CN105435230B

CN105435230B - The glycosylation modified application in prevention and treatment liver fibrosis of O-GlcNAc

Info

Publication number: CN105435230B
Application number: CN201510979220.8A
Authority: CN
Inventors: 顾建新; 阮元元; 贾冬威; 宋淑淑; 邵苗苗; 李莉莉
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2015-12-23
Filing date: 2015-12-23
Publication date: 2019-09-27
Anticipated expiration: 2035-12-23
Also published as: CN105435230A

Abstract

The present invention provides the glycosylation modified applications in prevention and treatment liver fibrosis of O-GlcNAc.By enhancing, O-GlcNAc is glycosylation modified to be able to suppress hepatic stellate cells overactivity and proliferation to the present invention, inhibit the expression of α-smooth muscle actin and type i collagen and the formation of fibrous septum in liver, is preventing and/or treating in liver fibrosis to have a good application prospect.

Description

The glycosylation modified application in prevention and treatment liver fibrosis of O-GlcNAc

Technical field

The invention belongs to biotechnologys and medical domain.Specifically, the present invention relates to O-GlcNAc it is glycosylation modified Application in treatment and/or prevention liver fibrosis.

Background technique

Liver fibrosis is the histological change in chronic liver disease advanced stage, is a kind of progressive disease under inflammatory factor continuous action Reason process.Since the abnormal excessive of liver cell epimatrix deposits, lead to the formation of fibrous septum, liver original structure is broken It is bad, cause liver fibrosis.Liver fibrosis is also one and is related to the dynamic changing process of various kinds of cell and cell factor.Cell factor A huge network system is constituted with liver inner cell and extracellular matrix, regulates and controls the occurrence and development of liver fibrosis.

What is played a decisive role in liver fibrosis is hepatic stellate cells (hepatic stellate cells, HSC), liver The activation of sternzellen and its bulk deposition of the extracellular matrix mediated are the central events of liver fibrosis morbidity.The liver of activation On the one hand sternzellen passes through hyperplasia and extracellular matrix secretion participates in the reconstruction of structure in the formation and liver of liver fibrosis, another Aspect increases sinus hepaticus internal pressure by cellular contraction, and liver fibrosis, portal hypertension morbidity have finally been established in these two types variation Pathological basis.Therefore, inhibiting Hepatic Stellate Cell Activation and collagen generation is to inhibit the disease developments such as liver fibrosis Important target spot.

Liver fibrosis can be further development of irreversible cirrhosis, and majority report is thought, before cirrhosis is the cancer of liver cancer Lesion.Therefore, the treatment of chronic liver fibrotic disease should be carried out in pathological change reversible stage fibrosis phase.

The treatment of liver fibrosis is also wrapped other than for the cause of disease and conventional protection liver cell, anti-inflammatory treatment at present It includes and promotees the methods of sternzellen apoptosis, the activation for inhibiting sternzellen and proliferation, the degradation for promoting extracellular matrix.However, mesh Preceding existing drug is clinically unsatisfactory for the therapeutic effect of liver fibrosis.Therefore, there is an urgent need in the art to develop For the safely and effectively drug of liver fibrosis.

β-N-Acetyl-D-glucosamine (O-GlcNAc) modification of O- connection is that one kind is widely present in cytoplasm and nucleus Dynamic on protein serine/threonine, reversible posttranslational modification.The O-GlcNAc glycosylation and deglycosylation of protein are by O- It connects N-acetylglucosamine transferase (O- β-N-acetylglucosaminyltransferase, OGT) and connects N- with O- Acetyl glucosaminidase (O- β-N-acetylglucosaminidase, O-GlcNAcase, OGA) effect is completed, the former Catalysis GlcNAc is connected on the hydroxyl of target protein serine or threonine, and the effect of the latter is then by GlcNAc from albumen It is removed on the hydroxyl of matter.

Protein O-GlcNAcylation is different from classical glycosylation, and is similar to phosphorylation modification, thus logical Cross different mechanism regulating protein function and cellular processes.Under normal physiological conditions, the glycosylation modified participation of O-GlcNAc The multiple important processes such as growth and development, immunoregulation and metabolism.And abnormal O-GlcNAc is glycosylation modified also in a variety of diseases It is found in disease, including tumour, Alzheimer disease, cardiovascular disease and autoimmune disease etc..

However, the glycosylation modified variation in liver fibrosis of O-GlcNAc, O-GlcNAc are glycosylation modified to liver fiber There is no related reports for the influence of change process and strategy based on the glycosylation modified treatment of O-GlcNAc and/or prevention liver fibrosis Road.Before making the present invention, this field is never made to based on the glycosylation modified treatment and/or prevention to liver fibrosis of O-GlcNAc It is studied with making.

Summary of the invention

An object of the present invention, which is just being to provide one kind, can effectively prevent and/or treat liver fibrosis and/or its correlation The product of disease or symptom.

In the first aspect of the present invention, the glycosylation modified promotor of O-GlcNAc is provided in preparation prevention and/or treatment Application in object in the product of liver fibrosis and its related symptoms or disease.

In certain embodiments of the present invention, the glycosylation modified promotor of the O-GlcNAc is one in being selected from the group Kind is a variety of:

(a) the glycosylation modified donor of O-GlcNAc or its precursor forms, such as: N-acetylglucosamine, aminoglucose Sugar, UDP-N- acetylglucosamine, Glucosamine -6- phosphoric acid, acetylglucosamine -6- phosphoric acid, acetamido glucose Sugar -1- phosphoric acid；

(b) UDP-GlcNAc forms promotor: glutamine: fructose-1, 6-diphosphate aminopherase GFAT；

(c) O-GlcNAc glycosylates the inhibitor of hydrolase OGA, such as: PugNAC, OGA expression inhibiting agent (are such as directed to The siRNA of OGA, the antisense oligonucleotides for OGA), anti-OGA antibody, Thiamet-G, NAG- thiazoline, NButGT；

(d) O-GlcNAc glycosyltransferase OGT and/or its agonist, such as: OGT enzyme preparation, OGT express promotor (such as the carrier of OGT being overexpressed, as replication defect type OGT high expresses adenovirus)；

(e) substance pharmaceutically acceptable salt or ester in (a)~(d).

In certain embodiments of the present invention, the liver fibrosis related symptoms or related disease are selected from the group:

Hepatorenal syndrome caused by liver fibrosis, liver caused by cirrhosis, liver fibrosis caused by liver fibrosis Primary peritonitis caused by functional metabolism obstacle, liver fibrosis, oneself immunity hepatitis caused by liver fibrosis, liver fibrosis Ascites caused by caused primary sclerotic cholangitis, liver fibrosis, upper digestive tract varication caused by liver fibrosis go out Hepatic encephalopathy caused by blood and liver fibrosis, preferably cirrhosis caused by liver fibrosis；

Following symptom caused by liver fibrosis: tired, powerless；Appetite stimulator, Nausea and vomiting；Chronic indigestion disease Shape, such as abdominal distension gas, constipation or diarrhea, dull pain in liver；Chronic gastritis, as sour regurgitation, belch, hiccup, upper abdomen secret anguish and upper abdomen are full Swollen equal gastric areas symptom；Bleeding, chronic hepatitis, such as spider angioma, nosebleed epistaxis, bleeding gums, skin and mucous membrane have purple plague purpura or blutpunkte Deng；The accompanying infection of liver fibrosis, such as the third type of chronic type b and viral hepatitis type D snail fever etc.；Congenital metabolic Defect, such as hepatolenticular degeneration hemochromatosis α1-antitrypsin deficiency etc.；Chemical toxicant (such as chronic alcoholic liver The chronic drug-induced liver disease of disease) and oneself immunity hepatitis primary, biliary cirrhosis and primary, sclerosing cholangitis； Or

Liver fibrosis is relevant: the extracellular matrix accumulation of activation, the activation mediation of hepatic stellate cells of hepatic stellate cells, Serum aminotransferase levels at commencement increases, liver organization inflammatory reaction.

In certain embodiments of the present invention, the liver fibrosis related symptoms or related disease are selected from the group: liver is fine Hepatorenal syndrome caused by dimensionization, primary abdomen caused by liver function dysbolism, liver fibrosis caused by liver fibrosis Primary sclerotic cholangitis caused by oneself immunity hepatitis liver fibrosis caused by film inflammation, liver fibrosis, liver fibrosis are led Hepatic encephalopathy, preferably liver caused by upper digestive tract variceal bleeding caused by the ascites of cause, liver fibrosis and liver fibrosis Cirrhosis caused by fibrosis.

In certain embodiments of the present invention, the object is mammal, preferably people, primate, rodent, family Poultry, mammalian pet, more preferable people.

In certain embodiments of the present invention, the product is selected from: pharmaceutical composition, medicine box.

In certain embodiments of the present invention, the glycosylation modified promotor of the O-GlcNAc accounts for described pharmaceutical composition The 0.001-99.9wt% of total weight, preferably 0.1-99wt%.

In some embodiments, the active material glycosylation modified based on O-GlcNAc accounts for composition total weight 1-95wt%, preferably 5-90wt%, more preferable 10-80wt%.

In certain embodiments of the present invention, the dosage form of the composition includes: tablet, powder agent, injection, particle Agent, syrup, capsule, solution, suppository or ointment.

In some embodiments, the composition is unit dosage form or multi-form, wherein being glycosylated based on O-GlcNAc The content of the active material of modification is 1-4000mg/ agent, preferably 50-1000mg/ agent.For example, the O-GlcNAc glycosylation is repaired Adoring unit dose of the promotor in described pharmaceutical composition is 0.01-1000mg/ agent, preferably 0.1-500mg/ agent, more preferably 0.1-100mg/ agent.

In another preferred example, with 0.01-100mg/kg weight, preferably 0.1-50mg/kg weight, preferably 1-10mg/ Kg weight gives the composition.

In certain embodiments of the present invention, the composition also includes prevention and/or treatment liver fibrosis and its phase Close other active materials of symptom or disease.

In some embodiments, other active materials of the treatment and/or prevention liver fibrosis or its symptom are selected from: Antiviral drugs (such as interferon-' alpha ', Lamivudine, adefovirdipivoxil and Ribavirin), anti-inflammatory drug (such as glucocorticoid, recombination Human interleukin-10), anti-oxidation medicine (such as silymarin and vitamin E), inhibit hepatic stellate cells differentiation activation drug (such as according to horse For Buddhist nun and the like, Sorafenib etc.), angiotensin converting enzyme inhibitor etc..

In the second aspect of the present invention, it is starlike to provide the glycosylation modified promotor of O-GlcNAc liver in inhibiting object Application in cell activation and/or proliferation, or be used in prevention and/or treatment object and hepatic stellate cells overactivity in preparation And/or the application in the product of the relevant disease of hyper-proliferative, preferably drawn by hepatic stellate cells overactivity and/or hyper-proliferative The liver fibrosis that rises, structural remodeling in liver, sinus hepaticus internal pressure increases or portal hypertension.

(e) substance pharmaceutically acceptable salt or ester in (a)~(d).

In certain embodiments of the present invention, the composition also includes prevention and/or treatment liver fibrosis and its phase Other active materials of symptom or disease are closed, preferably other of Hepatic Stellate Cell Activation and/or proliferation active matter in inhibition object Matter.

In some embodiments, other active materials are selected from: antiviral drugs (such as interferon-' alpha ', Lamivudine, Adefovirdipivoxil and Ribavirin), anti-inflammatory drug (such as glucocorticoid, recombinant human interleukin-11 0), anti-oxidation medicine (such as milk thistle Element and vitamin E), inhibit hepatic stellate cells differentiation activation drug (such as Apoptosis and the like, Sorafenib), blood vessel Anatransferase inhibitors etc..

A kind of product is provided in the third aspect of the present invention, is contained:

(1) the glycosylation modified promotor of a effective amount of O-GlcNAc；

(2) prevent and/or treat other active materials of liver fibrosis and its related symptoms or disease, such as inhibit object Other active materials of middle Hepatic Stellate Cell Activation and/or proliferation；And

(3) pharmaceutically acceptable carrier.

In certain embodiments of the present invention, the product is pharmaceutical composition or medicine box.

In some embodiments, the glycosylation modified promotor of the O-GlcNAc accounts for the 0.001- of the product total weight 99.9wt%, preferably 1-95wt% are more preferably 5-90wt%, more preferable 10-80wt%.

In some embodiments, other active materials are one or more substances selected from the group below: antiviral agent Object (such as interferon-' alpha ', Lamivudine, adefovirdipivoxil and Ribavirin), anti-inflammatory drug (such as glucocorticoid, recombination human interleukin 10), anti-oxidation medicine (such as silymarin and vitamin E), inhibit hepatic stellate cells differentiation activation drug (such as Apoptosis and its Analog, Sorafenib etc.), angiotensin converting enzyme inhibitor etc..

In certain embodiments of the present invention, the weight ratio of component (1) and component (2) is 0.01:100~100: 0.01.

In some embodiments, the weight ratio of component (1) and component (2) be 1:50~50:1, more preferable 1:10~10: 1。

In the fourth aspect of the present invention, provide a kind of prevention and/or treatment object liver fibrosis and its related symptoms or Disease inhibits the method for Hepatic Stellate Cell Activation and/or proliferation in object, and the method includes giving the object O- The glycosylation modified promotor of GlcNAc or the composition comprising the promotor.

In certain embodiments of the present invention, the liver fibrosis includes that liver fibrosis proceeds to liver caused by advanced stage Hardening, the symptom of the liver fibrosis are selected from the group: hepatorenal syndrome caused by liver fibrosis, liver caused by liver fibrosis Primary peritonitis caused by functional metabolism obstacle, liver fibrosis, oneself immunity hepatitis liver fibrosis caused by liver fibrosis Ascites caused by caused primary sclerotic cholangitis, liver fibrosis, upper digestive tract varication caused by liver fibrosis go out Hepatic encephalopathy caused by blood and liver fibrosis.

In certain embodiments of the present invention, disease relevant to hepatic stellate cells overactivity and/or hyper-proliferative It is selected from: the liver fibrosis as caused by hepatic stellate cells overactivity and/or hyper-proliferative, structural remodeling, sinus hepaticus internal pressure liter in liver High or portal hypertension.

In certain embodiments of the present invention, the product is pharmaceutical composition or medicine box.In some realities of the invention It applies in mode, the object is mammal.In some embodiments, the mammal is people.

In certain embodiments of the present invention, the glycosylation modified promotor of the O-GlcNAc accounts for the composition gross weight The 0.001-99.9wt% of amount.It is preferred that 1-95wt%, more preferable 5-90wt%, further preferably 10-80wt%.

In certain embodiments of the present invention, the method also includes give treatment and/or prevention liver fibrosis or its Other active materials of symptom, such as inhibit other of Hepatic Stellate Cell Activation and/or proliferation active material in object.

Those skilled in the art can carry out any combination without departing from this hair to technical solution above-mentioned and technical characteristic Bright inventive concept and protection scope.Other aspects of the invention are due to this disclosure, to those skilled in the art For be obvious.

Detailed description of the invention

The present invention will be further explained below with reference to the attached drawings, and wherein these displays are only for illustrating reality of the invention Scheme is applied, rather than in order to limit to the scope of the present invention.

Fig. 1: N-acetylglucosamine pretreatment inhibits the mouse liver fibrosis of TAA induction

Figure 1A: histology N-acetylglucosamine pre-processes the mouse liver Histological Effects (HE mediated to TAA Dyeing and sirius red stains)；Scale=100 μm.

Figure 1B: α-in the mouse liver tissue that real-time RT-PCR detection N-acetylglucosamine pretreatment mediates TAA The influence of SMA and collagen expression up-regulation；

The pretreatment of Fig. 1 C:N- acetylglucosamine reduces the transaminase level in the mice serum of TAA processing: using and turns Glutamic-pyruvic transaminase (ALT) in the mice serum that the detection N-acetylglucosamine pretreatment of adnosine deaminase detection kit handles TAA Turn the influence of ammonia (AST) with millet straw；Wherein, " U/L " in ordinate indicates every liter of unit.

In figure, " N " indicates normal group；" T " indicates TAA model group；" L " indicates N-acetylglucosamine low dose group； " H " indicates N-acetylglucosamine high dose group；" S " indicates silymarin group.

Fig. 2: Glucosamine pretreatment inhibits the mouse liver fibrosis of TAA induction

Fig. 2A: mouse liver Histological Effects that the pretreatment of histology Glucosamine mediates TAA (HE dyeing with Sirius red stains)；Scale=100 μm

Fig. 2 B: α-SMA and glue in the mouse liver tissue that real-time RT-PCR detection Glucosamine pretreatment mediates TAA The influence of original expression up-regulation；

Fig. 2 C: Glucosamine pretreatment reduces the transaminase level in the mice serum of TAA processing: being examined using transaminase Glutamic-pyruvic transaminase (ALT) and millet straw turn the shadow of ammonia (AST) in the mice serum that test agent box detection Glucosamine handles TAA It rings；Wherein, " U/L " in ordinate indicates every liter of unit.

In figure, " N " indicates normal group；" T " indicates TAA model group；" L " indicates Glucosamine low dose group；" H " is indicated Glucosamine high dose group；" S " indicates silymarin group.

Fig. 3: OGA inhibitor PugNAc pretreatment inhibits the hepatic fibrosis in mice of TAA induction

Mouse liver Histological Effects (HE dyeing and the day wolf that Fig. 3 A: histology PugNAc pretreatment mediates TAA Star red colouring)；Scale=100 μm

Fig. 3 B: α-SMA and collagen table in the mouse liver tissue that real-time RT-PCR detection PugNAc pretreatment mediates TAA Up to the influence of up-regulation；

Fig. 3 C:PugNAc pretreatment reduces the transaminase level in the mice serum of TAA processing: using transaminase detection examination Glutamic-pyruvic transaminase (ALT) and millet straw turn the influence of ammonia (AST) in the mice serum that agent box detection PugNAc handles TAA；Wherein, " U/L " in ordinate indicates every liter of unit.

In figure, " N " indicates normal group；" T " indicates TAA model group；" L " indicates PugNAc low dose group；" H " is indicated PugNAc high dose group；" S " indicates silymarin group.

Fig. 4: N-acetylglucosamine treatment inhibits the hepatic fibrosis in mice of TAA induction

Fig. 4 A: (HE contaminates the mouse liver Histological Effects that the treatment of histology N-acetylglucosamine mediates TAA Color and sirius red stains)；Scale=100 μm

Fig. 4 B: α-SMA in the mouse liver tissue that real-time RT-PCR detection N-acetylglucosamine treatment mediates TAA With the influence of collagen expression up-regulation；

The treatment of Fig. 4 C:N- acetylglucosamine reduces the transaminase level in the mice serum of TAA processing: using turning ammonia Gu Bingzhuan ammonia (ALT) and millet straw turn ammonia in the mice serum that enzyme detection kit detection N-acetylglucosamine handles TAA (AST) influence；Wherein, " U/L " in ordinate indicates every liter of unit.

The hepatic fibrosis in mice of Fig. 5: Glucosamine suppression therapy TAA induction

Fig. 5 A: mouse liver Histological Effects (HE dyeing and the day that histology glucosamine in treating mediates TAA Wolf star red colouring)；Scale=100 μm

Fig. 5 B: α-SMA and collagen in the mouse liver tissue that real-time RT-PCR detection glucosamine in treating mediates TAA Express the influence of up-regulation；

Fig. 5 C: glucosamine in treating reduces the transaminase level in the mice serum of TAA processing: being detected using transaminase Gu Bingzhuan ammonia (ALT) and millet straw turn the influence of ammonia (AST) in the mice serum that kit detection Glucosamine handles TAA； Wherein, " U/L " in ordinate indicates every liter of unit.

Fig. 6: OGA inhibitor PugNAc treatment inhibits the hepatic fibrosis in mice of TAA induction

Mouse liver Histological Effects (HE dyeing and Sirius that Fig. 6 A: histology PugNAc treatment mediates TAA Red colouring)；Scale=100 μm

Fig. 6 B: α-SMA and collagen expression in the mouse liver tissue that real-time RT-PCR detection PugNAc treatment mediates TAA The influence of up-regulation；

Fig. 6 C:PugNAc treatment reduces the transaminase level in the mice serum of TAA processing: using transaminase detection reagent Gu Bingzhuan ammonia (ALT) and millet straw turn the influence of ammonia (AST) in the mice serum that box detection PugNAc handles TAA；Wherein, it indulges and sits " U/L " in mark indicates every liter of unit.

Fig. 7: Glucosamine increases the glycosylation modified level of O-GlcNAc of liver and hepatic stellate cells

Fig. 7 A: fluorescent immunohistochemistry detects Glucosamine to the glycosylation modified water of O-GlcNAc in hepatic stellate cells Flat influence, RL2 detect the glycosylation modified level of O-GlcNAc, and PDGFR β is hepatic stellate cells marker molecules；

The fluorescence intensity statistical chart that RL2 is dyed in Fig. 7 B:PDGFR β positive cell.

In figure, " N " indicates normal group；" T " indicates TAA model group；" L " indicates Glucosamine low dose group；" H " is indicated Glucosamine high dose group；Scale=100 μm.

* is indicated: p < 0.01 compared with TAA model group has extremely significant difference.

Fig. 8: N-acetylglucosamine, Glucosamine and PugNAc inhibit Hepatic Stellate Cell Activation and collagen to generate

Fig. 8 A: with western blot method detection in the case where being stimulated with/without TGF-β, be separately added into Glucosamine (GS) 5mM, 100 μM of OGA inhibitor (PugNAc) or N-acetylglucosamine (NAG) 5mM produce hepatic stellate cells differentiation and type i collagen Raw influence；

Fig. 8 B:CCK8 is detected in the case where stimulating with/without PDGF, is separately added into Glucosamine (GS) 5mM, OGA inhibitor (PugNAc) 100 μM or N-acetylglucosamine (NAG) 5mM, the influence to hepatic stellate cell proliferation.

* is indicated: p < 0.01 compared with PDGF individually processing group has extremely significant difference.

Specific embodiment

The present invention is based on following results of study: by enhancing, O-GlcNAc is glycosylation modified to be able to suppress hepatic stellate cells mistake Degree activation and proliferation, inhibit the expression of α-smooth muscle actin and type i collagen and the formation of fibrous septum in liver, improve Liver function.Therefore, glycosylation modified in the formation and development and its correlation that prevent and/or treat liver fibrosis based on O-GlcNAc It has a good application prospect in disease or symptom.

Related definition

Herein, term " containing " indicates that various composition can be applied in composition of the invention together.Therefore, term " mainly by ... form " and " consist of " were included in term " containing ".

Herein, term " effective quantity " refer to by mode of the invention using when be enough to obtain the effect of needs and without excessively not Good side reaction (such as toxicity, stimulation and allergy), that is, have the amount of the ingredient of reasonable benefit/risk ratio.Obviously, specifically " effective quantity " is different because of various factors, such as age, the patient's condition of the required object given.

Terms used herein " liver fibrosis " refer to caused by various virulence factors connective tissue paraplasm in liver.

Term " individual ", " host ", " object " and " patient " is used interchangeably herein, and refers to mammal, including but It is not limited to Primates, including ape and monkey and people, the especially mankind.

Terms used herein " liver function " refer to the normal function of liver, including but not limited to: synthesis function, such as synthetic proteins Matter, as (such as albumin, coagulation factor, alkaline phosphatase, (such as alanine aminotransferase, aspartic acid turns ammonia to transaminase to haemocyanin Enzyme), 5'- nucleosidase, gamma-glutamyl amine acyl transpeptidase etc.), synthesis of hematoidin, synthetic cholesterol and synthesis cholic acid；The metabolism of liver Function, such as carbohydrate metabolism, amino acid and ammonia metabolism, hormone metabolism and fat metabolism；Exogenous drugs removing toxic substances；Blood is dynamic Mechanics function, including internal organ and pylic Hemodynamics；Etc..

Referred to the term of term " prevention and treatment ", " treatment " and " prevention and/or treatment " and the like in this article and is obtained Pharmacology required for obtaining and/or physiologic effect.The effect may for it prevents all or part of a kind of disease or symptom It is preventative, and/or may for it treats a kind of disease and/or the adverse effect as caused by disease partially or completely It is therapeutic." treatment " includes any treatment to all mammalian diseases, especially human diseases, packet herein Including (a) prevents the symptom of disease or disease from having neurological susceptibility to the disease at those but is not yet diagnosed as sending out on the individual for suffering from the disease It is raw；(b) inhibit disease, that is, prevent the development of disease；(c) disease is mitigated or eliminated, that is, causes the recession of disease.

Whether liver function increases or restores that normally mature liver function test can be used by person skilled in the art It is readily determined.For example, the liver functions such as albumin, alkaline phosphatase, alanine aminotransferase, aspartate transaminase, bilirubin The synthesis of marker can be by being assessed with the level of marker in the immunology of standard and enzyme analysis measurement serum；Use standard Method can measure splanchnic circulation and pylic Hemodynamics by portal vein Wedge Pressure and/or tolerance；Metabolic function can It is measured by ammonia level in measurement serum.

Based on the glycosylation modified active material of O-GlcNAc

As used herein, term " the glycosylation modified promotor of O-GlcNAc " and " glycosylation modified based on O-GlcNAc Active material " and similar terms are used interchangeably, and each meaning can be prevented by increasing the glycosylation modified level of O-GlcNAc And/or treat the active material of liver fibrosis and/or its symptom or related disease.The active material includes but is not limited to:

(a) the glycosylation modified donor of O-GlcNAc, its precursor forms, such as: N-acetylglucosamine, aminoglucose Sugar, UDP-N- acetylglucosamine, Glucosamine -6- phosphoric acid, acetylglucosamine -6- phosphoric acid, acetamido glucose Sugar -1- phosphoric acid；

(e) substance pharmaceutically acceptable salt or ester in (a)~(d).

The pharmaceutically acceptable salt or ester of active material for use in the present invention.Representative salt/ester includes (but not It is limited to): sodium salt, sylvite, zinc salt, maleate, malate, citrate, sulfate/ester, phosphate/ester, acetic acid esters etc.. Herein, term " based on the glycosylation modified active material of O-GlcNAc " includes that above-mentioned active material, above-mentioned active material exist Physiology or pharmaceutically acceptable salt, ester, hydrate, solvate, isomers or other derivative forms or theirs is mixed Close object.

Be not limited to mechanism, based on O-GlcNAc glycosylation modified active material may be prevented by following approach and/ Or treatment liver fibrosis: 1. inhibit the expression of α-smooth muscle actin and type i collagen；2. inhibit Hepatic Stellate Cell Activation and/ Or proliferation.

Product

The present invention provides a kind of product (such as pharmaceutical composition or medicine box), it includes: (a) it is based on O-GlcNAc glycosyl Change the active material modified and its pharmacological or physiological acceptable salt and/or ester；(b) pharmaceutically acceptable load Body.

Composition in the present invention can be drug, can be used for effectively preventing and/or treating liver fibrosis.

As used herein, term " pharmacological or physiological acceptable carrier " refers to the carrier for pharmaceutical preparation, packet Various excipient and diluent are included, themselves is not necessary active constituent, and be not with or without excessive poison after applying Property.Suitable carrier is well known to those of ordinary skill in the art.For example, pharmaceutically acceptable carrier is recorded in detail " Remington pharmaceutical science " (Remington ' s Pharmaceutical Sciences, Mack Pub.Co., N.J.1991).

Pharmaceutically acceptable carrier can contain liquid in the composition, such as water, salt water, glycerol and ethyl alcohol.In addition, these There is likely to be complementary substances in carrier, such as filler, disintegrating agent, lubricant, glidant, effervescent agent, wetting agent or cream Agent, corrigent, pH buffer substance etc..In general, these substances can be formulated in nontoxic, inert and pharmaceutically acceptable In aqueous carrier medium, wherein pH is usually about 5-8, preferably, pH is about 6-8.

Active material (a) accounts for the 0.001-99.9wt% of composition total weight in composition of the invention；Preferably combine The 1-95wt% of object total weight is more preferably 5-90wt%, more preferable 10-80wt%.Surplus is carrier and other additives Equal substances.

In another preferred embodiment of the invention, the composition is unit dosage form or multi-form.As used herein, Term " unit dosage forms " refers to take or easy to use, and composition of the invention is prepared into single and is taken or using required Dosage form, including but not limited to various solid formulations (such as tablet), liquid agent, capsule, sustained release agent.

In another preference of the invention, 1-6 agent composition of the invention, preferably application 1-3 agent are applied daily；? 1 dose is preferably taken when high dose daily.In a preference of the invention, 0.01~100mg/kg body is applied to object daily The present composition of weight, preferably 0.1~50mg/kg weight, more preferable 1~10mg/kg weight.

It should be understood that the effective dose of active material used can be (such as right with the individual instances for the object that need to prevent or treat As weight, age, physical condition, the required effect reached) it determines, this range that may determine that in skilled practitioners or nutritionist It is interior.

Composition of the invention, can for solid-state (such as granule, tablet, freeze-dried powder, suppository, capsule, sublingual lozenge) or Liquid (such as oral solution, solution or syrup) or other suitable forms.

The present invention also provides a kind of medicine boxs, wherein containing: (A) is equipped with a effective amount of glycosylation modified based on O-GlcNAc Active material, its pharmacological or physiological acceptable salt and/or ester container；(B) is equipped with the other prevention and treatments of effective quantity The active material of liver fibrosis or its related symptoms or disease.The medicine box is for improving liver redox equilibrium, inhibiting α- The generation of smooth muscle actin and type i collagen inhibits Hepatic Stellate Cell Activation and/or proliferation, for preventing or treating Liver fibrosis.

Method of application

Composition of the invention, medicine box can be applied by conventional route, including (but being not limited to): oral, spray The approach such as in painting, nasal cavity or transdermal.It is preferred that oral or injection application.Composition forms should match with method of application.The present invention The amount of application of composition, by based on the glycosylation modified active material weight of O-GlcNAc, usually daily about with 0.01- 100mg/kg weight, preferably 0.1-50mg/kg weight, preferably 1-10mg/kg weight.

Composition of the invention, medicine box can be used directly, can also with the substance of other preventions or treatment liver fibrosis (such as with 0.01-100mg/kg body weight/day, preferable 0.1-50mg/kg body weight/day, preferably 1-10mg/kg body weight/day) combine or combines It uses.These substances include but is not limited to: antiviral drugs (such as interferon-' alpha ', Lamivudine, adefovirdipivoxil and Ribavirin), Anti-inflammatory drug (such as glucocorticoid, recombinant human interleukin-11 0), inhibits liver at anti-oxidation medicine (such as silymarin and vitamin E) Sternzellen differentiation activation drug (such as Apoptosis and the like, Sorafenib), angiotensin converting enzyme inhibitor Deng.

Composition of the invention can also be with other methods for being usually used in treating or preventing liver fibrosis in addition to drug therapy Or means combine.These methods or means include but is not limited to: operative treatment, acupuncture, rational diet etc..

It is excellent when these substances or method are with based on O-GlcNAc glycosylation modified active substance combination or combined administration Choosing has the effect of being better than individually giving these substances or method.

Advantages of the present invention

Advantages of the present invention includes but is not limited to:

(a) by enhancing, O-GlcNAc is glycosylation modified to be able to suppress hepatic stellate cells overactivity and increasing for discovery for the first time Grow, inhibit liver in the expression of α-smooth muscle actin and type i collagen and the formation of fibrous septum, thus prevention and/ Or it has a good application prospect in the formation and development for the treatment of liver fibrosis；

(b) active material glycosylation modified based on O-GlcNAc being currently known, including Glucosamine, N- acetyl ammonia Base glucose etc., it has therefore proved that have no toxic and side effect to human body, therefore treating and/or preventing that there is high security in liver fibrosis；

(c) active material glycosylation modified based on O-GlcNAc being currently known has been used including Glucosamine etc. In treatment bone and joint diseases, including arthritis, osteoproliferation and meniscus injury etc..Since liver fibrosis is common in person in middle and old age People, the diseases such as the arthritis that often occurs together, therefore using based on O-GlcNAc glycosylation modified active material treatment and/or in advance It can treat such bone and joint diseases while anti-liver fibrosis.

All numberical ranges provided herein be intended to clearly include fall in all numerical value between endpoints of ranges and it Between numberical range.The feature that the feature or embodiment that can be mentioned to the present invention are mentioned is combined.This specification is taken off All features shown can be used in combination with any composition form, and each feature disclosed in specification any can provide phase The alternative characteristics of same, impartial or similar purpose replace.Therefore except there is special instruction, revealed feature is only impartial or similar The general example of feature.

Embodiment

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.Those skilled in the art can make modification appropriate, variation to the present invention, these modifications It is within the scope of the present invention with variation.

In the following examples, the experimental methods for specific conditions are not specified, the conventional method in this field can be used, such as join Examine " Molecular Cloning:A Laboratory guide " (third edition, New York, CSH Press, New York:Cold Spring Harbor Laboratory Press, 1989) or according to condition proposed by supplier.The sequencing approach of DNA is that this field is normal The method of rule can also provide test by commercial company.

Unless otherwise stated, otherwise percentage and number are calculated by weight.Unless otherwise defined, as used herein all Professional and scientific terms have the same meanings as commonly understood by one of ordinary skill in the art.In addition, any similar or equal to described content Deng method and material can be applied to the method for the present invention.Preferred implement methods and materials described in the text only present a demonstration it With.

The pretreatment of embodiment 1.N- acetylglucosamine inhibits the mouse liver fibrosis of TAA induction

In order to detect whether N-acetylglucosamine there is protection to make liver fibrosis caused by thioacetamide (TAA) With inventor constructs TAA hepatic fibrosis in mice model, when carrying out TAA modeling, while using various dose N- acetylamino Portugal Grape sugar is injected intraperitoneally, and observes N-acetylglucosamine liver cirrhosis pathology morphology and liver function caused by TAA Protective effect.

Modeling and dosage:

Group	Drug	Dosage	Administration frequency
				T	TAA	200mg/kg/ times	3 times a week
L	N-acetylglucosamine low dosage	50mg/kg/d	Daily medication 1 time
				H	N-acetylglucosamine high dose	200mg/kg/d	Daily medication 1 time
S	Silymarin	25mg/kg/d	Daily medication 1 time

Wherein, TAA used, N-acetylglucosamine and silymarin are purchased from Sigma company, and lot number is respectively as follows: 163678-25G；A8625-25G；S0292.

Animal packet and administration:

Healthy Balb/C mouse, male, 4-6 week old are purchased from Chinese Academy of Sciences Shanghai Experimental Animal Center.Mouse is randomly divided into 4 groups: normal group (being labeled as in figure " N ", 10), model group (being labeled as in figure " T ", 10), N-acetylglucosamine are low Dosage group (being labeled as in figure " L ", 10), N-acetylglucosamine high dose group (being labeled as in figure " H ", 10), powder-refining with water Silibin group (is labeled as " S ", 10) in figure.

Model group, N-acetylglucosamine low dose group, N-acetylglucosamine high dose group, silymarin component TAA intraperitoneal injection is not given, and is administered since give the TAA same day for the first time, gives each dosage N- acetamido glucose within continuous 8 weeks Sugar intraperitoneal injection or silymarin stomach-filling, model group give distilled water intraperitoneal injection；Normal group mouse gives distilled water abdominal cavity note It penetrates.After 8 weeks, whole mouse are put to death.

The acquisition process of sample:

Mouse takes blood using plucking eyeball, and institute's blood sampling is collected in Eppendorf pipe, is stored at room temperature 4 hours, 3000rpm from Heart 10min separates serum, and -80 DEG C save backup.

After mouse cervical dislocation is put to death, abdominal cavity is opened, liver is won, cuts 0.5cm × 0.5cm size hepatic tissue in right lobe of liver 2 pieces are fixed in 4 DEG C of paraformaldehydes, are prepared for Pathologic specimen；Liquid nitrogen flash freezer after remaining hepatic tissue is dispensed with Eppendorf pipe ,- 80 DEG C save backup.

I. the experimental method, result and analysis of liver cirrhosis pathology Senile Mouse:

Slice and roasting piece: 5 μm of serial section of paraffin-embedded tissue are affixed on the processed glass slide of APES, 60 DEG C (in electricity In hot thermostatic drying chamber, similarly hereinafter) bake piece 6-8h.

HE dyeing: dewaxing to water: roasting piece 1h, dimethylbenzene Ι 10min → dimethylbenzene Ι Ι 10min → absolute alcohol Ι 3min → nothing The water-alcohol Ι Ι alcohol of 2min → 95% alcohol of 2min → 85% alcohol of 2min → 70% 2min → tap water cleaning → bush repeatedly Cleaning → hydrochloride alcohol 3 seconds → tap water of differentiation cleans until nucleus becomes basket smart dye liquor 15min → tap water repeatedly repeatedly 2~3 seconds → 95% alcohol Ι alcohol Ι Ι of 1min → 95% 1min of (microscopy) → Yihong → absolute alcohol Ι 1min → absolute alcohol Ι Ι 1min → drip resinene, cover plate microscopy.

Sirius red stains: dewaxing to water: then roasting piece 1h is sequentially placed into the following solution prepared: dimethylbenzene Ι 10min → dimethylbenzene Ι Ι 10min → absolute alcohol Ι 3min → absolute alcohol Ι Ι the alcohol of 2min → 95% alcohol of 2min → 85% The alcohol of 2min → 70% 2min → tap water cleaning → drying repeatedly, the Picro-Sirius red dye liquor one that is close to → is added dropwise drop, sets wet box 37 DEG C, 20min → absolute alcohol differentiation → dimethylbenzene Ι 2min → dimethylbenzene Ι Ι 2min → drips resinene, cover plate microscopy.

Experimental result and analysis:

As shown in Figure 1A: HE dyeing shows that normal lobuli hepatis structure is lost in model group (T) Mouse Liver, and liver cell is in water The fibr tissue of sample denaturation or steatosis, hyperplasia divides original lobuli hepatis, wraps normal lobuli hepatis, formation is differed in size Pseudolobuli, have a large amount of fibroblasts and inflammatory cell infiltration in fibrous septum, arrange more disorder.Compared with model group, N-acetylglucosamine group (L, H) fibrous connective tissue is loose, very thin, discontinuous, and the fibroblast in fibre bundle is reduced, Degree of fibrosis makes moderate progress and is in dose dependent.

Sirius red stains show, model group (T) hepatic tissue collagenous fibres diffusivity hyperplasia and from portal area to lobuli hepatis Stretching, extension in tissue, segmentation wrapping hepatic tissue, forms apparent fibrous septum, normal lobuli hepatis structure disappears to form pseudolobuli.N- Fibrous septum narrows discontinuously in acetylglucosamine group (L, H) liver, without complete pseudolobuli structure, and changes in dose dependent It is kind.Silymarin group (S) cell infiltration situation, pseudolobuli are formed and degree of fibrosis also has centainly compared with model group (T) The improvement of degree.

In liver fibrosis, a large amount of extracellular matrixs including type i collagen of hepatic stellate cells secretion of activation, to liver Dirty essence carries out wrapping segmentation, forms pseudolobuli.Red type i collagen area statistics are shown after sirius red stains, N- acetyl Type i collagen deposition and liver fibrosis have extremely significant improvement result in the mouse liver that Glucosamine pretreatment induces TAA, and With doses dependence.

II. the mRNA level in-site of fibrosis indices in hepatic changes in liver detection method, result and analysis

Inventor further progress Real-time PCR experiments detect the variation of the mRNA level in-site of fibrosis indices in hepatic in liver.

Organize RNA extracting:

Using Trizol reagent (Invitrogen company), operated according to Invitrogen company RNA method for extracting.

RNA reverse transcription:

Using RNA PCR kit (AMV) Ver.3.0 (Takara Biotechnology, DaLian, China), according to The Takara company kit specification is operated.

Real-time PCR detection:

Using ABI Stepone Plus real-time fluorescence quantitative PCR amplification instrument, by TaKaRa company SYBR Premix Ex Taq II kit specification is operated.

Primer sequence:

Mouse GAPDH

Forward primer: GAGCGAGACCCCACTAACAT (SEQ ID NO.:1)

Reverse primer: TCTCCATGGTGGTGAAGACA (SEQ ID NO.:2)

Mouse collagen I α 1 (Collagen I α 1)

Forward primer: AGAGCATGACCGATGGATTC (SEQ ID NO.:3)

Reverse primer: CCTTCTTGAGGTTGCCAGTC (SEQ ID NO.:4)

Mouse α-SMA

Forward primer: ATGAAGCCCAGAGCAAGAG (SEQ ID NO.:5)

Reverse primer: TTTCCATGTCGTCCCAGT (SEQ ID NO.:6)

Experimental result and analysis:

The result of real-time PCR is as shown in Figure 1B, should the result shows that, in liver fibrosis, N-acetylglucosamine can With the extremely significant mRNA level in-site for reducing α-SMA and type i collagen, and the reduction level has certain N-acetylglucosamine dosage Dependence.

III. detection method, result and the analysis of mice serum ALT and AST level

Glutamic-pyruvic transaminase (ALT) and glutamic-oxalacetic transaminease (AST) are the important indicators for reflecting liver function, into one in the present embodiment Step demonstrates influence of the N-acetylglucosamine pretreatment to mice serum ALT and AST.

Serum ALT and AST detection:

ALT and AST detection method is built up detection kit specification according to Nanjing and is operated.Following kit is purchased from Bioengineering Research Institute is built up in Nanjing:

Glutamic-oxalacetic transaminease (AST/GOT) assay kit (reitman-frankel method)

Glutamic-pyruvic transaminase (ALT/GPT) assay kit (reitman-frankel method)

Analysis of experimental results:

As shown in Figure 1 C, N-acetylglucosamine pretreatment can the extremely significant glutamic-oxalacetic transaminease for inhibiting TAA to mediate (AST/GOT) horizontal up-regulation, while the up-regulation of the extremely significant glutamic-pyruvic transaminase (ALT/GPT) for inhibiting TAA to mediate, prompt N- second Acylamino- glucose has protective effect for hepatosis in liver fibrosis.

The pretreatment of 2. Glucosamine of embodiment inhibits the mouse liver fibrosis of TAA induction

In order to detect whether Glucosamine has protective effect, hair to liver fibrosis caused by thioacetamide (TAA) Bright people constructs TAA hepatic fibrosis in mice model, is carrying out TAA modeling simultaneously, carries out abdominal cavity using various dose Glucosamine Injection, and observe the protective effect of Glucosamine liver cirrhosis pathology morphology and liver function caused by TAA.

Modeling and dosage:

Group	Drug	Dosage	Administration frequency
				T	TAA	200mg/kg/ times	3 times a week
L	Glucosamine low dosage	60mg/kg/d	Daily medication 1 time
				H	Glucosamine high dose	300mg/kg/d	Daily medication 1 time
S	Silymarin	25mg/kg/d	Daily medication 1 time

Wherein, TAA used, Glucosamine and silymarin are purchased from Sigma company, and lot number is respectively as follows: 163678- 25G；G4875-25G；S0292.

Animal packet and administration:

Healthy Balb/C mouse, male, 4-6 week old are purchased from Chinese Academy of Sciences Shanghai Experimental Animal Center.Mouse is randomly divided into 4 groups: normal group (being labeled as in figure " N ", 10), model group (being labeled as in figure " T ", 10), Glucosamine low dose group (being labeled as in figure " L ", 10), Glucosamine high dose group (being labeled as in figure " H ", 10), (the figure acceptance of the bid of silymarin group Note be " S ", 10).

Model group, Glucosamine low dose group, Glucosamine high dose group, silymarin group give TAA abdomen respectively Chamber injection, is administered from give the TAA same day for the first time, gives within continuous 8 weeks each dosage Glucosamine and is injected intraperitoneally or milk thistle Plain stomach-filling (the same), model group give distilled water intraperitoneal injection；Normal group mouse gives distilled water intraperitoneal injection.After 8 weeks, put to death Whole mouse.

The acquisition process of sample:

HE dyeing: dewaxing to water: roasting piece 1h, dimethylbenzene Ι 10min → dimethylbenzene Ι Ι 10min → absolute alcohol Ι 3min → nothing The water-alcohol Ι Ι alcohol of 2min → 95% alcohol of 2min → 85% alcohol of 2min → 70% 2min → tap water cleans → Su Pin repeatedly Cleaning → hydrochloride alcohol 3 seconds → tap water of differentiation cleans until nucleus becomes basket smart dye liquor 15min → tap water repeatedly repeatedly 2~3 seconds → 95% alcohol Ι alcohol Ι Ι of 1min → 95% 1min of (microscopy) → Yihong → absolute alcohol Ι 1min → absolute alcohol Ι Ι 1min → drip resinene, cover plate microscopy.

Experimental result and analysis:

As shown in Figure 2 A: HE dyeing shows that normal lobuli hepatis structure is lost in model group (T) Mouse Liver, and liver cell is in water The fibr tissue of sample denaturation, hyperplasia wraps normal lobuli hepatis, and there are a large amount of fibroblasts and inflammatory cell in central vein portal area Infiltration arranges more disorder.Compared with model group (T), Glucosamine group (L, H) fibrous connective tissue is loose, very thin, fiber Fibroblast in beam is reduced, and degree of fibrosis makes moderate progress and is in dose dependent.

Sirius red stains show, model group (T) hepatic tissue collagenous fibres diffusivity hyperplasia and from portal area to lobuli hepatis Stretching, extension in tissue, segmentation wrapping hepatic tissue, forms apparent fibrous septum, normal lobuli hepatis structure disappears to form pseudolobuli.Ammonia Fibrous septum narrows discontinuously in base glucose group (L, H) liver, improves without complete pseudolobuli structure, and in dose dependent.Water Fly silibin group (S) cell infiltration situation, pseudolobuli is formed and degree of fibrosis also has a degree of change compared with model group It is kind.

Sirius red stains area statistics show that Glucosamine pre-processes type i collagen in the mouse liver induced TAA Deposition and liver fibrosis have extremely significant improvement result, and are in doses dependence.

II. the mRNA level in-site of fibrosis indices in hepatic changes in liver (the same) detection method, result and analysis

Organize RNA extracting:

RNA reverse transcription:

Real-time PCR detection:

Primer sequence:

Mouse GAPDH

Forward primer: GAGCGAGACCCCACTAACAT (SEQ ID NO.:1)

Reverse primer: TCTCCATGGTGGTGAAGACA (SEQ ID NO.:2)

Mouse collagen I α 1 (I α 1 of Collagen)

Forward primer: AGAGCATGACCGATGGATTC (SEQ ID NO.:3)

Reverse primer: CCTTCTTGAGGTTGCCAGTC (SEQ ID NO.:4)

Mouse α-SMA

Forward primer: ATGAAGCCCAGAGCAAGAG (SEQ ID NO.:5)

Reverse primer: TTTCCATGTCGTCCCAGT (SEQ ID NO.:6)

Experimental result and analysis:

The result of real-time PCR is as shown in Figure 2 B, should the result shows that, Glucosamine can α-in extremely significant reduction liver The mRNA level in-site of SMA and type i collagen, and the reduction level is that Glucosamine is dose-dependent.

III. detection method, result and the analysis of mice serum ALT and AST level

Glutamic-pyruvic transaminase (ALT) and glutamic-oxalacetic transaminease (AST) are the important indicators for reflecting liver function, into one in the present embodiment Step demonstrates influence of the Glucosamine processing to mice serum ALT and AST.

Serum ALT and AST detection:

Glutamic-oxalacetic transaminease (AST/GOT) assay kit (reitman-frankel method)

Glutamic-pyruvic transaminase (ALT/GPT) assay kit (reitman-frankel method)

Analysis of experimental results:

As shown in Figure 2 C, Glucosamine pretreatment can the extremely significant glutamic-oxalacetic transaminease (AST/GOT) for inhibiting TAA to mediate Horizontal up-regulation, while the up-regulation of the extremely significant glutamic-pyruvic transaminase (ALT/GPT) for inhibiting TAA to mediate, prompt Glucosamine pair Hepatosis has protective effect in liver fibrosis.

Embodiment 3.O- connection N-acetylglucosamine glycosides enzyme (OGA) inhibitor PugNAc pretreatment inhibits TAA induction Hepatic fibrosis in mice

In order to detect whether OGA inhibitor PugNAc there is protection to make liver fibrosis caused by thioacetamide (TAA) With inventor constructs TAA hepatic fibrosis in mice model first, is carrying out TAA modeling simultaneously, is being carried out using various dose PugNAc Intraperitoneal injection, and observe PugNAc liver cirrhosis pathology morphology and α-smooth muscle actin caused by TAA (α-SMA) The protective effect of expression and distribution situation.

Modeling and dosage:

Wherein, TAA, PugNAc and silymarin used are purchased from Sigma company, and lot number is respectively as follows: 163678-25G； A7229-5MG；S0292.

Animal packet and administration:

Healthy Balb/C mouse, male, 4-6 week old are purchased from Chinese Academy of Sciences Shanghai Experimental Animal Center.Mouse is randomly divided into 4 groups: normal group (being labeled as in figure " N ", 10), model group (being labeled as in figure " T ", 10), PugNAc low dose group are (in figure Be labeled as " L ", 10), PugNAc high dose group (being labeled as in figure " H ", 10), silymarin group (" S " is labeled as in figure, 10).

Model group, PugNAc low dose group, PugNAc high dose group, silymarin group give TAA intraperitoneal injection respectively, and It is administered since give the TAA same day for the first time, gives within continuous 8 weeks each dosage PugNAc intraperitoneal injection or silymarin stomach-filling, model Group gives distilled water stomach-filling.Normal group mouse gives distilled water intraperitoneal injection and stomach-filling simultaneously.After 8 weeks, whole mouse are put to death.

The acquisition process of sample:

Experimental result and analysis:

As shown in Figure 3A: HE dyeing shows that normal lobuli hepatis structure is lost in model group (T) Mouse Liver, and liver cell is in water The fibr tissue of sample denaturation or steatosis, hyperplasia divides original lobuli hepatis, has a large amount of fibroblasts in fibrous septum And inflammatory cell infiltration, arrange more disorder.Compared with model group (T), PugNAc group (L, H) fibrous connective tissue is loose, fine Carefully, discontinuously, the fibroblast in fibre bundle is reduced, and degree of fibrosis makes moderate progress.

Sirius red stains show, model group (T) hepatic tissue collagenous fibres diffusivity hyperplasia and from portal area to lobuli hepatis Stretching, extension in tissue, segmentation wrapping hepatic tissue, forms apparent fibrous septum.Fibrous septum narrows discontinuously in PugNAc group liver, Without complete pseudolobuli structure.Silymarin group cell infiltration situation, pseudolobuli are formed and degree of fibrosis is compared with model group Also there is a degree of improvement.

Sirius red stains area statistics show that type i collagen deposits in the mouse liver that PugNAc pretreatment induces TAA There is extremely significant improvement result with liver fibrosis, and is in dose dependent.

Organize RNA extracting:

RNA reverse transcription:

Real-time PCR detection:

Primer sequence:

Mouse GAPDH

Forward primer: GAGCGAGACCCCACTAACAT (SEQ ID NO.:1)

Reverse primer: TCTCCATGGTGGTGAAGACA (SEQ ID NO.:2)

Mouse collagen I α 1 (I α 1 of Collagen)

Forward primer: AGAGCATGACCGATGGATTC (SEQ ID NO.:3)

Reverse primer: CCTTCTTGAGGTTGCCAGTC (SEQ ID NO.:4)

Mouse α-SMA

Forward primer: ATGAAGCCCAGAGCAAGAG (SEQ ID NO.:5)

Reverse primer: TTTCCATGTCGTCCCAGT (SEQ ID NO.:6)

Experimental result and analysis:

The result of real-time PCR is as shown in Figure 3B, should the result shows that, in liver, PugNAc can extremely significant reduction α-SMA With the mRNA level in-site of type i collagen, and the reduction level is PugNAc dose-dependent.

III. detection method, result and the analysis of mice serum ALT and AST level

Serum ALT and AST detection:

Glutamic-oxalacetic transaminease (AST/GOT) assay kit (reitman-frankel method)

Glutamic-pyruvic transaminase (ALT/GPT) assay kit (reitman-frankel method)

Analysis of experimental results:

As shown in Figure 3 C, PugNAc pretreatment can significantly inhibit glutamic-oxalacetic transaminease (AST/GOT) level of TAA mediation Up-regulation, while the up-regulation for the glutamic-pyruvic transaminase (ALT/GPT) for inhibiting TAA to mediate, prompt PugNAc for liver function in liver fibrosis Energy obstacle has protective effect.

The treatment of embodiment 4.N- acetylglucosamine inhibits the hepatic fibrosis in mice of TAA induction

In order to detect whether N-acetylglucosamine there is treatment to make liver fibrosis caused by thioacetamide (TAA) With inventor constructs TAA hepatic fibrosis in mice model, and carries out intraperitoneal injection with various dose N-acetylglucosamine and control It treats, and observes the influence of N-acetylglucosamine liver cirrhosis pathology morphology and liver function caused by TAA.

Modeling and dosage:

Animal packet and administration:

Healthy Balb/C mouse, male, 4-6 week old are purchased from Chinese Academy of Sciences Shanghai Experimental Animal Center.Mouse is randomly divided into 4 groups, normal group (being labeled as in figure " N ", 10), model group (being labeled as in figure " M ", 10), N-acetylglucosamine it is low Dosage group (being labeled as in figure " L ", 10), N-acetylglucosamine high dose group (being labeled as in figure " H ", 10), powder-refining with water Silibin group (is labeled as " S ", 10) in figure.

Model group, N-acetylglucosamine low dose group, N-acetylglucosamine high dose group, silymarin component It does not give and continues TAA modeling after TAA is injected intraperitoneally 8 weeks, 8 weeks and give each dosage N-acetylglucosamine abdominal cavity simultaneously Injection or silymarin stomach-filling, model group give distilled water intraperitoneal injection；Normal group mouse gives distilled water intraperitoneal injection.12 weeks When (after being administered 4 weeks), put to death whole mouse.

The acquisition process of sample:

Experimental result and analysis:

As shown in Figure 4 A: HE dyeing shows that normal lobuli hepatis structure is lost in model group (T) Mouse Liver, and liver cell is in water Sample is denaturalized, and has a large amount of fibroblasts and inflammatory cell infiltration in fibrous septum, arranges more disorder.Compared with model group (T), N-acetylglucosamine group (L, H) fibrous connective tissue is loose, very thin, discontinuous, and the fibroblast in fibre bundle is reduced, Degree of fibrosis makes moderate progress and is in dose dependent.

Sirius red stains show, model group (T) hepatic tissue collagenous fibres diffusivity hyperplasia and from portal area to lobuli hepatis Stretching, extension in tissue, segmentation wrapping hepatic tissue, forms apparent fibrous septum.Fiber in N-acetylglucosamine group (L, H) liver Narrower intervals are discontinuous, improve without complete pseudolobuli structure, and in dose dependent.Silymarin group (S) cell infiltration feelings Condition, pseudolobuli are formed and degree of fibrosis also has a degree of improvement compared with model group.

Sirius red stains area statistics show, type i collagen in the mouse liver that N-acetylglucosamine induces TAA Deposition and liver fibrosis have extremely significant improvement result, and are in dose dependent.

Organize RNA extracting:

RNA reverse transcription:

Real-time PCR detection:

Primer sequence:

Mouse GAPDH

Forward primer: GAGCGAGACCCCACTAACAT (SEQ ID NO.:1)

Reverse primer: TCTCCATGGTGGTGAAGACA (SEQ ID NO.:2)

Mouse collagen I α 1 (I α 1 of Collagen)

Forward primer: AGAGCATGACCGATGGATTC (SEQ ID NO.:3)

Reverse primer: CCTTCTTGAGGTTGCCAGTC (SEQ ID NO.:4)

Mouse α-SMA

Forward primer: ATGAAGCCCAGAGCAAGAG (SEQ ID NO.:5)

Reverse primer: TTTCCATGTCGTCCCAGT (SEQ ID NO.:6)

Experimental result and analysis:

The result of real-time PCR is as shown in Figure 4 B, should the result shows that, in liver, N-acetylglucosamine can extremely be shown The mRNA level in-site for reducing α-SMA and type i collagen is write, and the reduction level is that N-acetylglucosamine is dose-dependent.

III. detection method, result and the analysis of liver fibrosis mice serum ALT and AST level

Glutamic-pyruvic transaminase (ALT) and glutamic-oxalacetic transaminease (AST) are the important indicators for reflecting liver function, into one in the present embodiment Step demonstrates influence of the N-acetylglucosamine processing to mice serum ALT and AST.

Serum ALT and AST detection:

Glutamic-oxalacetic transaminease (AST/GOT) assay kit (reitman-frankel method)

Glutamic-pyruvic transaminase (ALT/GPT) assay kit (reitman-frankel method)

Analysis of experimental results:

As shown in Figure 4 C, N-acetylglucosamine can the extremely significant glutamic-oxalacetic transaminease (AST/GOT) for inhibiting TAA to mediate Horizontal up-regulation, while the up-regulation of the extremely significant glutamic-pyruvic transaminase (ALT/GPT) for inhibiting TAA to mediate, prompt N- acetylamino Portugal Grape sugar has therapeutic effect for hepatosis in liver fibrosis.

The hepatic fibrosis in mice of 5. Glucosamine suppression therapy TAA of embodiment induction

In order to detect whether Glucosamine has therapeutic effect, hair to liver fibrosis caused by thioacetamide (TAA) Bright people constructs TAA hepatic fibrosis in mice model, and carries out intraperitoneal injection treatment with various dose Glucosamine, and observe amino The influence of glucose liver cirrhosis pathology morphology and liver function caused by TAA.

Modeling and dosage:

Animal packet and administration:

Healthy Balb/C mouse, male, 4-6 week old are purchased from Chinese Academy of Sciences Shanghai Experimental Animal Center.Mouse is randomly divided into 4 groups, normal group (being labeled as in figure " N ", 10), model group (being labeled as in figure " T ", 10), Glucosamine low dose group (being labeled as in figure " L ", 10), Glucosamine high dose group (being labeled as in figure " H ", 10), (the figure acceptance of the bid of silymarin group Note be " S ", 10).

Model group, Glucosamine low dose group, Glucosamine high dose group, silymarin group give TAA abdomen respectively Chamber continues TAA modeling after injecting 8 weeks, 8 weeks and gives each dosage Glucosamine intraperitoneal injection or silymarin filling simultaneously Stomach, model group give distilled water intraperitoneal injection；Normal group mouse gives distilled water intraperitoneal injection.At 12 weeks (after being administered 4 weeks), Put to death whole mouse.

The acquisition process of sample:

Experimental result and analysis:

As shown in Figure 5A: HE dyeing shows that normal lobuli hepatis structure is lost in model group (T) Mouse Liver, and liver cell is in water Sample becomes, and the fibr tissue of hyperplasia divides original lobuli hepatis, wraps normal lobuli hepatis, forms the pseudolobuli to differ in size, small Hepatic cell cords is disorganized in leaf, there is a large amount of fibroblasts and inflammatory cell infiltration in fibrous septum.With model group (T) phase Than Glucosamine group (L, H) fibrous connective tissue is loose, very thin, discontinuous, and the fibroblast in fibre bundle is reduced, fine Dimensionization degree makes moderate progress and is in dose dependent.

Sirius red stains show that fiber rope segmentation wrapping liver cell shape is stretched out in model group (T) central vein and portal area At pseudolobuli.Apparent fibrous septum is formed, normal lobuli hepatis structure disappears to form pseudolobuli.Glucosamine group (L, H) liver Interior fibrous septum narrows discontinuously, without complete pseudolobuli structure.Silymarin group (S) cell infiltration situation, pseudolobuli are formed And degree of fibrosis also has a degree of improvement compared with model group.

Sirius red stains area statistics show, in the mouse liver that Glucosamine induces TAA type i collagen deposition and Liver fibrosis has extremely significant improvement result, and is in dose dependent.

II. the mRNA level in-site of fibrosis indices in hepatic changes in liver fibrosis detection method, result and analysis

Inventor further progress Real-time PCR experiments detect the mRNA level in-site of fibrosis indices in hepatic in liver fibrosis Variation.

Organize RNA extracting:

RNA reverse transcription:

Real-time PCR detection:

Primer sequence:

Mouse GAPDH

Forward primer: GAGCGAGACCCCACTAACAT (SEQ ID NO.:1)

Reverse primer: TCTCCATGGTGGTGAAGACA (SEQ ID NO.:2)

Mouse collagen I α 1 (I α 1 of Collagen)

Forward primer: AGAGCATGACCGATGGATTC (SEQ ID NO.:3)

Reverse primer: CCTTCTTGAGGTTGCCAGTC (SEQ ID NO.:4)

Mouse α-SMA

Forward primer: ATGAAGCCCAGAGCAAGAG (SEQ ID NO.:5)

Reverse primer: TTTCCATGTCGTCCCAGT (SEQ ID NO.:6)

Experimental result and analysis:

The result of real-time PCR is as shown in Figure 5 B, should the result shows that, in liver fibrosis, Glucosamine can extremely be shown The mRNA level in-site for reducing α-SMA and type i collagen is write, and the reduction level is that Glucosamine is dose-dependent.

Serum ALT and AST detection:

Glutamic-oxalacetic transaminease (AST/GOT) assay kit (reitman-frankel method)

Glutamic-pyruvic transaminase (ALT/GPT) assay kit (reitman-frankel method)

Analysis of experimental results:

As shown in Figure 5 C, glutamic-oxalacetic transaminease (AST/GOT) level that Glucosamine extremely significant can inhibit TAA to mediate Up-regulation, while the up-regulation of the extremely significant glutamic-pyruvic transaminase (ALT/GPT) for inhibiting TAA to mediate, prompt Glucosamine for liver fibre Hepatosis has therapeutic effect in dimensionization.

Embodiment 6.OGA inhibitor PugNAc treatment inhibits the hepatic fibrosis in mice of TAA induction

In order to detect whether PugNAc has therapeutic effect, inventor to liver fibrosis caused by thioacetamide (TAA) TAA hepatic fibrosis in mice model is constructed first, and carries out stomach-filling treatment with various dose PugNAc, and observe PugNAc to TAA Caused by liver cirrhosis pathology morphology and α-smooth muscle actin (α-SMA) expression and distribution situation influence.

Modeling and dosage:

Group	Drug	Dosage	Administration frequency
				T	TAA	200mg/kg/ times	3 times a week
L	PugNAc low dosage	30mg/kg/d	Daily medication 1 time
				H	PugNAc high dose	100mg/kg/d	Daily medication 1 time
S	Silymarin	25mg/kg/d	Daily medication 1 time

Animal packet and administration:

Healthy Balb/C mouse, male, 4-6 week old are purchased from Chinese Academy of Sciences Shanghai Experimental Animal Center.Mouse is randomly divided into 4 groups, normal group (being labeled as in figure " N ", 10), model group (being labeled as in figure " T ", 10), PugNAc low dose group is (in figure Be labeled as " L ", 10), PugNAc high dose group (being labeled as in figure " H ", 10), silymarin group (" S " is labeled as in figure, 10).

Model group, PugNAc low dose group, PugNAc high dose group, silymarin group give TAA intraperitoneal injection 8 respectively Week continues TAA modeling after 8 weeks and give each dosage PugNAc intraperitoneal injection simultaneously or silymarin stomach-filling, model group are given Give distilled water intraperitoneal injection；Normal group mouse gives distilled water intraperitoneal injection.At 12 weeks (after being administered 4 weeks), put to death all small Mouse.

The acquisition process of sample:

Experimental result and analysis:

As shown in Figure 6A: HE dyeing shows that normal lobuli hepatis structure is lost in model group (T) Mouse Liver, and liver cell is in water Sample denaturation, sinus week fibrosis it is obvious, have a large amount of fibroblasts and inflammatory cell infiltration around central vein and portal area, arrange More disorder.Compared with model group (T), PugNAc group (L, H) fibrous connective tissue is loose, very thin, discontinuous, in fibre bundle Fibroblast is reduced, and degree of fibrosis makes moderate progress and is in dose dependent.

Sirius red stains show, model group (T) hepatic tissue collagenous fibres diffusivity hyperplasia and from portal area to lobuli hepatis Stretching, extension in tissue, segmentation wrapping hepatic tissue, forms apparent fibrous septum, normal lobuli hepatis structure disappears to form pseudolobuli. Fibrous septum narrows discontinuously in PugNAc group (L, H) liver, improves without complete pseudolobuli structure, and in dose dependent.Powder-refining with water Silibin group (S) cell infiltration situation, pseudolobuli are formed and degree of fibrosis also has a degree of improvement compared with model group.

Sirius red stains area statistics show that type i collagen deposition and liver are fine in the mouse liver that PugNAc induces TAA Dimensionization has extremely significant improvement result, and is in dose dependent.

Organize RNA extracting:

RNA reverse transcription:

Real-time PCR detection:

Primer sequence:

Mouse GAPDH

Forward primer: GAGCGAGACCCCACTAACAT (SEQ ID NO.:1)

Reverse primer: TCTCCATGGTGGTGAAGACA (SEQ ID NO.:2)

Mouse collagen I α 1 (I α 1 of Collagen)

Forward primer: AGAGCATGACCGATGGATTC (SEQ ID NO.:3)

Reverse primer: CCTTCTTGAGGTTGCCAGTC (SEQ ID NO.:4)

Mouse α-SMA

Forward primer: ATGAAGCCCAGAGCAAGAG (SEQ ID NO.:5)

Reverse primer: TTTCCATGTCGTCCCAGT (SEQ ID NO.:6)

Experimental result and analysis:

The result of real-time PCR is as shown in Figure 6B, should the result shows that, in liver, PugNAc can extremely significant reduction α-SMA With the mRNA level in-site of type i collagen, and the reduction level is PugNAc dose-dependent.

III. detection method, result and the analysis of mice serum ALT and AST level

Glutamic-pyruvic transaminase (ALT) and glutamic-oxalacetic transaminease (AST) are the important indicators for reflecting liver function, into one in the present embodiment Step demonstrates influence of the PugNAc processing to mice serum ALT and AST.

Serum ALT and AST detection:

Glutamic-oxalacetic transaminease (AST/GOT) assay kit (reitman-frankel method)

Glutamic-pyruvic transaminase (ALT/GPT) assay kit (reitman-frankel method)

Analysis of experimental results:

As shown in Figure 6 C, PugNAc can significantly inhibit the up-regulation of glutamic-oxalacetic transaminease (AST/GOT) level of TAA mediation, The up-regulation of the glutamic-pyruvic transaminase (ALT/GPT) for inhibiting TAA to mediate extremely significant simultaneously, prompts PugNAc for liver function in liver fibrosis Energy obstacle has therapeutic effect.

7. Glucosamine of embodiment increases the glycosylation modified level of O-GlcNAc of liver and hepatic stellate cells

In order to confirm the action target spot of the glycosylation modified protective effect to hepatic fibrosis in mice of O-GlcNAc, we are to reality The mouse liver for applying normal group in example 2, TAA model group, Glucosamine low dose group and Glucosamine high dose group carries out Immunohistochemical staining observes the variation of the glycosylation modified level of O-GlcNAc in mouse liver (especially hepatic stellate cells).

Modeling and dosage, animal packet and administration illustrate in example 2.

The acquisition process of sample:

After mouse liver takes out, 1 piece of OCT of 0.5cm × 0.5cm size hepatic tissue is cut in right lobe of liver and is embedded, liquid nitrogen flash freezer, It is made for frozen section.

Experimental method, result and the analysis of liver cirrhosis pathology Senile Mouse:

Slice:

The embedded tissue of OCT is fixed on the jelly platform of freezing microtome, the hepatic tissue section with a thickness of 8 μm is cut. It is sliced in the fixed 10min of cold acetone.

Immunohistochemistry fluorescent staining:

Frozen section PBS wash 10min × 3 time → lowlenthal serum close 4 DEG C of 30min → PDGFR β antibody be incubated overnight → 488,37 DEG C of incubation 4 DEG C of 1h → RL2 antibody, 594,37 DEG C of overnight incubation Alex fluor incubation 1h of Alex fluor, it is anti-every time PBS washes 10min × 3 time between body incubation.It takes pictures under Leica laser confocal microscope.

Experimental result and analysis:

As shown in Figure 7 A, immunofluorescence results are shown, compared with model group mouse, after Glucosamine administration, and Mouse Liver Dirty middle entirety RL2 dye level increases in dose dependent.

As shown in Figure 7 B, fluorescent staining result is analyzed using IPP software, liver star after discovery Glucosamine administration RL2 level is also in that dose dependent increases in shape cell (PDGFR β+), i.e. the glycosylation modified enhancing of O-GlcNAc.

Above results proved that Glucosamine administration can increase liver and the O-GlcNAc glycosylation of hepatic stellate cells is repaired Decorations are horizontal.

Embodiment 8.N- acetylglucosamine, Glucosamine and PugNAc inhibit Hepatic Stellate Cell Activation and collagen to produce It is raw

In order to confirm the glycosylation modified influence for activating and being proliferated to HSCs of O-GlcNAc in hepatic stellate cells (HSCs), I The primary hepatic stellate cells of separating mouse, by the way that N-acetylglucosamine is added, Glucosamine or PugNAc increase The glycosylation modified level of O-GlcNAc in HSCs, the change for detecting the glycosylation modified level of O-GlcNAc activate HSC, are extracellular Matrix generates and its regulation of proliferation.

Primary hepatic stellate cells isolation and culture

Preceding perfusate and enzyme prepare formula and the preparation of liquid

With NaOH tune pH value to 7.4, distilled water is added to be settled to 1L, after 0.22 μm of membrane filtration, 4 DEG C of preservations.

Pronase E (pronaseE) liquid:Pronase E 30mg is first dissolved in 50ml enzyme to prepare in liquid (EB), 37 DEG C hydrotropy, 0.22 μm of filtration, supplements EB to total volume 100ml.37 DEG C of water-baths are placed.

Collagen enzyme solution:Clostridiopetidase A 30mg is first dissolved in 50ml EB, 37 DEG C of hydrotropies, 0.22 μm of filtration, supplement EB to total volume 225ml.37 DEG C of water-baths are placed.

Clostridiopetidase A/pronase E dispersion liquid:Collagen 15mg, pronase E 15mg are first dissolved in 50ml enzyme and prepare liquid (EB) in, 37 DEG C of hydrotropies, 0.22 μm of filtration supplements EB to total volume 100ml.37 DEG C of water-baths are placed.

DNAse:DNAse 5mg is dissolved in 25ml EB, 0.22 μm of filtering, 4 DEG C of placements.

2 × SDS cell pyrolysis liquid:Tris 1.9376g, NaCl 3.5064g, EDTA0.1169g, SDS 4g, adds ddH₂O It is settled to 200ml, pH value is adjusted to 7.4 with HCl, is stored at room temperature spare.

1 × SDS cell pyrolysis liquid:50%2 × SDS cell pyrolysis liquid, 5% beta -mercaptoethanol (Fluka), 2% complete egg White enzyme inhibitor (Roche), 2%PhosSTOP inhibitors of phosphatases (Roche), 41%ddH₂O constant volume, -20 DEG C save backup.

Experimental method:

The experiment is the normal balb/C mouse hepatic stellate cells of separation, carries out the inspection of the protein expression level of cellular level It surveys.It is unrelated with TAA modeling animal mentioned in embodiment 1-6.

1. the separation and purifying of mouse primary hepatic stellate cells

Digestion in site: after 4 normal balb/C mouse anesthesias, fixation of lying on the back is put on super-clean bench, is disappeared with 75% alcohol Malicious fur, it is U-shaped to split abdomen, portal vein is exposed, portal vein punctures, and exits needle core, fixed remaining needle.Open constant flow pump, 5ml/ Min rinses liver blood with preceding perfusion liquid, cuts inferior caval vein bloodletting rapidly, and liver becomes filbert.After filling 3min, chain enzyme is changed Protease E, flow are adjusted to 3ml/min, digest through hepatic parenchymal cells.Later, clostridiopetidase A is perfused, after about 20min, liver is soft Change, stops perfusion.

Cell dispersion: liver being taken out, and is shredded, conical flask is put into, there is pronase E/ clostridiopetidase A dispersion liquid in bottle, 37 degree of shaking tables shake up, and 200 revs/min, shake 30min.

Cell purification: the suspension after dispersion is filtered by two layers of gauze into 2-3 root 50ml centrifuge tube, and DNAse is added in every pipe, 500g is centrifuged 7min, inhales and abandons on supernatant to cell mass at 1cm, every pipe adds DMEM 40ml and DNAse, suspension cell, and centrifugation is washed Wash 3-4 times it is limpider to supernatant.Before final step centrifugation, cell is combined into a pipe, after centrifugation, precipitating plus culture solution are made up to 10ml adds 3.85ml 36%Nycodenz, DNAse is added to mix well.Carefully in one layer of this mixed liquor upper berth culture solution, 4 DEG C, 1450g is centrifuged 20min.Centrifuge tube is removed in vertical position, the cell between culture solution and cell suspension is carefully drawn, after adding culture solution 500g, 7min are centrifuged twice, abandon supernatant, to contain the DMEM suspension cell of 10% fetal calf serum, 90 μ l cell suspensions are taken to count, purple Outer exciting light observation has autofluorescence cell number to account for total number of cells 90%-95%.

Cell is with 1 × 10⁶The concentration of a/ml is seeded in diameter 100mm plastic culture dish, in 5%CO₂, it is 95% moist empty The CO of gas₂It is cultivated in incubator, changes liquid every other day.

2. cell processing and detection

The detection of 2.1HSCs Activation

Be added in the primary stellate cells DMEM culture solution of culture 2 days/or 10ng/ml TGF-β 1 is not added, it is separately added into not Same drug-treated (5mM Glucosamine (GS), 100 μM of OGA inhibitor (PugNAc) or 5mMN- acetylglucosamine (NAG)) cell, is harvested afterwards for 24 hours.

Cell is flushed three times with 1ml PBS (pH=7.4), 1ml PBS is added, scrapes cell with cell scraper, is received Collect cell suspension in 1.5ml Eppendorf pipe；4 DEG C of 4000rpm are centrifuged 5min, to the greatest extent abandoning supernatant, be added appropriate volume 1 × SDS cell pyrolysis liquid, piping and druming are uniform；100 DEG C are boiled 10-20min, centrifuging and taking supernatant.Protein quantification, immunoblotting (ginseng Examine " molecular cloning ") detection protein expression level.

The detection of 2.2HSCs proliferative conditions

2 days primary stellate cells of culture are inoculated in 96 well culture plates, and 10³A/hole, is cultivated under the conditions of 5%CO2 by 37 DEG C, After cell is adherent, be added/or it is not added 10ng/ml PDGF and 5mM Glucosamine (GS), 100 μM of OGA inhibitor (PugNAc) or 5mM N-acetylglucosamine (NAG) is cultivated 24 hours, and WST-8 is added, and 37 DEG C are incubated for 1 hour, using logical The absorbance value that wavelength is 450nm wavelength is read with microplate reader (Universal Microplate Reader).

Experimental result and analysis:

As shown in Figure 8 A, using Glucosamine (GS), OGA inhibitor (PugNAc) or N-acetylglucosamine (NAG) processing can inhibit the expression up-regulation of α-SMA and type i collagen in the Primary mouse sternzellen of the mediation of TGF-β 1.

As shown in Figure 8 B, Glucosamine (GS), OGA inhibitor (PugNAc) or N-acetylglucosamine (NAG) can The proliferation for the Primary mouse sternzellen for inhibiting PDGF to mediate.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims

The glycosylation modified promotor of 1.O-GlcNAc is in preparation using it as liver fibrosis and its phase in prevention and/or treatment object Close the application in the product of the active material of symptom or disease, wherein the glycosylation modified promotor of O-GlcNAc be selected from One of the following group is a variety of: N-acetylglucosamine, PugNAC, Glucosamine, Glucosamine can pharmaceutically connect The salt received.
2. application as described in claim 1, which is characterized in that the liver fibrosis related symptoms or related disease are selected from down Group:

Hepatorenal syndrome caused by liver fibrosis, liver function caused by cirrhosis, liver fibrosis caused by liver fibrosis Primary peritonitis caused by dysbolism, liver fibrosis, oneself immunity hepatitis caused by liver fibrosis, liver fibrosis cause Primary sclerotic cholangitis, upper digestive tract variceal bleeding caused by ascites, liver fibrosis caused by liver fibrosis with And hepatic encephalopathy caused by liver fibrosis；

Following symptom caused by liver fibrosis: tired, powerless；Appetite stimulator, Nausea and vomiting；Chronic indigestion symptom；Slowly Property gastritis；Chronic hepatitis；Accompanying infection chronic type b, the third type, the viral hepatitis type D, snail fever of liver fibrosis；Slowly Property alcoholic liver disease, chronic drug-induced liver disease, oneself immunity hepatitis；Primary, biliary cirrhosis and primary, hardening Property cholangitis；

Liver fibrosis is relevant: the activation of hepatic stellate cells, the extracellular matrix accumulation of the activation mediation of hepatic stellate cells, serum Transaminase level increases, liver organization inflammatory reaction.
3. application as described in claim 1, which is characterized in that the liver fibrosis and its related symptoms or disease are selected from down Group:

Cirrhosis caused by liver fibrosis；

Following symptom caused by liver fibrosis: abdominal distension gas, constipation or diarrhea；Sour regurgitation, belch, hiccup, upper abdomen secret anguish and on Abdomen is glutted, dull pain in liver；Spider angioma, nosebleed epistaxis, bleeding gums, skin and mucous membrane have purple plague purpura or blutpunkte.
4. application as described in claim 1, which is characterized in that the object is mammal.
5. application as described in claim 1, which is characterized in that the object is selected from: primate, rodent, domestic animal, lactation are dynamic Pet object.
6. application as described in claim 1, which is characterized in that the object is behaved.
7. application as described in claim 1, which is characterized in that the product is pharmaceutical composition.
8. application as described in claim 1, which is characterized in that the product is medicine box.
9. the use as claimed in claim 7, which is characterized in that the glycosylation modified promotor of O-GlcNAc accounts for the drug The 0.001-99.9wt% of composition total weight；Alternatively, the glycosylation modified promotor of O-GlcNAc is in the pharmaceutical composition Unit dose in object is 0.01-1000mg/ agent.
10. the use as claimed in claim 7, which is characterized in that the glycosylation modified promotor of O-GlcNAc accounts for the medicine The 0.1-99wt% of compositions total weight；Alternatively, the glycosylation modified promotor of O-GlcNAc is in described pharmaceutical composition In unit dose be 0.1-500mg/ agent.
11. the use as claimed in claim 7, which is characterized in that the glycosylation modified promotor of O-GlcNAc is in the medicine Unit dose in compositions is 0.1-100mg/ agent.
12. the use as claimed in claim 7, which is characterized in that the dosage form of described pharmaceutical composition is selected from: tablet, powder agent, Injection, granule, syrup, capsule, solution, suppository or ointment.
13. application as described in claim 1, which is characterized in that the product also include prevention and/or treatment liver fibrosis and Other active materials of its related symptoms or disease.
14. application as claimed in claim 13, wherein other active materials are selected from: antiviral drugs, anti-inflammatory drug, Anti-oxidation medicine inhibits hepatic stellate cells differentiation activation drug, angiotensin converting enzyme inhibitor.
15. application as claimed in claim 13, wherein other active materials are selected from: interferon-' alpha ', Lamivudine, Ah De Fuwei, Ribavirin, glucocorticoid, recombinant human interleukin-11 0, silymarin, vitamin E, Apoptosis, Sorafenib.
The glycosylation modified promotor of 16.O-GlcNAc preparation using its as prevent and/or treatment object in hepatic stellate cells Application in the product of overactivity and/or the active material of the relevant disease of hyper-proliferative, wherein the O-GlcNAc glycosyl Changing modification promotor is one of to be selected from the group or a variety of: N-acetylglucosamine, PugNAC, Glucosamine, amino The pharmaceutically acceptable salt of glucose.
17. application as claimed in claim 16, which is characterized in that the disease is selected from: by hepatic stellate cells overactivity and/ Or liver fibrosis caused by hyper-proliferative, structural remodeling, the raising of sinus hepaticus internal pressure or portal hypertension in liver.