colony Afterwards, then it is sequenced after enzyme action identification.Sequence after sequencing is shown in sequence 1.

Embodiment 2：The preparation method of the KIAA0157 after corresponding mutation

1. the introducing of catastrophe point

(1) corresponding mutagenic primer is designed according to corresponding mutational site, using PCR fixed-point mutation method in KIAA0157 base Because the corresponding amino acid sites of upper wild type are mutated；

(2) above-mentioned PCR primer through glue reclaim after purification, carries out enzyme action with restricted enzyme, and through identical enzyme action After pPIC9k fragment connects, convert bacillus coli DH 5 alpha competent cell；

2. identify recombiant plasmid：With enzyme action, PCR method, recombiant plasmid is identified, and the inspection that is sequenced, thus dashed forward Nucleotide sequence after change.

Embodiment 3, KIAA0157 variant overexpression suppression cell colony are formed

Have an impact to study KIAA0157 variant cell proliferation, we construct KIAA0157 variant-myc/hisB+ Carrier for expression of eukaryon, and its propagation after KIAA0157 variant overexpression in HepG2 cell be have detected using Colony forming experiment Situation of change.Result is as follows：

Table 1 KIAA0157 variant overexpression suppresses cell colony formational situation

The expression of embodiment 4 KIAA0157 variant causes the HepG2 cell G0/G1 phase to block

For understanding the impact to HepG2 cell cycle for the KIAA0157 variant, our band GFP marks in HepG2 cell transfecting The carrier for expression of eukaryon of the KIAA0157 signing, the distribution of each phase of flow cytomery cell cycle.It is found through experiments, with Transfection KIAA0157 original protein is compared, and after the carrier for expression of eukaryon of transfection KIAA0157 variant, the G0/G1 phase in HepG2 cell The change of retardance, result is as follows：

The impact level that table 2 KIAA0157 variant blocked for the HepG2 cell G0/G1 phase

Sequence table

<110>Zhu Yupan

A kind of ＜ 120 ＞ human tumor inhibiting protein variant and its application

〈160〉1

〈210〉1

〈211〉416

〈212〉PRT

＜ 213 ＞ ethnic group (Homo Sapiens.)

〈400〉1

Met Ala Ala Ser Ile Ser Gly Tyr Thr Phe Ser Ala Val Cys Phe His 16

Ser Ala Asn Ser Asn Ala Asp His Glu Gly Phe Leu Leu Gly Glu Val 32

Arg Gln Glu Glu Thr Phe Ser Ile Ser Asp Ser Gln Ile Ser Asn Thr 48

Glu Phe Leu Gln Val Ile Glu Ile His Asn His Gln Pro Cys Ser Lys 64

Leu Phe Ser Phe Tyr Asp Tyr Ala Ser Lys Val Asn Glu Glu Ser Leu 80

Asp Arg Ile Leu Lys Asp Arg Arg Lys Lys Val Ile Gly Trp Tyr Arg 96

Phe Arg Arg Asn Thr Gln Gln Gln Met Ser Tyr Arg Glu Gln Val Leu 112

His Lys Gln Leu Thr Arg Ile Leu Gly Val Pro Asp Leu Val Phe Leu 128

Leu Phe Ser Phe Ile Ser Thr Ala Asn Asn Ser Thr His Ala Leu Glu 144

Tyr Val Leu Phe Arg Pro Asn Arg Arg Tyr Asn Gln Arg Ile Ser Leu 160

Ala Ile Pro Asn Leu Gly Asn Thr Ser Gln Gln Glu Tyr Lys Val Ser 176

Ser Val Pro Asn Thr Ser Gln Ser Tyr Ala Lys Val Ile Lys Glu His 192

Gly Thr Asp Phe Phe Asp Lys Asp Gly Val Met Lys Asp Ile Arg Ala 208

Ile Tyr Gln Val Tyr Asn Ala Leu Gln Glu Lys Val Gln Ala Val Cys 224

Ala Asp Val Glu Lys Ser Glu Arg Val Val Glu Ser Cys Gln Ala Glu 240

Val Asn Lys Leu Arg Arg Gln Ile Thr Gln Arg Lys Asn Glu Lys Glu 256

Gln Glu Arg Arg Leu Gln Gln Ala Val Leu Ser Arg Gln Met Pro Ser 272

Glu Ser Leu Asp Pro Ala Phe Ser Pro Arg Met Pro Ser Ser Gly Phe 288

Ala Ala Glu Gly Arg Ser Thr Leu Gly Asp Ala Glu Ala Ser Asp Pro 304

Pro Pro Pro Tyr Ser Asp Phe His Pro Asn Asn Gln Glu Ser Thr Leu 320

Ser His Ser Arg Met Glu Arg Ser Val Phe Met Pro Arg Pro Gln Ala 336

Val Gly Ser Ser Asn Tyr Ala Ser Thr Ser Ala Gly Leu Lys Tyr Pro 352

Gly Ser Gly Ala Asp Leu Pro Pro Pro Gln Arg Ala Ala Gly Asp Ser 368

Gly Glu Asp Ser Asp Asp Ser Asp Tyr Glu Asn Leu Ile Asp Pro Thr 384

Glu Pro Ser Asn Ser Glu Tyr Ser His Ser Lys Asp Ser Arg Pro Met 400

Ala His Pro Asp Glu Asp Pro Arg Asn Thr Gln Thr Ser Gln Ile 415

Claims (5)

1. a kind of human tumor inhibiting protein, its aminoacid sequence is SEQ ID NO：Shown in 1.

2. a kind of human tumor inhibiting protein variant is it is characterised in that in SEQ ID NO：On the basis of aminoacid shown in 1, Replaced accordingly on H57Q/V220F.

3. purposes in preparation suppression tumour medicine for the protein variant as claimed in claim 2.

4. purposes as claimed in claim 3 it is characterised in that：Tumor is hepatocarcinoma.

5. a kind of anti-tumor medicinal preparation, it contains protein described in claim 2 and pharmaceutically suitable carrier.