CN105601726A - Application of Oct4 (octamer-binding transcription factor 4) in regulating IL-31 gene expression - Google Patents
Application of Oct4 (octamer-binding transcription factor 4) in regulating IL-31 gene expression Download PDFInfo
- Publication number
- CN105601726A CN105601726A CN201610076404.8A CN201610076404A CN105601726A CN 105601726 A CN105601726 A CN 105601726A CN 201610076404 A CN201610076404 A CN 201610076404A CN 105601726 A CN105601726 A CN 105601726A
- Authority
- CN
- China
- Prior art keywords
- oct4
- gene
- application
- gene expression
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 101710181613 Interleukin-31 Proteins 0.000 title claims abstract description 66
- 102100021596 Interleukin-31 Human genes 0.000 title claims abstract description 51
- 230000014509 gene expression Effects 0.000 title claims abstract description 26
- 230000001105 regulatory effect Effects 0.000 title abstract description 6
- 230000027455 binding Effects 0.000 title abstract description 3
- 102000009523 Transcription Factor 4 Human genes 0.000 title abstract 2
- 108010048992 Transcription Factor 4 Proteins 0.000 title abstract 2
- 230000033228 biological regulation Effects 0.000 claims description 15
- 239000002773 nucleotide Substances 0.000 claims description 9
- 125000003729 nucleotide group Chemical group 0.000 claims description 9
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 5
- 239000003814 drug Substances 0.000 claims description 4
- 230000004913 activation Effects 0.000 claims description 2
- 230000002068 genetic effect Effects 0.000 claims description 2
- 239000005089 Luciferase Substances 0.000 abstract description 16
- 238000000034 method Methods 0.000 abstract description 10
- 108090000623 proteins and genes Proteins 0.000 abstract description 8
- 210000002901 mesenchymal stem cell Anatomy 0.000 abstract description 4
- 201000010099 disease Diseases 0.000 abstract description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 3
- 230000008844 regulatory mechanism Effects 0.000 abstract description 3
- 238000011160 research Methods 0.000 abstract description 2
- 238000013518 transcription Methods 0.000 abstract description 2
- 230000035897 transcription Effects 0.000 abstract description 2
- 201000004624 Dermatitis Diseases 0.000 abstract 1
- 108010002386 Interleukin-3 Proteins 0.000 abstract 1
- 238000000975 co-precipitation Methods 0.000 abstract 1
- 238000001514 detection method Methods 0.000 abstract 1
- 101710126211 POU domain, class 5, transcription factor 1 Proteins 0.000 description 48
- 102100035423 POU domain, class 5, transcription factor 1 Human genes 0.000 description 42
- 239000013612 plasmid Substances 0.000 description 21
- 210000004027 cell Anatomy 0.000 description 18
- 108020004414 DNA Proteins 0.000 description 17
- 241000700605 Viruses Species 0.000 description 12
- 238000001890 transfection Methods 0.000 description 12
- 230000029087 digestion Effects 0.000 description 11
- 239000012634 fragment Substances 0.000 description 8
- 210000004271 bone marrow stromal cell Anatomy 0.000 description 6
- 238000006243 chemical reaction Methods 0.000 description 6
- 230000000694 effects Effects 0.000 description 6
- 108010077544 Chromatin Proteins 0.000 description 5
- 102100031780 Endonuclease Human genes 0.000 description 5
- 108010042407 Endonucleases Proteins 0.000 description 5
- 238000012408 PCR amplification Methods 0.000 description 5
- 210000003483 chromatin Anatomy 0.000 description 5
- 108090000331 Firefly luciferases Proteins 0.000 description 4
- 102000002584 Octamer Transcription Factor-3 Human genes 0.000 description 4
- 108010068425 Octamer Transcription Factor-3 Proteins 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000013467 fragmentation Methods 0.000 description 4
- 238000006062 fragmentation reaction Methods 0.000 description 4
- 239000000499 gel Substances 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 239000000047 product Substances 0.000 description 4
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 3
- 102000012410 DNA Ligases Human genes 0.000 description 3
- 108010061982 DNA Ligases Proteins 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 3
- 241000620209 Escherichia coli DH5[alpha] Species 0.000 description 3
- WSFSSNUMVMOOMR-UHFFFAOYSA-N Formaldehyde Chemical compound O=C WSFSSNUMVMOOMR-UHFFFAOYSA-N 0.000 description 3
- 101710120037 Toxin CcdB Proteins 0.000 description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 239000011324 bead Substances 0.000 description 3
- 238000000749 co-immunoprecipitation Methods 0.000 description 3
- 239000002299 complementary DNA Substances 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 230000004069 differentiation Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 239000007788 liquid Substances 0.000 description 3
- 239000006166 lysate Substances 0.000 description 3
- 238000012797 qualification Methods 0.000 description 3
- 108091008146 restriction endonucleases Proteins 0.000 description 3
- 238000010839 reverse transcription Methods 0.000 description 3
- 238000003757 reverse transcription PCR Methods 0.000 description 3
- 238000011144 upstream manufacturing Methods 0.000 description 3
- 238000001712 DNA sequencing Methods 0.000 description 2
- DHMQDGOQFOQNFH-UHFFFAOYSA-N Glycine Chemical compound NCC(O)=O DHMQDGOQFOQNFH-UHFFFAOYSA-N 0.000 description 2
- 108010052090 Renilla Luciferases Proteins 0.000 description 2
- 101150086694 SLC22A3 gene Proteins 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 210000002469 basement membrane Anatomy 0.000 description 2
- 230000015556 catabolic process Effects 0.000 description 2
- 230000006037 cell lysis Effects 0.000 description 2
- 238000006731 degradation reaction Methods 0.000 description 2
- 210000001671 embryonic stem cell Anatomy 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 210000002919 epithelial cell Anatomy 0.000 description 2
- 238000009413 insulation Methods 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 229920001184 polypeptide Polymers 0.000 description 2
- 238000001556 precipitation Methods 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 102000004196 processed proteins & peptides Human genes 0.000 description 2
- 108090000765 processed proteins & peptides Proteins 0.000 description 2
- 238000012545 processing Methods 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 238000011084 recovery Methods 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 230000009870 specific binding Effects 0.000 description 2
- 210000000130 stem cell Anatomy 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 210000003954 umbilical cord Anatomy 0.000 description 2
- 102000010400 1-phosphatidylinositol-3-kinase activity proteins Human genes 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- KDXKERNSBIXSRK-RXMQYKEDSA-N D-lysine Chemical compound NCCCC[C@@H](N)C(O)=O KDXKERNSBIXSRK-RXMQYKEDSA-N 0.000 description 1
- 108010009540 DNA (Cytosine-5-)-Methyltransferase 1 Proteins 0.000 description 1
- 102100036279 DNA (cytosine-5)-methyltransferase 1 Human genes 0.000 description 1
- 230000004568 DNA-binding Effects 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 239000004471 Glycine Substances 0.000 description 1
- 229920000209 Hexadimethrine bromide Polymers 0.000 description 1
- 101000994365 Homo sapiens Integrin alpha-6 Proteins 0.000 description 1
- 101000615505 Homo sapiens Methyl-CpG-binding domain protein 6 Proteins 0.000 description 1
- 101000586302 Homo sapiens Oncostatin-M-specific receptor subunit beta Proteins 0.000 description 1
- 102100032816 Integrin alpha-6 Human genes 0.000 description 1
- 102100021594 Interleukin-31 receptor subunit alpha Human genes 0.000 description 1
- 101710131691 Interleukin-31 receptor subunit alpha Proteins 0.000 description 1
- 102000004889 Interleukin-6 Human genes 0.000 description 1
- 108090001005 Interleukin-6 Proteins 0.000 description 1
- 102000015696 Interleukins Human genes 0.000 description 1
- 108010063738 Interleukins Proteins 0.000 description 1
- 241000713666 Lentivirus Species 0.000 description 1
- 108060001084 Luciferase Proteins 0.000 description 1
- 102000043136 MAP kinase family Human genes 0.000 description 1
- 108091054455 MAP kinase family Proteins 0.000 description 1
- 102100021281 Methyl-CpG-binding domain protein 6 Human genes 0.000 description 1
- 102100030098 Oncostatin-M-specific receptor subunit beta Human genes 0.000 description 1
- 108091007960 PI3Ks Proteins 0.000 description 1
- 102000042835 POU transcription factor family Human genes 0.000 description 1
- 108091082602 POU transcription factor family Proteins 0.000 description 1
- 108091005804 Peptidases Proteins 0.000 description 1
- 239000004365 Protease Substances 0.000 description 1
- 102000001708 Protein Isoforms Human genes 0.000 description 1
- 108010029485 Protein Isoforms Proteins 0.000 description 1
- 101100247004 Rattus norvegicus Qsox1 gene Proteins 0.000 description 1
- 102100037486 Reverse transcriptase/ribonuclease H Human genes 0.000 description 1
- 108091027967 Small hairpin RNA Proteins 0.000 description 1
- 210000004241 Th2 cell Anatomy 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 210000000577 adipose tissue Anatomy 0.000 description 1
- 210000004504 adult stem cell Anatomy 0.000 description 1
- 125000000539 amino acid group Chemical group 0.000 description 1
- 150000001413 amino acids Chemical class 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 238000003149 assay kit Methods 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 239000012148 binding buffer Substances 0.000 description 1
- 230000008827 biological function Effects 0.000 description 1
- 210000000621 bronchi Anatomy 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 230000024245 cell differentiation Effects 0.000 description 1
- 230000010261 cell growth Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 239000012141 concentrate Substances 0.000 description 1
- 230000001276 controlling effect Effects 0.000 description 1
- 238000004132 cross linking Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 235000019441 ethanol Nutrition 0.000 description 1
- 125000005909 ethyl alcohol group Chemical group 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 235000011389 fruit/vegetable juice Nutrition 0.000 description 1
- 230000006870 function Effects 0.000 description 1
- 230000004927 fusion Effects 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 210000001368 germline stem cell Anatomy 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 238000010438 heat treatment Methods 0.000 description 1
- 239000003112 inhibitor Substances 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 210000004698 lymphocyte Anatomy 0.000 description 1
- 230000002101 lytic effect Effects 0.000 description 1
- 210000001161 mammalian embryo Anatomy 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 238000012856 packing Methods 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 239000002574 poison Substances 0.000 description 1
- 231100000614 poison Toxicity 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000012679 serum free medium Substances 0.000 description 1
- 239000002356 single layer Substances 0.000 description 1
- 210000003491 skin Anatomy 0.000 description 1
- 239000004055 small Interfering RNA Substances 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
- 239000011800 void material Substances 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of an Oct4 (octamer-binding transcription factor 4) in regulating IL-31 gene expression. The application is based on the achievement that the inventor detects the Oct4 can combine and activate the new target gene IL-3 in mesenchymal stem cells for the first time. A method of immune coprecipitation and double-luciferase report gene system detection is utilized to prove that the Oct4 can specifically combine the promoter of the IL-31 gene in the mesenchymal stem cells and can activate the transcription of the IL-31 gene. Therefore, the research results can provide theoretical bases for researching the expression regulation mechanism of the Oct4 for the new target gene IL-31, and can lay necessary foundations for application of the Oct4 and IL-31 in treatment of dermatitis and other diseases.
Description
Technical field
The present invention relates to molecular biology and genetic engineering field, be specifically related to Oct4 at regulation and control IL-31 geneApplication in expression.
Background technology
Interleukin Ⅲ 1 (Interleukin31, IL-31) is having of being equaled to find for 2004 by DillonThe polypeptide chain cell factor of 4 helical structures, ranges interleukin-6 cytokine family, mainly by livingThe CD changing4+Th2 cell produces. People's IL-31 gene is positioned at 12q24.31, contains 904bp, open readdingFrame is 495bp, the polypeptide chain being made up of 164 amino acid residues of encoding, ripe IL-31 albumenMatter contains 141 amino acid. IL-31 by with the allos two of two subunits compositions of IL-31RA and OSMR βThe combination of aggressiveness compound, thus activate JAK-STAT, MAPK, PI3K/AKT tri-signal paths, send outWave biological function. The acceptor of IL-31 is mainly distributed in epithelial cell, lymphocyte, bronchus and skin etc.In tissue, so mainly concentrate on the effect of IL-31 in scytitis reaction about the research of IL-31 at present.
Oct4 is called again Oct3 or Oct3/4, belongs to the member in POU transcription factor family, by Pou5f1Gene code is mainly expressed in embryonic stem cell and germline stem cell, maintains the oneself of embryonic stem cell moreNew and many differentiation potentials. People Oct4 gene is positioned on No. 6 chromosome (6p21.31), contains 16.4kb.Oct4 has different hypotype (Isoforms), and wherein Isoform1 is the Oct4 hypotype with function, toolThere are 5 extrons, 4 intrones, the protein of translation contains a conservative DNA binding structural domain (POUIn conjunction with territory), can with containing octamer motif (Octamermotif) thus DNA be combined downstream target baseTranscribing of cause. That studies about the target gene of Oct4 at present is many, and great majority are that many differentiation potentials are relevantGene, as: Nanog and Sox2 etc. In the process of Cell Differentiation, the expression of Oct4 is lowered gradually, completeIn the cell of full differentiation, substantially can't detect the expression of Oct4, but a lot of adult stem cells of recent findings are also shownReach Oct4. Mescenchymal stem cell (Mesenchymalstemcells, MSCs) is one in adult stem cellKind, derive from Various Tissues, as: marrow, umbilical cord and adipose tissue etc. Recently a lot of article report Oct4Also can promote self and the multi-lineage potential of MSCs, but its molecular regulation mechanism is not clear at present.In MSCs, Oct4 can its target gene of direct regulation and control MBD6, Dnmt1 and the expression of CD49f etc., fromAnd self and the multi-lineage potential of promotion MSCs. But whether Oct4 is to IL-31, gene expression plays tuneControl effect is not clear at present.
Summary of the invention
The shortcoming that the object of the invention is to overcome prior art, with not enough, provides Oct4 at regulation and control IL-31 baseBecause of the application in expressing.
Object of the present invention is achieved through the following technical solutions: Oct4 answering in regulation and control IL-31 gene expressionWith, the proposition of this technical scheme is to find based on inventor that first transcription factor Oct4 is in MSCsIL-31 is expressed and has regulating action.
The nucleotide sequence of described IL-31 gene is as follows:
ATGGCCTCTCACTCAGGCCCCTCGACGTCTGTGCTCTTTCTGTTCTGCTGCCTGGGAGGCTGGCTGGCCTCCCACACGTTGCCCGTCCGTTTACTACGACCAAGTGATGATGTACAGAAAATAGTCGAGGAATTACAGTCCCTCTCGAAGATGCTTTTGAAAGATGTGGAGGAAGAGAAGGGCGTGCTCGTGTCCCAGAATTACACGCTGCCGTGTCTCAGCCCTGACGCCCAGCCGCCAAACAACATCCACAGCCCAGCCATCCGGGCATATCTCAAGACAATCAGACAGCTAGACAACAAATCTGTTATTGATGAGATCATAGAGCACCTCGACAAACTCATATTTCAAGATGCACCAGAAACAAACATTTCTGTGCCAACAGACACCCATGAATGTAAACGCTTCATCCTGACTATTTCTCAACAGTTTTCAGAGTGCATGGACCTCGCACTAAAATCATTGACCTCTGGAGCCCAACAGGCCACCACTTAA。
The application of described Oct4 in regulation and control IL-31 gene expression, be Oct4 albumen can with IL-31 baseThe promoter specific binding of cause, and can activate transcribing of IL-31 gene.
Describedly be just regulated to.
Thereby the application of described Oct4 in regulation and control IL-31 gene expression, is by Oct4 albumen or energyThe nucleotide sequence of expressing Oct4 is prepared into the medicine of activation IL-31 genetic transcription.
The application of described Oct4 in regulation and control IL-31 gene expression is by Oct4 albumen or can expressThe nucleotide sequence of Oct4 is prepared into the medicine for the treatment of scytitis.
Described nucleotide sequence is DNA sequence dna.
The present invention has following advantage and effect with respect to prior art: the present invention is that the present invention finds firstTranscription factor Oct4 expresses and has regulating action to propose its new target gene IL-31 in MSCs. ThisBright employing chromatin co-immunoprecipitation and dual-luciferase reporter system method have proved to turn in MSCsRecord factor Oct4 can with the promoter specific binding of IL-31 gene, and can activate IL-31 geneTranscribe. The present invention has disclosed the regulatory mechanism that transcription factor Oct4 expresses its new target gene IL-31, and isOct4 and IL-31 are applied in the treatment of the diseases such as scytitis and establish necessary basis.
Brief description of the drawings
Fig. 1 infects the slow virus that contains Oct4, shOct4 and empty plasmid respectively in the embodiment of the present invention 1After UC-MSCs, adopt RT-PCR method to confirm the result figure that IL-31 expresses.
Fig. 2 adopts CHIP (chromatin co-immunoprecipitation) method to confirm in difference in the embodiment of the present invention 2In the UC-MSCs of algebraically, the result figure that Oct4 is combined with the promoter DNA of IL-31 gene; Wherein,* P < 0.01 is with respect to control antibodies separately; P3, P6, P9 represent respectively UC-MSCs subculture extremelyThe 3rd generation, the 6th generation, the 9th generation.
Fig. 3 adopts dual-luciferase reporter system to detect Oct4 to exist in the embodiment of the present invention 3Result figure to the effect of IL-31 gene expression regulation in UC-MSCs; Wherein, * P < 0.01 is with respect to separatelyThe contrast of empty plasmid.
Detailed description of the invention
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but be not used for limiting thisBright scope. If do not particularly point out, embodiment is all with reference to normal experiment condition, or reference reagent box is manufacturedThe description of manufacturer carries out. In embodiment, engineering bacteria used, cell line are business-like bacterial strain or thinBorn of the same parents' strain. The preparation of competent escherichia coli cell is prepared according to " molecular cloning ".
Embodiment 1 adopts RT-PCR method to confirm the impact of transcription factor Oct4 on IL-31 gene expression.
(1) structure of Oct4 and shOct4 Lentiviral.
1) design of Oct4 gene primer.
With the primer of Primer5.0 Software for Design amplification Oct4 gene ORFs, primer two ends enzyme is cut positionPoint is respectively Xho I and Nco I, and primer is synthetic by the Shanghai biological Co., Ltd of raw work, and the sequence of primer is as follows:
Oct4 forward primer: 5 '-CCGCTCGAGAGGATGGCGGGACACCTGGCTT-3 '
Oct4 reverse primer: 5 '-CATGCCATGGAAGGGCAGGCACCTCAGTTTG-3 '.
2) amplification Oct4 gene.
Taking the cDNA (purchased from Shanghai Si Dansai Bioisystech Co., Ltd) of human embryo stem cell as template amplificationOct4 gene.
The reaction system of pcr amplification is as follows:
The reaction condition of pcr amplification is as follows:
3) recovery of Oct4 gene.
Above-mentioned PCR product is carried out to 1% agarose gel electrophoresis, and with GelExtractionKit (Omega)PCR product is reclaimed, and experimental procedure is slightly changed kit description, and step is as follows:
A, cut the agarose gel that contains target DNA fragment with knife blade, excise DNA fragmentation as far as possibleAround unnecessary agarose gel is to reduce gel volume.
B, gel piece is placed in to 1.5ml microcentrifugal tube, adds and the isopyknic Bindingbuffer of gel(× p2). Mixture is placed in to 50-55 DEG C, and 7min, until gel dissolves completely.
C, HiBindDNA centrifugal column is placed in to the 2ml collecting pipe of enclosing, by 700 μ lDNA/ agarSugar juice adds to HiBindDNA centrifugal column, under room temperature, and the centrifugal 1min of 10,000 × g.
D, discard liquid, HiBindDNA centrifugal column is put back to identical collecting pipe again. To HiBindDNAIn centrifugal column, add 300 μ lBindingbuffer (× p2), under room temperature, the centrifugal 1min of 10,000 × g, washesHiBindDNA centrifugal column. Discard efflux and reuse collecting pipe.
E, the lavation buffer solution washing HiBindDNA centrifugal column that adds 700 μ l absolute ethyl alcohols to dilute. Room temperatureThe lower centrifugal 1min of 10,000 × g.
F, discard liquid the centrifugal 2min of maximum (top) speed void column to be dried centrifugal column basement membrane.
G, HiBindDNA centrifugal column is placed in to clean 1.5ml centrifuge tube. In the middle of centrifugal column basement membrane, dripAdd 15-30 μ l elution buffer, room temperature is placed after 1min with the centrifugal 1min eluted dna of 13,000g.
4) structure of Oct4 expression vector.
By the Oct4DNA fragment and pGL3-Basic carrier for expression of eukaryon (Promega company) warp that reclaimCross Xho I and the processing of Nco I double digestion, use T4DNA ligase by the Oct4DNA fragment after double digestionBe cloned in the pGL3-Basic of double digestion carrier for expression of eukaryon then transfection Escherichia coli DH5 α impressionState cell, uses forward primer and reverse primer to screen clone, and the positive colony that screening is obtained sendGo order-checking, DNA sequencing shows that sequence is correct, called after pGL3-Oct4.
5) structure of Oct4 slow virus plasmid.
Use Xho I single endonuclease digestion pGL3-Oct4 and slow virus carrier pLVX-IRES-ZsGreen1 (buy inHan Heng bio tech ltd), use T4DNA ligase by the Oct4 after Xho I single endonuclease digestionDNA fragmentation is cloned into Xho I single endonuclease digestion linearisation lentivirus transfer plasmid pLVX-IRES-ZsGreen1, soRear transfection Escherichia coli DH5 α competent cell, by restriction enzyme Nco I single endonuclease digestion Preliminary Identification weightGroup plasmid, serves the sea biological Co., Ltd of raw work by the correct clone of qualification and carries out DNA sequencing, called afterPLVX-Oct4-ZsGreen1. Clone's large quantity extracting plasmid correct order-checking is used in order to transfection.
6) structure of shOct4 slow virus plasmid.
In Shanghai, synthetic DNA sequence dna corresponding to Oct4shRNA neck ring structure of the biological Co., Ltd of raw work (containsHave Xho I and Nco I restriction enzyme site), use Xho I single endonuclease digestion Oct4shRNA neck ring structure correspondingDNA sequence dna and slow virus carrier pLVX-IRES-ZsGreen1, use T4DNA ligase by Oct4The DNA sequence dna that shRNA neck ring structure is corresponding is cloned into linearisation slow virus plasmid vectorPLVX-IRES-ZsGreen1, called after pLVX-shOct4-ZsGreen1.
The DNA sequence dna that Oct4shRNA neck ring structure is corresponding is as follows:
5’-CTCGAGCCCTCACTTCACTGCACTGCCATTG-3’。
(2) by the slow-virus transfection UC-MSCs that contains genes of interest.
1) preparation of slow virus.
A, inoculation people renal epithelial cell be 293T cell (purchased from Mei Yan bio tech ltd, Shanghai) inIn the 100mm culture dish of poly-D-lysine processing, in the time that reaching 80%, changes Fusion of Cells degree liquid, by three plasmids(pspax2, pMD2G, pLVX-Oct4-ZsGreen1 or pLVX-shOct4-ZsGreen1) cotransfection293T cell, changes culture medium after cultivation 6h; Pspax2 and pMD2G buy in excellent precious biological;
After B, transfection 48h, collect viral supernatant, in 4 DEG C, the centrifugal 10min of 4000r/min; Collect fromSupernatant after the heart also filters;
After C, 4 DEG C, the centrifugal 2h of 25000r/min by serum-free medium lytic virus precipitation;
D, use limiting dilution assay are measured virus titer, and packing is stored in-80 DEG C of refrigerators for subsequent use.
2) transfection of slow virus.
Umbilical cord mesenchymal stem cells (UC-MSCs, Bai Li bio tech ltd, Shanghai) is inoculated in to sixIn orifice plate, in the time that Monolayer growth of cells density reaches 80%～90%, add 1ml step 1) the slow disease that obtains(titre is 6 × 10 to poison particle7, and to add polybrene to final concentration be that 8 μ g/ml are to promote virus TU/ml)Absorption. Carry out transfection according to following 3 groups: contrast the UC-MSCs into transfection empty plasmid, Oct4 is transfectionThe UC-MSCs of Oct4 plasmid (being pLVX-Oct4-ZsGreen1), shOct4 is transfection Oct4shRNAUC-MSCs (being pLVX-shOct4-ZsGreen1).
(3) RT-PCR method detects IL-31 gene expression.
1) extracting cell total rna.
After transfection 72 hours, extracting cell total rna from above-mentioned 3 groups of UC-MSCs respectively, by E.Z.N.A.TotalRNAKitI kit (flying upward biological Co., Ltd purchased from Guangzhou) uses step to complete.
2) total RNA reverse transcription obtains cDNA.
Reverse transcription kit is purchased from Dalian precious bioengineering Co., Ltd, and reverse transcription system is as follows:
After 70 DEG C of upper heating 10min, put rapidly on ice at least 2min. Then in above-mentioned mixed liquor, add as followsThe mixed liquor 10 μ l of system, 42 DEG C of insulation 1h, 70 DEG C of insulation 15min, obtain cDNA.
3) PCR detects the expression of IL-31.
The primer sequence of amplification IL-31 is as follows:
IL-31 upstream primer: 5 '-CACGTTGCCCGTCCGTTTA-3 ';
IL-31 downstream primer: 5 '-TTTAGTGCGAGGTCCATG-3 '.
The reaction system of pcr amplification is as follows:
The reaction condition of pcr amplification is as follows:
Finally PCR product is carried out agarose gel electrophoresis qualification and taken pictures.
Experimental result shows: UC-MSCs can express IL-31mRNA, and Oct4 gene can increase IL-31Expression, shOct4 is by degradation of cell endogenous Oct4mRNA, what cause that in cell, IL-31 expresses fallsLow (Fig. 1).
Embodiment 2 adopts the MSCs of CHIP (chromatin co-immunoprecipitation) method qualification at different algebraicallyMiddle Oct4 is combined situation with the promoter of IL-31 gene.
Experimental procedure is undertaken by CHIP kit description, slightly changes, and CHIP kit ends purchased from WuhanMei Jie Science and Technology Ltd.
(1) UC-MSCs of different algebraically (P3, P6, P9) is fixed through 1% formaldehyde crosslinking respectively,Under room temperature, place 10min, use glycine solution stopped reaction;
(2) then use the PBS washed cell twice of precooling, centrifugal going adds 1ml to contain protease after supernatantThe SDS lysate cell lysis of inhibitor;
(3) chromatin dna in ultrasonic broken cells lysate, adopts Protein G magnetic bead to remove non-specificThe DNA fragmentation of property combination;
(4) in residue supernatant, add anti-Oct4 antibody, add mouse IgG antibody as negative control;
(5) add Protein G magnetic bead, collection Protein G magnetic bead/anti-Oct4 antibody/Oct4/DNA fragmentCompound;
(6) obtain dissociative DNA fragment through separating after crosslinked, reclaim DNA fragmentation with DNA purification column.
(7) then taking the DNA that reclaims as template, adopt the method amplification IL-31 base of Real-timePCRThe promoter fragment of cause, IL-31 promoter upstream and downstream primer Primer5.0 Software for Design, by the raw work in ShanghaiBiotech firm is synthetic, and the sequence of primer is as follows:
IL-31 promoter upstream primer: 5 '-CGCTGACTGCTCTTTCTCCT-3 ';
IL-31 promoter downstream primer: 5 '-GGGGGTAGTGCTTCCAGAAT-3 '.
Real-timePCR reaction system is as follows:
Real-timePCR response procedures is as follows:
(8) carry out relative quantification by Δ Δ Ct value.
Experimental result shows: adopts in the chromatin dna fragment of UC-MSCs of anti-Oct4 antibody precipitation,Can amplify specifically the IL-31 promoter gene fragment that contains Oct4 binding site, adopt normal mouseIgG antibody is as negative control group this fragment that can not increase. Along with UC-MSCs passage number increases, PCRAmplification amount also reduces. This result shows: Oct4 can be combined with IL-31 gene promoter, thereby regulates IL-31Expression, IL-31 is the new target gene (Fig. 2) of Oct4.
Embodiment 3 adopts dual-luciferase reporter system to detect the regulation and control of Oct4 to IL-31 gene expressionEffect.
(1) build the plasmid containing IL-31 promoter.
1) the synthetic IL-31 promoter that contains XhoI (tcgag) and HindIII (agctt) restriction enzyme siteDNA, the sequence of template strand (positive-sense strand) is as follows:
5’-GCTCGAGAGGCGAACACATCTGGCTCCAAGCTTCG-3’。
2) IL-31 promoter DNA and pGL3-Luciferase plasmid (Promega) are carried out respectively to XhoIWith HindIII double digestion, IL-31 promoter DNA double digestion condition is as follows:
PGL3-Luciferase plasmid double digestion condition is as follows:
3), after 37 DEG C of enzymes are cut and spent the night, in 1% agarose gel electrophoresis, and reclaim respectively the IL-31 after enzyme is cutPromoter DNA and pGL3-Luciferase plasmid;
4) IL-31 promoter double digestion is reclaimed to product and be connected to pGL3-Luciferase double digestion recovery productIn, obtain pGL3-IL-31 promoter-Luciferase plasmid of recombinating. 16 DEG C connect 2h, linked system asUnder:
5) by pGL3-IL-31 promoter-Luciferase plasmid transformation escherichia coli DH5 α impression of this restructuringState cell, obtains DH5 α recombinant clone, and some clones of picking carry out positive identification, by the positive gram of selectingGrandly check order in Shanghai Sheng Gong biotech firm. Sequencing result shows that its nucleotide sequence is all correct, obtainsPGL3-IL-31 promoter-Luciferase.
(2) dual-luciferase reporter system detects the regulating and controlling effect of Oct4 to IL-31 gene expression.
1) slow virus that contains Oct4, shOct4 and empty plasmid is distinguished to transfection to UC-MSCs, turn simultaneouslyEnter firefly luciferase plasmid pGL3-IL-31 promoter-Luciferase and renilla luciferase plasmid(pGL3-Luciferase and pGL4-Renilla buy in the limited public affairs of Guangzhou one hundred road biotechnology pGL4-RenillaDepartment), pGL4-Renilla contrasts as transfection efficiency internal reference. Adopt the plasmid that does not contain IL-31 promoterPGL3-Luciferase in contrast.
2) after 24h, collect respectively transfectional cell, with passive lysate (Promega company) cell lysis,Use Relative luciferase activity assay kit and the luminous detector of GloMax2/20 of Promega companyMeasure fluorescent value. Result represents the mean value of firefly luciferase and renilla luciferase activity ratio.
Experimental result show: in UC-MSCs transcription factor Oct4 can with the promoter of IL-31 geneIn conjunction with, thereby the expression of promotion firefly luciferase. ShOct4 is by degradation of cell endogenous Oct4MRNA, thereby the expression (Fig. 3) of inhibition firefly luciferase.
Above-described embodiment is preferably embodiment of the present invention, but embodiments of the present invention are not subject to above-mentioned realityExecute routine restriction, other any do not deviate from the change done under Spirit Essence of the present invention and principle, modification,Substitute, combine, simplify, all should be equivalent substitute mode, within being included in protection scope of the present invention.
Claims (5)
- The application of 1.Oct4 in regulation and control IL-31 gene expression.
- 2. the application of Oct4 according to claim 1 in regulation and control IL-31 gene expression, its feature existsIn: the nucleotide sequence of described IL-31 gene is as shown in SEQIDNO.1.
- 3. the application of Oct4 according to claim 1 in regulation and control IL-31 gene expression, its feature existsIn: be the medicine that Oct4 albumen or the nucleotide sequence that can express Oct4 is prepared into activation IL-31 genetic transcriptionThing.
- 4. the application of Oct4 according to claim 1 in regulation and control IL-31 gene expression, its feature existsIn: be the medicine that Oct4 albumen or the nucleotide sequence that can express Oct4 is prepared into treatment scytitis.
- 5. the application in regulation and control IL-31 gene expression according to the Oct4 described in claim 3 or 4, its spyLevy and be: described nucleotide sequence is DNA sequence dna.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610076404.8A CN105601726B (en) | 2016-02-03 | 2016-02-03 | Application of the Oct4 in regulation IL-31 gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610076404.8A CN105601726B (en) | 2016-02-03 | 2016-02-03 | Application of the Oct4 in regulation IL-31 gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105601726A true CN105601726A (en) | 2016-05-25 |
| CN105601726B CN105601726B (en) | 2019-03-22 |
Family
ID=55982135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610076404.8A Expired - Fee Related CN105601726B (en) | 2016-02-03 | 2016-02-03 | Application of the Oct4 in regulation IL-31 gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105601726B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591238A (en) * | 2016-12-14 | 2017-04-26 | 南开大学 | Cell line capable of dynamically monitoring expression level of Stat3 through molecular imaging method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103145846A (en) * | 2011-12-06 | 2013-06-12 | 吉林圣元科技有限责任公司 | Novel preparation method for TAT-Oct4 |
| CN104672317A (en) * | 2015-02-12 | 2015-06-03 | 暨南大学 | Transcription factor ZNF312b for regulating Oct4 gene expression and application of transcription factor ZNF312b |
| CN105061594A (en) * | 2015-07-16 | 2015-11-18 | 中国人民解放军第二军医大学 | Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody |
-
2016
- 2016-02-03 CN CN201610076404.8A patent/CN105601726B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103145846A (en) * | 2011-12-06 | 2013-06-12 | 吉林圣元科技有限责任公司 | Novel preparation method for TAT-Oct4 |
| CN104672317A (en) * | 2015-02-12 | 2015-06-03 | 暨南大学 | Transcription factor ZNF312b for regulating Oct4 gene expression and application of transcription factor ZNF312b |
| CN105061594A (en) * | 2015-07-16 | 2015-11-18 | 中国人民解放军第二军医大学 | Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody |
Non-Patent Citations (1)
| Title |
|---|
| WEI XING等: "《Transcriptional Regulation of Oct4 in Human》", 《STEM CELLS AND DEVELOPMENT》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591238A (en) * | 2016-12-14 | 2017-04-26 | 南开大学 | Cell line capable of dynamically monitoring expression level of Stat3 through molecular imaging method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105601726B (en) | 2019-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107513531A (en) | LncRNA XIST gRNA target sequences and its application are overexpressed for endogenous | |
| CN110075124B (en) | Application of AMSC-MALAT1-Exo in preparing medicine for treating liver diseases and preparation method thereof | |
| CN112353939B (en) | Application of GTPBP4 protein as immunosuppressant and construction of cell line for knocking down or over expressing GTPBP4 | |
| Guo et al. | Nanog RNA‐binding proteins YBX1 and ILF3 affect pluripotency of embryonic stem cells | |
| JP6960409B2 (en) | promoter | |
| CN103834691B (en) | The construction method of targeting IL-33 gene RNA interference recombinant lentivirus vector | |
| AU2017370662A1 (en) | Gene therapy for mucopolysaccharidosis, type I | |
| CN113136372B (en) | Construction method of recombinant phage | |
| WO2020034097A1 (en) | Transcriptional regulatory element and its use in enhancing the expression of exogenous protein | |
| CN115698301A (en) | Active DNA transposable systems and methods of use thereof | |
| CN105601726A (en) | Application of Oct4 (octamer-binding transcription factor 4) in regulating IL-31 gene expression | |
| CN102190735B (en) | Fusion protein TAT (transactivator of transcription)-OCT4 (octamer-binding transcription factor 4), and coding gene and application thereof | |
| CN103160514A (en) | cDNA overall length nucleotide sequence of human EBLN-1 gene and cloning method thereof | |
| CN116218906A (en) | RNA editor expression plasmid, exosome aptamer fusion expression plasmid and targeted gene RNA editing method | |
| CN112226460B (en) | Screening and breeding method of cell line for stably expressing porcine host restriction factor A3Z2 molecule and application thereof | |
| CN104450781B (en) | A kind of cell line of overexpression CIAPIN1 albumen and its preparation method and application | |
| CN106754976B (en) | Novel eimeria tenella TERT related protein gene OTU | |
| LU102533B1 (en) | miRNA (Mini Ribonucleic Acid) Precursor Polypeptide and Use thereof | |
| CN112126645B (en) | Ring RNA (ribonucleic acid) knocking-down method and application thereof | |
| JP2021533826A (en) | Precisely modified concealed messenger RNA and other polynucleotides | |
| CN117883553B (en) | Application of PML-1 protein in preparation of medicines for inhibiting cytokine storm | |
| CN112326963B (en) | Application of eukaryotic expression type A influenza virus PB2cap protein | |
| CN117802097B (en) | SgRNA for knocking out ISG15 gene, ISG15 gene-deleted bovine kidney cell and application thereof | |
| WO2017214940A1 (en) | Lentiviral expression vector for specifically promoting high expression of cplx2 gene, and applications thereof | |
| CN110042083B (en) | BHK-21 cell strain for stably expressing MAP3K8 protein and construction and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190322 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |