Cyclic annular tiny RNA library constructing method and its application
Technical field
The invention belongs to biotechnologies, specifically, the present invention relates to the method for cyclic annular tiny RNA library construction and its
Using.
Background technology
Tiny RNA includes several different types of non-coding RNAs:Micro rna (miRNA), short RNA interfering (siRNA), core
Benevolence tiny RNA (snoRNA) and cell small nuclear RNA (snRNA).In these endogenic tiny RNAs, miRNA in biogenesis and
All it is the most comprehensive of research in terms of functional mechanism.MiRNA is a kind of small RNA molecular for there was only 20-25 nucleotide, main logical
Cross the target site that is attached on mRNA and carry out post-transcriptional control, then according to the different guidances of complementarity make target mrna degradation or
Person checks the translation of said target mrna, plays an important role in genetic transcription, translation, cell growth and ontogenetic process.
In recent years, the means that tiny RNA is studied by high throughput sequencing technologies are more and more ripe, and form relevant
Library kit is built, most common is exactly the Truseq small RNA-seq kits of illumina companies, New England
Biolab (NEB) companySmall RNA Library Prep Set kits and Ion Prepare
Small RNA Libraries kits.The former two is all based on the technology that (SBS) is sequenced in synthesis, and third is to be based on
Semiconductor sequencing technologies.No matter which kind of sequencing technologies, need to build is all linear library, and library on chip again by expanding
Increase aggregation or be laid on chip after mutually being expanded by Water-In-Oil, carries out sequencing and the capture of sequence signal.Due to such text
The tectonic property in library, by the sample after amplification on chip distributing inhomogeneity, cause capture signal strength be also unevenly distributed
It is even, to sequencing mistake occur.
Based on joint probe be anchored connection sequencing technologies (combinatorial probe-anchor ligation,
CPAL high-flux sequence platform) is a kind of novel high-flux sequence platform, and the library that platform sequencing needs is a kind of band
The single stranded circle molecule for having joint sequence forms the linear DNA that winding folds by carrying out rolling-circle replication to this ring molecule
Nanosphere (DNA nanoball, DNB).The time of control rolling-circle replication can control the size of DNB, that is, identical multiple
The DNB sizes that time processed obtains are the same, the DNB of these same sizes are passed through gravity, so that it may to be allowed to uniform
It is laid on chip, the signal of the DNB obtained when being sequenced in this way is exactly uniform, to improve the accuracy rate of sequencing.
Currently based on the high-flux sequence platform of cPAL, there are no the construction methods in corresponding tiny RNA library, to solve this
One problem, the present invention develop a kind of tiny RNA there was only 18-30nt for length, are built into the library of single stranded circle, and
Enable the technology of this library cPAL methods sequencing.
In conclusion there is an urgent need in the art to develop can in efficient, comprehensive determination sample tiny RNA type method.
Invention content
The object of the present invention is to provide a kind of methods of tiny RNA type in efficient, comprehensive determination sample.
Another object of the present invention is to provide a kind of efficient preparation high quality, especially suitable for cPAL microarray datasets
The tiny RNA single stranded circle library of the method in tiny RNA single stranded circle library and the high quality prepared with this method.
In the first aspect of the present invention, a kind of construction method in single stranded circle tiny RNA library, including step are provided:
(a) the total serum IgE sample of separation is provided;
(b) purification process is carried out to the total serum IgE sample, to obtain the total serum IgE of purifying;
(c) in 3 ' 3 ' connectors of the end connection with bar code (barcode) of the total serum IgE of the purifying, to obtain
The total serum IgE of 3 ' 3 ' connectors of the end with bar code (barcode);
(d) 3 ' ends obtained in above-mentioned steps (c) are carried to the total serum IgE of 3 ' connectors of bar code (barcode),
It anneals in 3 ' joint areas with reverse transcription primer, to obtain annealed product;
(e) connection of 5 ' connectors is carried out to the annealed product that previous step (d) obtains, to described with 5 ' connectors
Annealed product;
(f) reverse transcription is carried out to the annealed product with 5 ' connectors obtained in previous step (e), to obtain two
CDNA of the end with connector;
(g) PCR amplification is carried out to the cDNA products obtained in previous step (f), to obtain DNA cloning product;
(h) it to the DNA cloning product obtained in previous step, is separated and recovered from polyacrylamide gel electrophoresis
The amplified production of 85-97bp (it is 18-30bp to correspond to Insert Fragment) tiny RNA, obtains the DNA fragmentation of purifying;
(i) purifying DNA fragment that will be obtained in previous step passes through " Avidin-biology with the magnetic bead for being marked with Avidin
Element " is combined, and alkaline solution is handled, and so that chain of not biotin labeling is separated from magnetic bead, then use
Acid solution is neutralized, to obtain the single stranded DNA solution that both ends carry joint sequence;
(j) in single stranded DNA solution of the both ends obtained in previous step with joint sequence, addition and both ends
The matched bridge-type DNA primer of joint sequence and ligase, carry out single-stranded cyclization, to obtain containing single-stranded cyclisation molecule
Mixture;
(k) to the mixture containing single-stranded cyclisation molecule described in previous step, fallen with specific linear nuclease digestion
Not cyclized single stranded DNA and bridge-type DNA primer;To obtain the mixture containing indigested single-stranded cyclisation product;
(l) mixture containing indigested single-stranded cyclisation product described in previous step purify it is quantitative, point
The cyclisation product is separated out, single stranded circle DNA library is sequenced to obtain tiny RNA.
In another preferred example, the tiny RNA amplified production that polyacrylamide gel electrophoresis is separated and recovered from step (h)
Length be 85-97bp (being 18-30bp corresponding to Insert Fragment).
In another preferred example, in step (c), described 3 ' connectors are equipped with for distinguish the bar shaped of different samples
Code area (barcode), and the anchoring Matching band that matches of anchor series with cPAL sequencings.
In another preferred example, 5 ' ends of the 3 ' connector are modified by adenylylation.
In another preferred example, the length of the bar code area is 10bp.
In another preferred example, the sequence of the bar code area is selected from the group:SEQ ID NO:1-8.
TGTCATAAAT(SEQ ID NO.:1),
TTAATTAAGG(SEQ ID NO.:2),
GACTCACTGA(SEQ ID NO.:3),
ATAAGGCAGT(SEQ ID NO.:4),
TTGATAGATT(SEQ ID NO.:5),
CCTTCCTGGT(SEQ ID NO.:6),
AATATCTCTC(SEQ ID NO.:7),
CATGTTTCCC(SEQ ID NO.:8)。
In another preferred example, 5 ' -3 ' sequences of entire 3 ' connector are such as following formula I structure:
Z1-Z2-Z3 (I)
In formula,
Z1 is GTCTCCAGTCGAAGCCCGATC (SEQ ID NO.:9);
Z2 is the bar code area that length is 8-12bp;Preferably SEQ ID NO.:In 1-8 it is any shown in bar code
Area;
Z3 is GAGCTTGTCT (SEQ ID NO.:10).
In another preferred example, in step (d), the reverse transcription primer carries the bar shaped exactly matched with 3 ' connectors
Code (barcode);
In another preferred example, in step (d), the connector includes one or more different bar code areas.
In another preferred example, 5 ' connectors described in step (e) are one section of RNA sequences:5’-
rUrCrCrUrArArGrArCrCrGrCrUrUrGrGrCrCrUrCrCrGrArCrUrU-3’(SEQ ID NO.:11), described
RNA sequence matches with the cPAL anchor series being sequenced, and special modification is not made at 5 ' ends and 3 ';
In another preferred example, in step (g), in the PCR amplification, downstream primer uses reverse transcription primer 5 '
AGACAAGCTCNNNNNNNNNNGATCGGGCTTCGACTGGAGAC-3’(SEQ ID NO.:12), sense primer use and 5 '
The identical DNA sequence dna of joint sequence (SEQ ID NO.:13/5 ' bio-TCCTAAGACCGCTTGGCCTCCGACTT-3 '), and
At 5 ' ends of sense primer, there are one biotin labelings.
In another preferred example, in step (h), the polyacrylamide concentration is 4-8%, preferably 5-
8%, more preferably 6-7%.
In another preferred example, the Ago-Gel a concentration of 4%.
In another preferred example, the polyacrylamide concentration is 6%.
In another preferred example, in step (i), the oligonucleotides for capture dna molecule is fixed on the magnetic bead
Sequence.
In another preferred example, the oligonucleotide sequence and the joint sequence are complementary.
In another preferred example, in step (i), the magnetic bead is interacted by biotin-streptomysin, described in capture
DNA molecular.
In another preferred example, in step (g), the primer pair includes:
Forward primer:(SEQ ID NO.:12:5’AGACAAGCTCNNNNNNNNNNGATCGGGCTTCGACTGGAGAC-
3 ') and
Reverse primer:/5-bio/(SEQ ID NO.:13/5-bio/TCCTAAGACCGCTTGGCCTCCGACTT-3’);
Wherein ,/5-bio/ indicates the biotin modification group at 5 ' ends.
In another preferred example, between in step (h) and (i), further include:With fluorescent dye to the DNA fragmentation of purifying into
Row assay, so that it is determined that the total amount of purifying DNA fragment.
In another preferred example, in step (i), the total amount of the DNA fragmentation for the step is not less than 200ng, preferably
Not less than 300ng, more preferably it is not less than 400ng.
In another preferred example, the magnetic bead of the Avidin described in step (i) is strepavidin magnetic beads.
In another preferred example, in step (j), the sequence of the bridge-type DNA primer is (SEQ ID NO.:14)5’-
GAGCTTGTCTTCCTAAGACCGC-3’。
In another preferred example, in step (k), the nuclease is excision enzyme.
In another preferred example, in step (k), the nuclease is specific cutting single-chain and double-stranded linear DNA
Excision enzyme.
In another preferred example, the excision enzyme includes the mixed enzyme of ENo I and ENo III.
In another preferred example, further include step after step (l):
(m) concentration standard processing is carried out to the tiny RNA sequencing single stranded circle library, to obtain predetermined concentration
The tiny RNA sequencing single stranded circle library of 7.5fmol/ul;
(n) rolling-circle replication formation is carried out to the tiny RNA of the predetermined concentration described in step (m) sequencing single stranded circle library to receive
Rice ball (DNA nanoball, DNB) is then anchored connection sequencing (combinatorial probe-anchor with joint probe
Ligation, cPAL) method is sequenced.
In another preferred example, in step (m), the predetermined concentration is single chain molecule about 6-9fmol/ul, preferably
It is about 7.5fmol/ul.
In another preferred example, the single stranded circle tiny RNA length described in step (n) is that 85-97nt (corresponds to 18-
The length of the Insert Fragment of 30nt).
In the second aspect of the present invention, the single stranded circle library being sequenced for tiny RNA, single stranded circle text are provided
Library is prepared with the construction method that the first aspect of the present invention provides.
In another preferred example, the tiny RNA single stranded circle library is micro rna (miRNA) single stranded circle library.
In another preferred example, the tiny RNA single stranded circle library is short RNA interfering (siRNA) single stranded circle text
Library.
In another preferred example, the tiny RNA single stranded circle library is cell small nuclear RNA (snRNA) single stranded circle text
Library.
In another preferred example, the tiny RNA single stranded circle library be include miRNA, siRNA, small nucleolar RNA
(snoRNA) and the single stranded circle library of (snRNA) or combinations thereof.
In another preferred example, the tiny RNA single stranded circle library has one or more features selected from the group below:
(1) DNA molecular of single stranded circle;
(2) size is 85-97bp;
(3) a concentration of about 6-9fmol/ul (being preferably about 7.5fmol/ul).
In the third aspect of the present invention, the tiny RNA sequencing single stranded circle library described in second aspect of the present invention is provided
Purposes, the purposes are used as the library of cPAL methods.
In another preferred example, the sequencing is sequenced for tiny RNA.
In another preferred example, tiny RNA sequencing includes total tiny RNA sequencing of organism.
In another preferred example, the organism includes people, animal or plant.
In another preferred example, the animal includes mouse.
In another preferred example, the plant includes rice.
In another preferred example, tiny RNA sequencing includes total tiny RNA sequencing of biological cell
In another preferred example, tiny RNA sequencing includes the total serum IgE sequencing of people's cell.
In another preferred example, the cell includes at least body cell, reproduction cell, embryonic cell, stem cell, tumour
Cell.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment)
It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist
This no longer tires out one by one states.
Description of the drawings
Fig. 1 shows single stranded circle tiny RNA library constructing method flow chart.
Fig. 2 shows 6% polyacrylamide gel electrophoresis (left side) and 4% agarose gel electrophoresis (right side).
Specific implementation mode
The present inventor's in-depth study by extensive by, develop for the first time it is a kind of it is efficient prepare high quality, can be used for it is small
The new technology of RNA single strand ring molecule library construction.The results show, with small constructed by banking process of the present invention
Single stranded circle library is sequenced in RNA, and Library Quality is very high, makes it to be used for cPAL principle microarray datasets, obtained data
Accuracy is high, confidence level is good, is not influenced on information analysis.The present invention is completed on this basis.
Specifically, the present inventor with by way of the annealing of the reverse transcription primers of 3 ' connector equal lengths, to be formed
Double-stranded DNA passes through the biotin labeling introduced when PCR, isolate single stranded DNA and by cyclisation form single stranded circle molecule,
The method of different sample mixing gel extractions is to provide the reaction that enough products carry out next step;Develop tiny RNA single-stranded loop
The construction method of shape molecular library makes it the platform being sequenced for cPAL principles.
Term
In the present invention, term " tiny RNA " refers to the different types of non-coding RNA including several small RNA moleculars:It is miniature
RNA (miRNA), short RNA interfering (siRNA), small nucleolar RNA (snoRNA) and cell small nuclear RNA (snRNA).18-30nt master
If miniature tiny RNA.
DNA bar code (DNA barcode)
DNA bar code (DNA barcode) is easy amplification, relatively short and with identity DNA fragmentation.
Using DNA bar code, it can be measured in once sequencing and come from multiple species, come from multiple individuals or come
From in the different samples of same individual, and based on respectively with the specific DNA bar code of carrying, directly the reading sequence of sequencing is carried out
Classification, in order to Macro or mass analysis.
CPAL microarray datasets
Joint probe anchor series connection method (combinatorial probe-anchor ligation, cPAL),
In terms of sequencing, the connection that fluorescence signal is read with single base is sequenced, but its independent probe library in fluorescence probe source, the probe
Library occurs connection with anchor series and reacts, and is corresponded to by fluorescence color and reads corresponding base information, utilizes DNA nanometers of ball arrays
Chip technology can use multiple average probes, and hybridization and connecting detection are carried out in conjunction with standard anchorage sequence and extension anchor series.
This multiple average probe is divided into two groups, and one group of 5 ' end for detection tabs site, the 3 ' of one group of detection tabs site holds.Every group
Have many types of, there are 4 kinds of average probes per type.Standard anchorage sequence directly with the 5 ' of connector or 3 ' end connect, subsequent average probe into
Row hybridization and connection.The anchor series of extension are formed by connecting by annexing with standard anchorage sequence.The probe of this combination is anchored sequence
Row connection method (combinatorial probe-anchor ligation, cPAL) makes sequence read length to be increased to by 5 bases
10 bases, then occupy-place is combined by a variety of 6 random base sequences, reading length can be made to increase to 28bp.
The method for building library
The present inventor is connect with by way of the annealing of the reverse transcription primer of 3 ' connector equal lengths with reducing excessive 3 '
The connection of head and 5 ' connectors passes through the biology introduced when PCR to form the double-stranded DNA of 3 ' connectors+Insert Fragment+5 ' connector
Element label, isolate single stranded DNA and by cyclisation form single stranded circle molecule, different samples mix gel extraction method with
Enough product progress rolling-circle replications are provided and are prepared into DNA nanospheres (DNA nanoball, DNB), are then sequenced with cPAL flat
Tiny RNA single stranded circle molecule is sequenced in platform, obtains the tiny RNA single stranded circle high-throughput, signal is uniform and accuracy rate is high point
Sublibrary.
Single stranded circle library
In the present invention, it additionally provides and is surveyed with the small RNA molecular that is suitable for prepared by the above-mentioned library constructing method of the present invention
The single stranded circle library of sequence.
In the preference of the present invention, the present inventor is by with the side with the annealing of the reverse transcription primers of 3 ' connector equal lengths
Formula forms double-stranded DNA, while excessive connector after adding 3 ' connectors being made to be absorbed by reverse transcription primer, greatly reduces excess
Connector identified and the probability that is connected on 5 ' connectors by T4RNA ligase 1 again, when carrying out PCR amplification this connector oneself
Amplified production also largely reduce, target segment contaminated probability when to effectively reduce gel extraction.In addition,
Different samples are selected, the method for repeatedly mixing gel extraction is carried out to provide enough product progress rolling-circle replications and is prepared into DNB,
Form the linear DNA nanosphere (DNB) that winding folds.The time of control rolling-circle replication can control the size of DNB, that is,
The DNB sizes that identical doubling time obtains are the same, and the DNB of these same sizes is passed through gravity, so that it may so that
To be uniformly laid on chip, the signal of the DNB obtained when being sequenced in this way is exactly uniform, to improve the accurate of sequencing
Rate.In addition, what is particularly worth mentioning is that, based on joint probe anchoring connection sequencing technologies (combinatorial probe-
Anchor ligation, cPAL) the library that needs of high-flux sequence platform be that a kind of single stranded circle with joint sequence divides
Son, the results show are accurate by the obtained sequencing data of cPAL sequencings using the tiny RNA single stranded circle library of the present invention
Degree is high.
The main advantages of the present invention be:
(1) construction method for single stranded circle library in tiny RNA sequencing has been invented for the first time.
(2) tiny RNA single stranded circle library of the invention can be used for cPAL microarray datasets.
(3) method provided by the invention has sequencing throughput high, accuracy height and easy to operate.
(4) method provided by the invention not only there is consumptive material to take less and stability, repeatability and the high spy of reliability
Point.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as Sambrook et al., molecular cloning:Laboratory manual (New York:Cold Spring Harbor Laboratory
Press, 1989) or molecular biology of plants-laboratory manual (Plant Molecular Biology-A Laboratory
Mannual, Melody S.Clark is compiled, Springer-verlag Berlin Heidelberg, 1997) condition described in,
Or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.
Material and method
1. the RNA standard items (UHRR and HBRR) of people's cell, mouse RNA and rice RNA
Experiment material used in the embodiment of the present invention can obtain unless otherwise specified from commercially available channel, wherein UHRR
Purchased from agilent company (Agilent), HBRR is purchased from Ambion companies, mouse RNA and rice RNA be respectively from mouse liver and
Nipponbare leaf tissue extracts.
The structure in 1 tiny RNA single stranded circle library of embodiment
Specific experiment step (see process step shown in Fig. 1):
1. the connection of the 3 ' connectors with bar code (barcode).3 ' the connector is section of DNA sequence, is sequenced with cPAL
Anchor series match, and with 10bp bar code (barcode) sequence, in order to distinguish different samples.3 '
There is adenylylation modification at 5 ' ends of connector, which can be under conditions of no atriphos (ATP) by T4RNA
Ligase 2truncated specific recognitions, are connected on the 3 ' hydroxyls of RNA, can be avoided in this way with 5 ' phosphoric acid
RNA occurs to connect certainly.Specifically reaction process is:1ug total serum IgEs are taken, the 3 ' connectors of 1ul 10uM are added, react 2 for 70 DEG C in PCR instrument
Minute, to open the secondary structure of sequence.Add reaction mixture:2N T4RNA ligase buffer5ul, RNase suppressions
Preparation (40U/ul) 0.5ul, T4RNA ligase 2truncated (200U/ul) 1ul, benefit are without RNA enzyme water to reaction volume
10ul.Wherein 2N T4 RNA ligase buffer include:100mMTris-HCl, 20mM MgCl2,2mM DTT, 25%
PEG8000, remaining reagent are no RNA enzyme water.After reaction mixture mixing, in PCR instrument, 25 DEG C are reacted 2 hours.
2. reverse transcription primer is added to anneal with 3 ' connectors, to prevent excessive 3 ' connector in reaction in next step with 5 '
Connector connects.Since 3 ' connectors are with bar code (barcode), the reverse transcription primer being added must be with 3 ' connectors
It exactly matches, also to carry bar code (barcode), the two annealing in this way forms double-strand, and excessive 3 ' connector cannot be by RNA
Ligase is identified and is connected on 5 ' connectors, reduces connector from the formation connected.Specifically reaction process is:Take 0.5ul 100uM
The reverse transcription primer with bar code (barcode) add mixing in the connection reaction solutions of 3 ' connectors, be put into PCR instrument
Reaction, response procedures are:75 DEG C of 5min, 37 DEG C of 30min, 25 DEG C of 15min.
The connection of 3.5 ' connectors.5 ' connectors are one section of RNA sequence, anchor series phase of the sequence equally with cPAL sequencings
Match, special modification is not made at 5 ' ends and 3 ' ends, so both ends are all hydroxyls.In the presence of ATP, T4RNA ligase 1 are used
5 ' the phosphate groups of RNA and 3 ' hydroxyls of 5 ' connectors can be linked together.Connecting reaction condition is:1ul 10uM 5 ' are taken to connect
Head reacts 2 minutes for 70 DEG C in PCR instrument, to open the secondary structure of sequence.After cooled on ice 2 minutes, it is added into step 2
In reaction product, enzyme reaction mixed liquor is then added:10mM ATP 1ul, RNase inhibitor (40U/ul) 1ul, T4RNA
ligase 1(10U/ul)1ul.After mixing in PCR instrument 20 DEG C react 1 hour.
4. cDNA of the reverse transcription synthesis both ends with connector simultaneously carries out PCR amplification.Due to being had been added in step 2
Reverse transcription primer, therefore the enzyme reaction mixture for being directly added into reverse transcription is reacted:5N the first chain buffer solution 5ul,
0.1M DTT 0.5ul, 10mM dNTP 0.5ul, RNase inhibitor (40U/ul) 0.5ul, superscript II (200U/
ul)0.5ul.Response procedures are:42 DEG C of 30min, 70 DEG C of 15min, 12 DEG C of heat preservations.Need to carry out PCR amplification after reverse transcription with richness
Single cDNA template of the collection with joint sequence, downstream primer uses reverse transcription primer when amplification, sense primer and 5 ' connectors
Sequence is identical, but is DNA sequence dna, and there are one biotin labelings at 5 ' ends of sense primer, in order to subsequent single-stranded
Separation reaction.PCR reaction systems are:
cDNA |
10ul |
Sense primer |
1ul |
10N pfN buffer solutions |
2ul |
50mM magnesium sulfate |
0.4ul |
10mM dNTP |
0.6ul |
pfN |
0.4ul |
Water |
4.6ul |
total |
20ul |
Response procedures are:
5.6% polyacrylamide gel electrophoresis is separated and recovered from the small RNA fragments of corresponding position.Due to the enzyme reaction of front
Process both for total serum IgE, need to survey prodigious data volume just if sequencing of all taking them away can obtain it is enough
Tiny RNA information.Therefore the PCR product that tiny RNA is enriched with by electrophoresis recovery purifying is needed.This product can be poly- by 6%
Acrylamide gel electrophoresis or 4% Ago-Gel are recycled, but the organic efficiency of the latter is not so good as the former, therefore we
6% polyacrylamide gel electrophoresis is selected.The Yield comparison of one sample recycling is low, cannot meet subsequent experiment starting
Amount so we mix 8 PCR products with different bar codes (barcode) sample, then carries out electrophoresis recycling
Purifying, not only saves the time for cutting glue, and also reduce the cost of supplies consumption in this way.Select 8 kinds of bar codes
(barcode) it is mixed, is to make the sequencing library in 1 channel reach base balance in sequencing.Specific content
For:The sample of 8 kinds of difference barcode is mixed about 160ul, adds 32ul6 × loading buffer, point 6 wells
It is loaded to 6% polyacrylamide gel;It is another that 2ul 20bp DNA ladder marker is taken to be loaded onto an intermediate hole.180V electrophoresis
About 25 minutes, bromophenol blue was gone to away from lower edge about 1/5, you can stops electrophoresis.Contaminate glue 4-5 minutes.It takes pictures, sees Fig. 2.It cuts about
The master tape blob of viscose cut is placed in the centrifuge tube (being sleeved on 2ml centrifuge tubes) that 0.5ml has pricked hole by the band of 80-100bp,
13600rpm is centrifuged 2 minutes, so that blob of viscose is passed through aperture and is extruded into broken glue.400ul 0.3MNaCl are added in broken glue, mix at room temperature
Even device overturns mixing 2 hours, eluted dna.Broken glue and buffer solution are transferred to Spin-N filter, 13600rpm is centrifuged 2 minutes.
The glycogen that addition 2ul melts completely into eluent, 40ul 3M NaAC (effluent volume of volume=1/10 times of NaAC),
100% ethyl alcohol of 1000ul (ethyl alcohol volume is calculated according to the volume of eluent).It is placed 30 minutes or longer for -80 DEG C after mixing, with
Organic efficiency is improved, 4 DEG C of 13600rpm are centrifuged 30 minutes.White precipitate can be seen after centrifugation, abandon supernatant, then use 1000ul
70% or 75% ethyl alcohol washing precipitation, dries, and dissolves white precipitate with 30ul elution solution.It is dense that fluorescent dye quantitatively detects DNA
Degree takes total amount to be not less than 200ng, carries out subsequent single-stranded separation and cyclization process.
6. the product that step 5 recycles isolates a single stranded DNA, and carries out bridge-type cyclisation, quantitative after purification, you can use
It is sequenced in cPAL.During PCR, biotin labeling is introduced by 5 ' ends of the primer on a chain of PCR product, this
Then label can destroy the hydrogen bond of DNA double interchain with aqueous slkali, make no biotin mark in stable bond to strepavidin magnetic beads
That chain of note is separated from magnetic bead, then is neutralized with acid solution, and the single stranded DNA that both ends carry joint sequence is just obtained
Solution.One section and the matched bridge-type DNA primer of both ends joint sequence and ligase etc. are added into this single stranded DNA solution,
Single stranded DNA is set to form a ring molecule.Finally not cyclized single stranded DNA is digested with linear excision enzyme and bridge-type DNA draws
Object simultaneously purifies quantitative to get to the tiny RNA single stranded circle DNA library that can be used for cPAL sequencings.Specifically content is:By step 5
The PCR product moisturizing of acquisition to volume is 60ul, and 20ul 4NBBB (magnetic bead combination buffer) are added, use is added into after mixing
The strepavidin magnetic beads that 1NBBB suspends detach magnetic bead after 15 minutes on magnetic separator, discard supernatant, then with BWB (magnetic beads
Cleaning buffer solution) clean magnetic bead twice, after magnetic bead is detached on magnetic separator and blots BWB, magnetic is resuspended with 26ul 0.1M NaOH
Pearl after reacting 15 minutes, detaches magnetic bead, draws in supernatant to a new centrifuge tube, add 13ul 0.3M on magnetic separator
Propane sulfonic acid in and aqueous slkali to get to single strand dna.The bridge-type DNA primer of 2.5ul is added into single strand dna,
6ul 10NTA buffer, 0.6ul 100mM ATP and 0.4ul DNA ligase (600U/ul) mend total volume extremely with water
60ul reacts 1.5 hours for 37 DEG C after mixing.Excision enzyme digestion mixture is added after reaction:1ul 10NTA buffer,
2.1ul excision enzymes I (20U/ul) and 1.4ul exonucleaseⅢs (100U/ul).It reacts 30 minutes for 37 DEG C, adds after mixing
2.5ul 500mM EDTA terminate reaction.Reaction product moisturizing 40ul adds 10ul NaAc, 2ul glycogens, the anhydrous second of 300ul
Alcohol, -80 DEG C of precipitations 30 minutes or more after mixing, 4 DEG C of 13600rpm are centrifuged 30 minutes, abandon supernatant, then with 75% ethyl alcohol of 600ul
Washing precipitation, after centrifugation discards ethyl alcohol, with 27ul dissolving buffer solution precipitations after drying at room temperature.The solution finally obtained is i.e.
For the tiny RNA library of single stranded circle.
7. concentration standard
The sample initial amount used is prepared according to the concentration adjustment DNB of single chain molecule quantitative determination to be uniformly adjusted to
7.5fmol/ul。
8. machine is sequenced on library.Sequencing uses cPAL microarray datasets.
As a result
To the tiny RNA single stranded circle library prepared in step 1-7, using cPAL microarray datasets (model BlackBird)
It is sequenced.
To data caused by sequencing, the program Teramap carried with cPAL microarray datasets carries out information analysis, mainly with
Lower step:
(1) sequencing sequence is filtered;
Filtering unqualified sequence includes:The uncertain base of sequencing result (such as cPAL microarray datasets sequencing result in sequence
In N) number is more than 10% of whole series number and is considered unqualified sequence;In addition to sample joint sequence, with it
It tests the exogenous array introduced and compares, such as various terminal sequence.If in sequence there are exogenous array if be considered unqualified sequence
Row.The sequence data that original sequence data obtains after removing unqualified series processing we be known as clean sequence fragment
(clean reads), the basis as subsequent analysis.
(2) clean sequence fragment is compared with reference sequences;
The clean sequence fragment that high throughput sequencing technologies obtain is compared respectively and arrives reference gene group and reference gene sequence
On row.Reference gene group sequence and reference gene sequence can be taken at public database GeneBank and miRBase.
Embodiment 2 identifies the repeatability and stability of the construction method in tiny RNA single stranded circle library
The preparation process 1-8 for repeating 1 Chinese library of embodiment, the difference lies in that using the RNA standard items of two kinds of people's cells
(UHRR and HBRR), mouse RNA and rice RNA totally 4 kinds of samples, the source as total serum IgE.Each sample uses total serum IgE
1ug is originated, and first adds 3 ' connectors, 16 samples are separately connected the 3 ' connectors with different bar codes (barcode), with corresponding band
There is the reverse transcription primer of bar code (barcode) to anneal to close excessive 3 ' connector, reconnects 5 ' connectors and reversion
Record and PCR amplification.
After the completion of PCR reactions, 16 samples are divided into two groups, every group of each 8 sample is (comprising 4 kinds of different RNA samples, often
Each repetition of kind), then two groups are mixed respectively, it is recycled respectively with 6% acrylamide gel and 4% agarose gel electrophoresis
(Fig. 2).Quantitative (table 1) with fluorescent dye after recycling, the former recycling yield is higher than the latter, obtains 390ng DNA, all uses
Subsequent single-stranded separating step is carried out, obtains the single stranded circle library of about 34ng.And Ago-Gel recycling PCR product compared with
It is few, inadequate subsequent experimental, so not continuing.
The single stranded circle library of acquisition is carried out rolling-circle replication and is prepared into DNB, is then sequenced, is obtained with cPAL modes
About 290M reads, average length 28bp, filtering out pollution and connector, there are about 80% clean sequence fragment from after connecting
(clean reads), connector below 2% (table 2) from continued proportion.As a result as shown in Fig. 2, Tables 1 and 2.
Table 1
Table 2
Sample name |
Total reads numbers |
Reads numbers after filtering |
Connector connects number certainly |
Connector is from continued proportion |
All |
291080193 |
232764154 |
3314488 |
1.14% |
UHRR |
35248461 |
28168769 |
622612 |
1.77% |
UHRR |
36087532 |
28670026 |
355512 |
0.99% |
HBRR |
37059530 |
29747624 |
417809 |
1.13% |
HBRR |
36878800 |
29703040 |
324104 |
0.88% |
Mouse |
32678723 |
26182978 |
558211 |
1.71% |
Mouse |
39329268 |
31453414 |
326436 |
0.83% |
Rice |
38900191 |
31130153 |
362346 |
0.93% |
Rice |
34897688 |
27818150 |
347458 |
1.00% |
Identification and sequencing to prepared single stranded circle library the result shows that:
(a) the library repeatability and stability prepared with the present embodiment 1 and 2 method works is high;
(b) obtained data are sequenced has high-throughput and high accuracy.
Comparative example 1
Embodiment 1 is repeated, difference is:It anneals that RT primer are not added after adding 3 ' connectors when building library, directly adds
5 ' connectors.
Sequencing result is as shown in table 3.The result shows that data center tap is very high from the ratio connected, it is about 55% or more, this
Serious waste data.
Sample name |
Total reads numbers |
Reads numbers after filtering |
Connector connects number certainly |
Connector is from continued proportion |
All |
345821023 |
325071762 |
205697807 |
63.28% |
UHRR1 |
110780011 |
104133210 |
72749778 |
69.86% |
UHRR2 |
98984241 |
93045187 |
60746735 |
65.29% |
HBRR1 |
60965348 |
57307427 |
33183607 |
57.90% |
HBRR2 |
75091423 |
70585938 |
39017687 |
55.28% |
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To be made various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.