CN105462977B - One species specificity suppresses siRNA and its application of MAGEA1 gene expressions - Google Patents
One species specificity suppresses siRNA and its application of MAGEA1 gene expressions Download PDFInfo
- Publication number
- CN105462977B CN105462977B CN201510958796.6A CN201510958796A CN105462977B CN 105462977 B CN105462977 B CN 105462977B CN 201510958796 A CN201510958796 A CN 201510958796A CN 105462977 B CN105462977 B CN 105462977B
- Authority
- CN
- China
- Prior art keywords
- sirna
- magea1
- cell
- medicine
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Abstract
The present invention provides siRNA and its application that a species specificity suppresses MAGEA1 genes.The positive-sense strand and antisense strand sequence of siRNA of the present invention are respectively as shown in SEQ ID NO.1 2.The MAGEA1 target sequences of siRNA interference are as shown in SEQ ID NO.3, it suppresses MAGEA1 gene expressions by acting on MAGEA1 target sequences and realizing, available for the medicine for preparing MAGEA1 gene expressions in adjusting cell or organism, it can also be used for preparing the medicine for the treatment of tumour, especially melanoma, have broad application prospects.
Description
Technical field
The present invention relates to gene engineering technology field, relates in particular to a species specificity and suppresses MAGEA1 gene expressions
SiRNA and its application.
Background technology
RNA interference (RNA interference, RNAi) technology refer to it is being highly conserved during evolution, by double
Phenomenon that chain RNA (double-stranded RNA, dsRNA) induces, the efficient selective degradation of homologous mRNA, RNA molecule are led to
Cross and destroy specific mRNA, to suppress the biological process of certain gene expression.The technology has some following advantage：1 is efficient
Property；2 specificity；3 position effects；4 high stabilities；5 propagabilities；6 concentration-time dependences.Can be with due to the use of RNAi technology
Specific depletion or the expression for closing specific gene, the technology rapidly become gene functional research and gene therapy research field most
One of concerned research tool, has been widely used for exploring gene function and the treatment neck of communicable disease and malignant tumour
Domain.
Malignant mela noma (malignant melanoma, MM)：A kind of malignant tumour of melanocyte is derived from,
Skin is apt to occur in, grade malignancy is high, and treatment difficulty is big.Although melanoma only accounts for the 4% of whole skin neoplasins, account for skin and swell
The 80% of knurl death toll, is the highest a kind of malignant tumour of the death rate in skin neoplasin.National Cancer Institute (NCI)
Data show that between 2003-2007, number of patients is annual 20.1 people/10,000 people.By the end of 2010, it is estimated to be
68130 patients are diagnosed with melanoma, (the http wherein therefore 8700 patients will die://www.cancer.
gov/).The incidence of malignant mela noma constantly rises in worldwide, including the ground that former incidence is low
Area, it becomes a kind of malignant disease of serious threat health of people.There is the trend increased year by year in Chinese melanoma patients.
Eight city statistics of Beijing shows that MM incidence is 0.2/100,000 within 2000, by 2004 up to 1/100,000.Root
Delivered according to (CSCO) the melanoma Committee of Experts of Chinese Clinical tumour association《Chinese melanoma diagnosis and treatment guide (2011
Version)》, the annual new cases in China about 20,000, have become and seriously jeopardize one of disease of the health of our people.
Melanoma antigen family A1 (MAGEA1) are one of MAGE gene family members, which shares 12
A homologous gene, coding protein sequence has the similitude of 50%-80%, and promoter region and First Exon area difference are opposite
It is bigger.MAGEA1 is that by Vander Bruggeon et al., from an example, with melanoma tumors, still clinical manifestation was good in 1991
It is separated with good patient to obtain.The albumen of MAGEA1 coded by said gene can be by human toxicity T lymphocyte clones
(ctl clone) identifies.The albumen of MAGEA1 coded by said gene can occur to interact and pass through recruitment group with SKIP albumen
Albumen deacetylase (HDAC-1), so as to regulate and control the transcription of some specific genes.MAGEA1 chromatin is positioned at mankind's X chromosome
Q28 regions, full length gene 1755bp, is mainly made of 3 extrons and 2 intrones.309 amino acid longs of encoding proteins
Degree, it is considered that MAGEA1 is mainly distributed on nucleus and is anchored on cell membrane in the cell, and under normal circumstances, MAGEA1 is only
Express, do not expressed in malignant cell usually, the reason is that place is given in the startup of the gene in male reproductive system and placenta
CpG islands methylate.Recent study is found among kinds of tumors, including melanoma, breast cancer, neuroblastoma, wing
There is also the expression of MAGE-A1 genes in Guang cancer and non-small cell lung cancer, therefore MAGEA1 is referred to as cancer reproduction
(cancer-germline, CG) gene or cancer-testis antigen (cancer-testis antigen, CTA) gene.
The albumen of MAGEA1 codings can be identified in tumor cell surface by cytotoxic T lymphocyte, by antigen submission and body
Immune response, produces the response effect of humoral immunity and cellular immunity, therefore MAGEA1 genes are considered as potential tumor vaccine
Target spot.
Due to currently limited to the progress of MAGEA1, its biological function in reproductive system and tumour is not also
It is perfectly clear, but certainly, the molecule of MAGEA1 codings take part in different kinds of molecules function point analysis and play a series of works
With.The expression of MAGEA1 is lowered, can effectively suppress migration and the invasive ability of tumour cell, currently for downward MAGEA1's
The siRNA report that expression study, particularly specificity suppress MAGEA1 expression is less.
The content of the invention
It is an object of the invention to provide a kind of siRNA for being capable of specificity suppression MAGEA1 gene expressions
(siRNA) and its apply.
The present invention has designed and synthesized the siRNA for MAGEA1 genes, its G/C content according to RNAi occurring principles
For 42.11%, and the length of positive-sense strand and antisense strand is 19nt.
Further, the positive-sense strand of siRNA duplex molecule of the invention and antisense strand sequence are respectively：
Positive-sense strand：5 ' GAGUAUGUGAUCAAGGUCAdTdT-3 ', (SEQ ID NO.1)
Antisense strand：5’-dTdTCUCAUACACUAGUUCCAGU-3’(SEQ ID NO.2).
Above-mentioned siRNA provided by the invention, can in specific downregulation cell or organism MAGEA1 genes table
Up to amount.
Further, the target sequence that siRNA of the invention acts on MAGEA1 genes is：5’-
GAGTATGTGATCAAGGTCA-3’(SEQ ID NO.3)。
A kind of DNA sequence dna for encoding siRNA of the present invention belongs to protection scope of the present invention.
The present invention provides a kind of expression vector, and it includes the DNA sequence dna for encoding above-mentioned siRNA.
A kind of host cell, it is the cell that can express siRNA of the present invention.
A kind of medicine containing above-mentioned siRNA belongs to protection scope of the present invention.
Further, the medicine is anti-tumor drug.The tumour is melanoma, breast cancer, nerve mother
Cytoma, carcinoma of urinary bladder, non-small cell lung cancer, colorectal cancer, stomach cancer, liver cancer, seminoma, cancer of the esophagus, leukaemia, lymthoma,
Sarcoma.
Further, the medicine is immunotherapeutic agent.
A kind of cell line for expressing above-mentioned siRNA falls within protection scope of the present invention.
The present invention provides above-mentioned siRNA to prepare the MAGEA1 gene expression medicines in adjusting cell or organism
In purposes.
The present invention provides purposes of the above-mentioned siRNA in the medicine for suppressing tumor cell migration and invasion and attack is prepared.
Preferably, the tumour cell is melanoma cells, breast cancer cell, neuroblastoma cell, carcinoma of urinary bladder
Cell, non-small cell lung cancer cell, colorectal cancer cells, stomach cancer cell, liver cancer cells, seminoma cell, esophageal cancer cell,
Lymphoma cell, sarcoma cell.
The present invention provides purposes of the above-mentioned siRNA in the medicine for preparing treatment disease, the disease is black
Melanoma, breast cancer, neuroblastoma, carcinoma of urinary bladder, non-small cell lung cancer, colorectal cancer, stomach cancer, liver cancer, seminoma, food
Road cancer, leukaemia, lymthoma, sarcoma.
Effective targeted therapy is the auxiliary treating method constantly looked for both at home and abroad at present, and targeting provided by the invention is directed to
After the siRNA transfection melanoma cells of MAGEA1 genes, it is found that siRNA can significantly lower the expression of MAGEA1 genes, have
Effect suppresses migration and the invasive ability of tumour cell, the therapeutic effect for developing new Antioncogene medicine and tumour medicine
Acted on important guiding, prepare antitumor drug available for exploitation, it will obtain huge social benefit and economic value.
Brief description of the drawings
The siRNA that Fig. 1 is the present invention strikes poorly efficient fruit to A375 cell MAGEA1 gene expressions.Wherein 1：Untransfected
The A375 cells of siRNA；2：Transfect the A375 cells of negative control sequence；3：Transfect the A375 cells of siRNA.
Fig. 2 is that MAGEA1 gene mRNAs strike low-level electrophoresis detection as a result, wherein swimming lane 1 in A375 cells：Molecular weight
Mark；Swimming lane 2：Transfect the A375 cells of siRNA；Swimming lane 3：Transfect the A375 cells of negative control sequence；Swimming lane 4：Untransfected
The A375 cells of siRNA.
Fig. 3 strikes low-level Western blot detections, wherein swimming lane 1 for A375 cell MAGEA1 albumen：Untransfected
The A375 cells of siRNA；Swimming lane 2：Transfect the A375 cells of negative control sequence；Swimming lane 3：Transfect the A375 cells of siRNA.
Embodiment
Following embodiments are used to illustrate the present invention, but are not limited to the scope of the present invention.Without departing substantially from spirit of the invention
In the case of essence, the modifications or substitutions made to the method for the present invention, step or condition belong to the scope of the present invention.
Unless otherwise specified, chemical reagent used in embodiment is conventional commercial reagent, skill used in embodiment
The conventional means that art means are well known to those skilled in the art.
The design synthesis of the siRNA of the selectively targeted MAGEA1 genes of embodiment 1 and transfection melanoma cells
1st, the design of the siRNA of selectively targeted MAGEA1 genes
In public siRNA designs website, (network address is：http://sirna.wi.mit.edu/home.php；
https://www.thermofisher.com/cn/zh/home.html；http://sidirect2.rnai.jp/ etc.) on it is defeated
Enter the mRNA sequence of MAGEA1, the siRNA sequence of low MAGEA1 mRNA expression can be struck according to website indication predicting.
The prediction result provided of multiple websites is compared, selects at least while be predicted to two websites
siRNA。
Screening does not have the siRNA sequence of document report.The siRNA sequence G/C content of the present embodiment screening is 42.11%, and
The length of positive-sense strand and antisense strand is 19nt.
Specifically, its positive-sense strand and antisense strand sequence are respectively：
Positive-sense strand：5 ' GAGUAUGUGAUCAAGGUCAdTdT-3 ', (SEQ ID NO.1)
Antisense strand：5’-dTdTCUCAUACACUAGUUCCAGU-3’(SEQ ID NO.2).
The siRNA of the present invention acts on the target sequences of MAGEA1 genes：5’-GAGTATGTGATCAAGGTCA-3’
(SEQ ID NO.3)。
SiRNA and negative control sequence transfer to Guangzhou Rui Bo bio tech ltd to synthesize.
2nd, siRNA of the invention transfection melanoma cells
Melanoma cells A375 (being purchased from ATCC, American type culture collection) is cultivated in 10cm
Cultivate to after 80% in ware, digested with pancreatin, add 6 orifice plates, the final cell number for making each hole is 5 × 105A cell.
Transfection reagent prepares：
A.250 μ l Opti-MEM (the silent winged generation that science and technology of match, the U.S.)+5 μ l siRNA (20uM), stand 5 minutes.
B.250 2000 (the silent winged generation of match of μ l Opti-MEM (the silent winged generation that science and technology of match, the U.S.)+3 μ l Lipofeactmine
You are scientific and technological, the U.S.), 5 minutes are stood,
C. after A is mixed with reagent obtained by B, 20 minutes are stood.Mixed transfection reagent is added in 6 orifice plates, with
A375 cells mix.37 DEG C, culture 48 it is small when after, collect cell.
The mRNA expressions of identification of M AGEA1 genes after 2 siRNA of embodiment transfections
1st, the melanoma cells A375 of siRNA of the present invention has been transfected in real-time quantitative PCR (q-PCR) identification embodiment 1
MAGEA1 genes mRNA expressions
1 q-PCR reaction systems of table
Preceding primer：AAGGTGGCTGATTTGGTTGGT
Primer afterwards：CTGCAAGGACTCAGAGGCTTT
Q-PCR response procedures：95℃5min；95 DEG C of 15sec, 62 DEG C of 30sec, are circulated 35 times.
The level of software analysis MAGEA1 gene expression amounts, the result is shown in Figure 1 are carried using real-time quantitative.Fig. 1 shows, A375
After cell transfecting MAGEA1 specific siRNAs, MAGEA1 expression quantity just corresponds to the 8.7% of transfection negative control sequence (NC).
1：The A375 cells of untransfected siRNA；2：Transfect the A375 cells of negative control sequence；3：Transfect the A375 cells of siRNA.
PCR product is subjected to electrophoresis detection, MAGEA1 gene mRNAs strike low-level electrophoresis detection result in A375 cells
After seeing that Fig. 2, Fig. 2 displays transfect siRNA, the expression of low MAGEA1 genes can be effectively struck.
Identification of M AGEA1 protein expression levels after 3 siRNA of embodiment transfections
1st, the protein expression level of Western blot identification of M AGEA1 genes
Preparation of samples：Adherent melanoma cells A375：1 × PBS is washed twice, the digestion of 100 μ l pancreatin, 500 μ l cultures
Liquid is terminated and is put into 1.5ml EP pipes.Centrifuged 5 minutes with the rotating speed of 14000rpm.Supernatant is abandoned, 200 1 × PBS of μ l are washed once.Add
Enter 50 μ l cell lysis buffer solutions, acutely concussion, makes cell fully crack, -20 DEG C of preservations.Total protein concentration is detected with BCA methods.
5 × sample-loading buffer is diluted to 1 ×, it is added in the cell sample of cracking.95 DEG C of thermal denaturation 5min, then with 11500rpm's
Rotating speed centrifuges 5 minutes.
2nd, 12%SDS-PAGE glue is configured.
3rd, protein electrophorese：Point sample, each minimum 20 μ g of sample, 3 μ l of protein markers point.Constant pressure 100V, 30 points
Clock, then adjust voltage to 120V, 1 it is small when.Transferring film：Cellulose membrane is soaked with methanol in advance, with the transferring film buffer solution of precooling into
Row transferring film, constant current 300mA, 2 it is small when.Closing：Film is put into 5% skimmed milk power solution (1 × TTBS of 1g skimmed milk power+20ml)
In, when vibration 1 is small.Skimmed milk power solution is outwelled, primary antibody is added, when vibration 1 is small.After removing primary antibody, washed three times with 1 × TTBS,
10 minutes every time.Secondary antibody is then added, when vibration 1 is small.After removing secondary antibody, washed three times with 1 × TTBS, 10 minutes every time.Prepare
Nitrite ion is simultaneously uniformly dropped on film, exposure imaging.Three kinds of total protein of cell are subjected to Western blot detections, the result is shown in Fig. 3,
After the results show transfection siRNA, the expression of low MAGEA1 albumen can be effectively struck.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (8)
1. a kind of siRNA, it is characterised in that its positive-sense strand and antisense strand sequence are respectively：Positive-sense strand：5’GAGUAUGUG
AUCAAGGUCAdTdT-3 ',
Antisense strand：5’-dTdTCUCAUACACUAGUUCCAGU-3’；
The target sequence that the siRNA acts on MAGEA1 genes is：5’-GAGTATGTGATCAAGGTCA-3’.
A kind of 2. DNA fragmentation for encoding siRNA as claimed in claim 1.
3. a kind of expression vector, it includes the DNA fragmentation described in claim 2.
A kind of 4. medicine containing siRNA described in claim 1.
5. medicine as claimed in claim 4, it is antitumor drug.
6. the siRNA described in claim 1 is in the MAGEA1 gene expression medicines in preparing adjusting cell or organism
Purposes.
7. purposes of the siRNA in the medicine for suppressing hepatoma cell proliferation is prepared described in claim 1.
8. purposes of the siRNA in the medicine for preparing treatment disease described in claim 1, the disease is liver cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510958796.6A CN105462977B (en) | 2015-12-18 | 2015-12-18 | One species specificity suppresses siRNA and its application of MAGEA1 gene expressions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510958796.6A CN105462977B (en) | 2015-12-18 | 2015-12-18 | One species specificity suppresses siRNA and its application of MAGEA1 gene expressions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105462977A CN105462977A (en) | 2016-04-06 |
| CN105462977B true CN105462977B (en) | 2018-05-11 |
Family
ID=55601138
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510958796.6A Active CN105462977B (en) | 2015-12-18 | 2015-12-18 | One species specificity suppresses siRNA and its application of MAGEA1 gene expressions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105462977B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006006948A2 (en) * | 2002-11-14 | 2006-01-19 | Dharmacon, Inc. | METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY |
| CN101492729A (en) * | 2008-01-22 | 2009-07-29 | 上海人类基因组研究中心 | Uses of MAGEA1 gene |
-
2015
- 2015-12-18 CN CN201510958796.6A patent/CN105462977B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105462977A (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Cancers take their Toll—the function and regulation of Toll-like receptors in cancer cells | |
| Chen et al. | MiR-125a/b regulates the activation of cancer stem cells in paclitaxel-resistant colon cancer | |
| CN105779454B (en) | Inhibit siRNA-203 and the application of long-chain non-coding RNA SNHG6 expression and hepatoma cell proliferation | |
| CN107828888A (en) | Circular rna circ PTPRA purposes | |
| CN105462975B (en) | One species specificity suppresses siRNA and its application of CTGF gene expressions | |
| Wang et al. | The N‐terminal polypeptide derived from vMIP‐II exerts its antitumor activity in human breast cancer through CXCR4/miR‐7‐5p/Skp2 pathway | |
| CN105861551B (en) | The carrier and its construction method of Combined expression microRNAs inhibition Cells Proliferation of Human Breast Cancer and application | |
| Gao et al. | HSP90 and SIRT3 expression in hepatocellular carcinoma and their effect on invasive capability of human hepatocellular carcinoma cells | |
| CN102433383A (en) | Applications and correlated medicament of human STIM1 gene | |
| CN105462977B (en) | One species specificity suppresses siRNA and its application of MAGEA1 gene expressions | |
| CN105462978B (en) | One species specificity suppresses siRNA and its application of MAGEA1 gene expressions | |
| CN107488733A (en) | Applications of the miR 133b in prostate cancer with osseous metastasis diagnosis, prediction, treatment | |
| CN107488735B (en) | MiR-339-5p is inhibiting the application in prostate cancer with osseous metastasis and TGF-β signal path | |
| CN107488734B (en) | MiR-19a-3p is preparing the application in prostate cancer with osseous metastasis diagnostic reagent and therapeutic agent | |
| CN114032236B (en) | shRNA of TMEM2 and application thereof | |
| CN105462979B (en) | One species specificity suppresses siRNA and its application of TWIST1 gene expressions | |
| CN108913690A (en) | PD-1 specificity interference sequence, plasmid, attenuation salmonella and in antitumor application | |
| CN105462976A (en) | Small interfering RNA for specific inhibition of TWIST1 gene expression and application thereof | |
| CN101948544A (en) | FAT10 gene siRNA recombination analogue virus as well as preparation method and application thereof | |
| CN105296622B (en) | The diagnosis and treatment target of LMNB2 gene and its expression product as nasopharyngeal carcinoma | |
| CN110358765A (en) | Inhibit siRNA and its application of people TNFAIP1 gene expression | |
| CN109061193A (en) | Glycosylate purposes of the dependent cell adhesion molecule 1 as antitumor drug resistance target spot | |
| CN107619835A (en) | Expression vectors and its construction method and CDCA5 of the CDCA5 in stomach cancer special interference fragment in stomach cancer | |
| EP4092138A1 (en) | A method and a kit for predicting the susceptibility to stimulator of interferon genes (sting) agonists in a cancer patient | |
| CN108103194B (en) | Target for inhibiting gastric cancer cell MGC-803 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |