CN105154334A - Geotrichum candidum and application thereof in greenhouse soil remediation - Google Patents
Geotrichum candidum and application thereof in greenhouse soil remediation Download PDFInfo
- Publication number
- CN105154334A CN105154334A CN201510439948.1A CN201510439948A CN105154334A CN 105154334 A CN105154334 A CN 105154334A CN 201510439948 A CN201510439948 A CN 201510439948A CN 105154334 A CN105154334 A CN 105154334A
- Authority
- CN
- China
- Prior art keywords
- soil
- warmhouse booth
- parts
- soil remediation
- geotrichum candidum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses geotrichum candidum and application thereof in greenhouse soil remediation. By carrying out strain isolating, screening, breeding and domesticating on a greenhouse soil sample as well as through determination of morphological characteristics and rDNA ITS sequence of the obtained strain and through phylogenetic analysis, the effect of the strain geotrichum candidum XHS0030B CGMCC NO.9435 in greenhouse soil remediation is determined; 70-80 parts of geotrichum candidum, 30-50 parts of rhodopseudomonas palustris, 20-40 parts of candida utilis and 10-30 parts of mortierella alpina are mixed, and a mixed strain liquid is fully adsorbed in a carrier and is mixed with accessories, wherein the carrier is selected from greenhouse soil and the accessories include urine and calcium superphosphate; a greenhouse soil remediation compound is prepared by virtue of a fermentation technology; and the soil remediation compound has an outstanding technical effect in greenhouse soil remediation.
Description
Technical field
The present invention relates to agriculture technical field of microbe application, specifically, the geotrichum candidum that the present invention relates to a kind of seed selection voluntarily screening and the technical field applied in warmhouse booth soil remediation.
Background technology
In intensive farming is produced, soil, as a space time continuum, must consider the Spatial Variability of soil property when Precision management.Instruct because peasant lacks necessary fertilising at present, many peasants carry out fertilizing management according to the experience of oneself mostly, and think " high investment, high production ", and this causes a large amount of blindly excessive fertilising phenomenon often to occur.But, although excessive fertilising can improve the output of crop in a short time, on long terms, excessive fertilising can cause the productivity of soil to decline, and crop failure, also can cause the danger of groundwater pollution simultaneously.
Soil in protected field salinification is the Main Barrier Factors of generally acknowledged greenhouse vegetable Sustainable Production.Because vegetable grower is in order to pursue high economic benefit, a large amount of application fertilizers or fertilizer, the pouring of irrational a large amount of poor-quality water, becomes the main source of soil salt simultaneously.The use of a large amount of inorganic fertilizer for many years, soil salt content can improve greatly, produces directly harm, affect vegetable growth to edatope.According to pertinent data, vegetables in vinyl house is endangered by salinity, even if not yet reach the degree that visible injury occurs crop, output generally also will reduce by 20%; The Soil structure of booth is damaged simultaneously, causes soil compaction, and new soil is dead soil, farm crop cannot be drawn into whole nutrition from new soil, cause plant growth not prosperous, angry defect, the new canopy plantation of peasant's the first three years is almost alive native, low in economic efficiency based on fertilizer.As can be seen here, understand the Coupling effects of salt ion in soil in protected field in depth, research soil-repairing agent, alleviate and avoid salinification to occur, this has great theory and practice meaning in agriculture production management and Sustainable development.
At present, because facility cultivation multiple crop index is high, output is high, and can realize balancing the production throughout the year, and therefore, facility cultivation has become one of leading industry of China's agriculture production.But generally cause greenhouse soil quality degradation, nutrient imbalance due to too high Land_use change intensity and improper Agricultural management after plantation 3-5, salinification is serious, thus causes vegetable crop to decline gradually, plant growth is bad, fruit distortion.Aeolian sandy soil is the maximum soil type of continental Arid&semi-arid area distribution area, aeolian sandy soil organic content is generally at 0.2%-0.6%, soil profile is without obvious humus layer and eluviation and illuviation layer, generally be made up of thin and light humus layer and dark and thick chorizon, quality is homogeneous, the coarse sand of particle diameter > 0.02mm and fine sand composition in soil particle composition, and fine sand accounts for 85%-90%, clay and flour sand content are little, almost without the chad of > 2mm; Chemical constitution, based on silicon-dioxide, is secondly alchlor and Indian red, and humic acid composition is based on fulvic acid; Add continental dry climate, quantity of precipitation is few, and steam output is large, and dry wind is many, and the Windy Days time length is long.Although have many about studying the report of organic materials on the impact of soil property and crop yield large Tanaka, but about from warmhouse booth soil, separation screening can improve the bacterial classification of warmhouse booth soil, and utilize seed selection voluntarily to screen geotrichum candidum that domestication obtains and other multi-cultur es are prepared soil-repairing agent according to the blending of bacterial classification, suitability and security basic demand and strain properties and be have not been reported for the research improveing warmhouse booth soil.
Summary of the invention
Merge with multi-cultur es is compatible the state of the art preparing warmhouse booth soil-repairing agent about screening geotrichum candidum as excellent species from warmhouse booth soil mutually for having no in prior art, the present invention aims to provide a kind of geotrichum candidum and for the application in warmhouse booth soil remediation.The present invention by isolating a collection of microorganism strains in warmhouse booth soil, therefrom separate the bacterial strain that a strain is numbered XHS0030B, and by utilizing the geotrichum candidum being numbered XHS0030B, with Rhodopseudomonas palustris, Candida utilis prepares warmhouse booth soil-repairing agent with compatible the fusion mutually of Mortierella alpina, improvement and activating soil effectively, objectionable impurities in degraded soil, solve the salinification problem of soil, soil nutrient in facility plastic greenhouse is solved for reality unbalance, salinification, desertify or the serious present situation that hardens, comprehensively the disadvantageous effect for Vegetable produce is reduced to bottom line, be conducive to the yield and quality improving vegetables, obtain good technique effect, there is extensively actual value in warmhouse booth soil remediation.
The present invention adopts main technical scheme:
By the separation screening of microbial strains, in warmhouse booth soil, isolate a collection of microorganism strains, through being separated further, screening, seed selection, domestication, obtain the geotrichum candidum bacterial strain that a strain is numbered XHS0030B.By carrying out morphological specificity, physio-biochemical characteristics and rDNAITS section determined dna sequence and Phylogenetic Analysis to obtained bacterial strain, tentatively determine its classification position.Simultaneously, the geotrichum candidum being numbered XHS0030B is prepared warmhouse booth soil-repairing agent with compatible the fusion mutually of Rhodopseudomonas palustris, Candida utilis and Mortierella alpina, assess according to weight part ratio, mix with geotrichum candidum 70 parts-80 parts, Rhodopseudomonas palustris 30 parts-50 parts, Candida utilis 20 parts-40 parts and Mortierella alpina 10 parts-30 parts, bacterial classification mixed solution is fully adsorbed in carrier, and mix mutually with auxiliary material, prepare the agent of warmhouse booth soil remediation group by utilizing fermentation technique.Utilize the soil remediation group agent of preparation can improve the quality of warmhouse booth soil, effectively prevent and treat all kinds of diseases of vegetables breeding time, the disadvantageous effect of warmhouse booth soil to Vegetable produce is reduced to bottom line, effectively improvement and activating soil, degraded soil in objectionable impurities, solution soil salinification problem, disadvantageous effect in being produced fruits and vegetables by soil is reduced to bottom line, be conducive to the yield and quality improving vegetables, obtain good technique effect, there is the meaning and function of reality in warmhouse booth soil remediation.
The present invention specifically provides a kind of geotrichum candidum (GeotrichumCandidum), by being separated in warmhouse booth soil, screening, tame and cultivating, obtain a collection of fungal microbe bacterial strain, therefrom filter out the bacterial strain that a strain is numbered XHS0030B, through microbiological classification and qualification, belong to geotrichum candidum (GeotrichumCandidum).
Concrete, the invention provides the geotrichum candidum (GeotrichumCandidum) that strain number is XHS0030B.This bacterial strain was preserved in budapest treaty microorganism International Depository Authority before the applying date: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC).Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101.Preservation date is on July 10th, 2014, and preserving number is CGMCCNo.9435.This bacterial strain optimum growing condition is: temperature 25 DEG C, and substratum adopts potato dextrose agar (PDA) substratum, culture condition: pH5-7, time 24h-48h.This bacterial strain produces white, in lint shape or powdery film, has fungal filament, some branches, more or less, modes of reproduction is fragmentation to tabula, and the arthrospore of formation is single or connect chaining, spore is in oval or circular, and bacterium colony is planar diffusion, and growth is fast, flat, front oyster white, back side khaki color, diameter 40-70mm, short flannel shape or be bordering on powdery, has concentric turns can radioactive rays, have in umbo.Can protolysate, wherein most can liquefy gelatin, peptonized milk, minority can only peptonized milk, can not liquefy gelatin, is accredited as geotrichum candidum (GeotrichumCandidum) through microbiology.With reference to " Fungal identification handbook ", the qualification of system Physiology and biochemistry is carried out to numbering XHS0030B bacterial strain, detect through Physiology and biochemistry and determine that numbering XHS0030B bacterial strain is the member in Geotrichum (Geotrichum).By the comparison of BLAST homology, after the ITSrDNA sequence nucleotide sequence of strain X HS0030B carries out BLAST analysis in ncbi database, constructing system evolutionary tree, this is numbered strain X HS0030B and GeotrichumcandidumisolateL11B and is in minimum branch, be its allied species, its homology is 94%, and then this strain X HS0030B is defined as Geotrichumcandidum, through said system taxonomy qualification classification, demonstrate geotrichum candidum provided by the invention (GeotrichumCandidum) and have certain physio-biochemical characteristics difference and the otherness of molecular level with common geotrichum candidum, according to bacterial classification Analysis of The Physiological And Biochemical Properties, the comprehensive identification of molecular level analysis and systematics, although the bacterial classification being numbered XHS0030B has obvious difference with common geotrichum candidum in physio-biochemical characteristics and molecular level, geotrichum candidum (GeotrichumCandidum) is accredited as from taxonomy.
Further, the invention provides the application of a kind of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435 in warmhouse booth soil remediation.By utilize XHS0030B bacterial strain prepare soil-repairing agent be applied to improvement warmhouse booth soil, effectively improvement and activating soil, degraded soil in objectionable impurities, solution soil salinification problem, obtain significantly good technique effect.
Meanwhile, the present invention specifically provides the preparation method of a kind of warmhouse booth soil remediation group agent, and concrete preparation method's step is as follows:
(1) inoculate: the solid medium preparing geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435, Rhodopseudomonas palustris, Candida utilis and Mortierella alpina four kinds of bacterial classifications, strictly aseptic technique is carried out after sterilizing, be forwarded to flat board from inclined-plane, cultivate 3 days at temperature 25 DEG C.
(2) one-level is cultivated: from the solid medium step (1), picking list bacterium colony is forwarded to and is equipped with in the 50mL Erlenmeyer flask of liquid nutrient medium, aseptic technique, 25 DEG C, 120r/min cultivates 24h-48h.
(3) second order fermentation: above-mentioned steps one-level is cultivated strain inoculation in the 500mL Erlenmeyer flask filling liquid nutrient medium, aseptic technique, 25 DEG C, 120r/min cultivates 36h-72h.
(4) compatibility of strain fermentating liquid: assess according to weight part ratio, geotrichum candidum second order fermentation liquid 70 parts-80 parts, Rhodopseudomonas palustris second order fermentation liquid 30 parts-50 parts, Candida utilis second order fermentation liquid 20 parts-40 parts and Mortierella alpina second order fermentation liquid 10 parts-30 parts prepared by optional step (3) mix, and prepare the mixed solution of composite bacteria.
(5) auxiliary material is added: be fully adsorbed in carrier by composite bacteria mixed solution prepared by step (4), carrier selects warmhouse booth soil; Auxiliary material adopts urea and calcium superphosphate, and wherein the weight ratio of urea and calcium superphosphate is 1:2.5; The consumption of carrier and auxiliary material is the mixing of 1:3 proportioning according to weight ratio, add water to water content 40-70%, then the materials that mix of every cubic metre of carrier and auxiliary material add composite bacteria mixed solution 100-300g prepared by above-mentioned steps (4) by volume, and mix, prepare the agent of warmhouse booth soil remediation group.
Further, the invention provides the application of application above-mentioned soil remediation group agent in warmhouse booth.Geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435 is obtained by utilizing screening and separating domestication voluntarily, by practice and other Rhodopseudomonas palustriss, Candida utilis and Mortierella alpina four kinds of bacterial classification test for fusion, facts have proved that the soil-repairing agent of preparation is applied to the soil of improvement warmhouse booth, for the objectionable impurities in improvement and activating soil, degraded soil, solve the salinification problem of soil, obtain the technique effect significantly given prominence to.
The present invention further provides the application method of above-mentioned warmhouse booth soil remediation group agent: composting at air themperature 20-30 DEG C; Composting carries out under covering straw screen or mat, and composting starts turning in latter every 30 days once, and during turning, moisturizing is to water content 40-70%, composting time remaining 120 days; Directly soil can be applied to after airing to drying after composting completes.
The geotrichum candidum being numbered XHS0030B selected by the present invention screens to obtain from warmhouse booth soil, simultaneously, although Rhodopseudomonas palustris, Candida utilis and Mortierella alpina are common bacterial classification, but, the specificity of microbial strains and complicacy, various different bacterial classification can be used by compound compatibility, by the blending of various bacterial classification, compatibleness is combined with each bacterial classification attribute, the security of the composite bacteria considered, particularly be applied in warmhouse booth soil remediation and all need a large amount of infrastest checkings, the present invention is based on fundamental research accumulation in early stage, by adopting the composite test of bacterial classifications different in a large number, prove that the present invention adopts composite bacteria to be mixed with warmhouse booth soil-repairing agent by interpolation carrier and auxiliary material, warmhouse booth soil-repairing agent is according to weight ratio proportioning geotrichum candidum 70 parts-80 parts, Rhodopseudomonas palustris 30 parts-50 parts, Candida utilis 20 parts-40 parts and Mortierella alpina 10 parts-30 parts mixing, bacterial classification mixed solution is fully adsorbed in carrier plastic shed soil, and mix mutually with selecting suitable auxiliary material, the agent of warmhouse booth soil remediation group is prepared by technique, and the soil remediation group agent obtained is applied by booth production practice, for effectively improveing and activating soil, objectionable impurities in degraded soil, solve the aspects such as the salinification problem of soil all have great importance and act on.
By implementing the concrete summary of the invention of the present invention, following beneficial effect can be reached:
(1) bacterial strain being numbered XHS0030B of the present invention's screening has stronger growth and breeding ability, and growth velocity is fast, and hereditary property is stablized, and has specific effect to soil remediation.
(2) the warmhouse booth soil remediation group agent that prepared by the present invention is conducive to the soil improveing warmhouse booth, objectionable impurities effectively in improvement and activating soil, degraded soil, the problem such as secondary salinization of solution soil, disadvantageous effect in being produced fruits and vegetables by soil is reduced to bottom line, be conducive to the yield and quality improving vegetables, obtain good technique effect, therefore there is the extensively value be suitable in warmhouse booth soil remediation.
Accompanying drawing explanation
Fig. 1 is shown as the colonial morphology figure of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435, and wherein, A is bacterium colony front, and B is bacterium colony reverse side.
Fig. 2 is shown as the mycelia microscopic examination figure of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435.
Fig. 3 is shown as the mycelia of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435 and the micro-structure diagram of spore, and wherein, A is the microstructure of spore, and B is the microstructure of mycelia.
Fig. 4 is shown as the ITSrDNA sequential system evo-devo tree graph of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435.
Embodiment
, for embodiment, the present invention is described below, but the present invention is not limited to following embodiment.
The all raw and auxiliary materials selected in the present invention, and the spawn culture method selected is all well known selecting, the % related in the present invention is weight percentage, unless otherwise indicated.
Embodiment one: the separation of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435, screening and qualification
1, the Isolation and screening of bacterial classification
(1) be separated
Geotrichum candidum used in the present invention is serious from the typical salinification in Kuerle, South Sinkiang, Xinjiang, soil desertification or the outstanding warmhouse booth soil of knot tying sampling be separated, analyze according to bacterial classification methanism of antagonism, the preliminary screening soil issues such as the soil salinization, soil compaction gone out warmhouse booth soil has the bacterial strain of certain antagonistic ability.Traditional plating method is utilized to isolate microorganism in soil layer, plate streak purifying bacterial strain, with different culture temperature, pH value, substratum for enrichment condition, filter out a collection of well-grown microorganism strains, therefrom preferably a strain is numbered the bacterial strain of XHS0030B.
Separating step: according to gradient dilution method, take 10g pedotheque in 90mL stroke-physiological saline solution, carries out gradient dilution after 25 DEG C of activation 30min, chooses 10
-2, 10
-3, 10
-4diluent coats the flat board of PDA substratum respectively, each process 3 repetition, in 25 DEG C of cultivations.The bacterium colony that picking shape, size, color etc. are different after growing bacterium colony distinguishes streak inoculation in new isolation medium PDA substratum, until fall without miscellaneous bacteria.A bacterial strain part after purifying is adopted the mode preservations such as lyophilized products ampoul tube, glycerine pipe and liquid nitrogen, and a part is stored in 4 DEG C and is directly used in follow-up study.
(2) culture condition
By the inoculation of purifying on solid potato culture medium inclined-plane, cultivate 2 days in 30 DEG C, put into 4 DEG C of refrigerators and save backup.
Concrete: this strain culturing temperature is 10-38 DEG C, and optimum temperuture is 25 DEG C, and growth pH is 3-11, and optimal pH is 5-7; This growth is in PDA media surface.
Being prepared as of described PDA substratum: potato is cleaned peeling, gets 200 grams and be cut into small pieces, add water 1000 milliliters, after boiling half an hour, supply moisture.In filtrate, add 10 grams of agar, to boil after dissolving with sucrose 20 grams, supply moisture, packing, sterilizing, PDA solid medium can be prepared.
By being separated warmhouse booth Soil Microorganism, screening and cultivating, obtain a collection of microorganism strains, therefrom filter out the bacterial strain that a strain is numbered XHS0030B, through microbiological classification and qualification, this bacterial strain belongs to GeotrichumCandidum.The present invention adopts strain number to be the geotrichum candidum (GeotrichumCandidum) of XHS0030B, and this bacterial strain was preserved in budapest treaty microorganism International Depository Authority before the applying date: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC).Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101.Preservation date is on July 10th, 2014, and preserving number is CGMCCNo.9435.Geotrichum candidum (GeotrichumCandidum) is accredited as through microbiology.This bacterial strain optimum growing condition is: temperature 25 DEG C, and substratum adopts PDA substratum, culture condition: temperature 25 DEG C, pH5-7, time 24h-48h; This bacterial strain can produce white, in lint shape or powdery film, has fungal filament, the branch had, tabula more or less; Modes of reproduction is fragmentation, and the arthrospore of formation is single or connect chaining, and spore is in oval or circular; Bacterium colony is planar diffusion, and growth is fast, flat, front oyster white, back side khaki color, diameter 40-70mm, short flannel shape or be bordering on powdery, has concentric turns can radioactive rays, have in umbo; GeotrichumCandidum bacterium is accredited as through microbiology.Identify being numbered XHS0030B bacterial strain with reference to " Fungal identification handbook ", in conjunction with the Physiology and biochemistry comprehensive detection determination bacterium numbering member that to be XHS0030B bacterial strain be in Geotrichum (Geotrichum), be geotrichum candidum (GeotrichumCandidum) from taxonomy angular divisions.
By the comparison of BLAST homology, after the ITSrDNA sequence of strain X HS0030B carries out BLAST analysis in ncbi database, constructing system evolutionary tree, this strain X HS0030B and GeotrichumcandidumisolateL11B is in minimum branch, it is its allied species, but from molecular level analysis, bacterium numbering is that XHS0030B and common geotrichum candidum have obvious difference, but is defined as geotrichum candidum (GeotrichumCandidum) from taxonomy angle and then by this strain X HS0030B.
This strain X HS0030B is at PDA substratum well-grown, prove that XHS0030B can utilize tween 80 through identification plate test, N-ethanoyl-β-D-Glucose amine, ribitol, L-arabinose, D-arabitol, arbutin, D-cellobiose, D-wood sugar, oxysuccinic acid, dextrin, erythritol, maltonic acid, a-D-glucose, PEARLITOL 25C, Beta-methyl-D-Glucose glycosides, 6-O-D-Glucopyranose acyl, D-fructofuranose, D-glucuronic acid, glycerol, glycogen, trisaccharide maltose, quinic acid, Pidolidone, adenosine-5 ˊ monophosphate, this salt of a-D-glucose-1-phosphorus, D-ribose, saligenin, D-glucitol, L-sorbose, stachyose, K-trehalose, turanose, Xylitol, y-aminobutyric acid, bromosuccinic acid, FUMARIC ACID TECH GRADE, beta-hydroxy-butanoic acid, y-hydroxybutyric acid, P-HPAA, a-ketoglutaric acid, D-malic acid, D-Glucose diacid, sebacic acid, succsinic acid, succsinic acid methyl ester, L-Beta Alanine acid amides, L-Beta Alanine, L-alanyl Padil, altheine, L-Aspartic acid, glycyl-L-glutamic acid, L-phenyl handle propylhomoserin, proline(Pro), Pyrrolidonecarboxylic acid, Serine, L-revives amino acid, 2-monoethanolamine, rotten glycosides, adenosine.
The factor such as temperature, pH to strain X HS0030B growth effect, in table 1.
Table 1: the impact that the factor such as temperature, pH grows strain X HS0030B
Observed and Determination of Physiological And Biochemical Indices by the above-mentioned thalli morphology for bacterial classification geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435, cultural characteristic, namely utilize test, catalase test, glycitols fermentation test, nitrate reduction test, Starch Hydrolysis, gelatine liquefication, indole test and H by thalli morphology observation, strain culturing observation of characteristics, aerobism and mobility mensuration, growth temperature mensuration, Salt tolerance, Citrate trianion
2s produces test, and the method all with reference to " Fungal identification handbook " is carried out, and be XHS0030B comprehensive identification is geotrichum candidum (GeotrichumCandidum) from bacterium classification angle by bacterium numbering.
Embodiment two: the molecular level of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435
1, the ITSrDNA sequence of pcr amplification geotrichum candidum and order-checking thereof
Single bacterium colony of picking a small amount of XHS0030B bacterial strain, put into the EP pipe filling 25 μ L sterilized waters, 100 DEG C are boiled 8-10min, put into rapidly mixture of ice and water 5min afterwards.Centrifugal 10000r/min, 5min, 4 DEG C of preservations, the used time gets supernatant.
The structure of ITSrDNA gene sequencing and systematic evolution tree thereof: the STb gene extracting bacterial isolates according to a conventional method, with deionized water, dilution universal primer ITSl and ITS4 is carried out the pcr amplification of ITSrDNA section, design of primers is as follows:
ITS1(F)：5'-TCCGTAGGTGAACCTGCGG-3'
ITS4(R)：5'-TCCTCCGCTTATTGATATGC-3'
The reaction system of 50 μ l contains: 10 × PCR damping fluid 5 μ l, each 20pmol of primer, template DNA (1000ng/ μ l) 1 μ l, TaqTM (TaKaRa company) 0.5U, dNTP8 μ l.Pcr amplification condition: first at 94 DEG C of denaturation 2min, then 98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 1.5min, circulate 30 times, finally extends 10min at 72 DEG C.The purifying of PCR primer: the PCR primer of getting 8 μ l, electrophoresis in 1% sepharose, reclaims object fragment with TaKaRaPCRFragmentRecoveryKit from glue, is dissolved in the high purity water of 20 μ l.Make sequencing primer to PCR primer PA (+) and PB (-), measure ITSrDNA sequence, the gene order of bacterial classification XHS0030B is see attached gene order table.Need according to the single-row gene order table of the gene order provided.
3, the comparison of ITSrDNA gene order and Phylogenetic Analysis
Nucleotide sequence in the ITSrDNA sequence and GenBank database that obtain checking order carries out BLAST analysis, therefrom obtain close ITSrDNA sequence, after the ITSrDNA sequence of XHS0030B is carried out BLAST analysis in ncbi database, constructing system evolutionary tree.Shown in accompanying drawing 4, between strain X HS0030B and GeotrichumCandidumisolateL11B, evolutionary distance is the shortest, is the allied species of GeotrichumCandidumisolate.In conjunction with Morphologic Characteristics and the physio-biochemical characteristics of XHS0030B, determine that it is geotrichum candidum and belong to.By measured ITSrDNA sequence inputting Genbank, tetraploid rice is carried out with Blast program, find that the similarity of the ITSrDNA sequence of it and GeotrichumCandidumisolateL11B is maximum, be 94%, thus determine that it is GeotrichumCandidum further.In conjunction with Morphologic Characteristics and the physio-biochemical characteristics of XHS0030B, to determine that it is bacterium numbering be XHS0030B comprehensive identification is geotrichum candidum (GeotrichumCandidum).
Embodiment three: the preparation of warmhouse booth soil remediation group agent
(1) inoculate: the solid medium preparing geotrichum candidum, Rhodopseudomonas palustris, Candida utilis and Mortierella alpina four kinds of bacterial classifications, strictly carry out aseptic technique after sterilizing, be forwarded to flat board from inclined-plane, cultivate 3 days at temperature 28 DEG C.
(2) one-level is cultivated: from the solid medium step (1), picking list bacterium colony is forwarded to and is equipped with in the 50mL Erlenmeyer flask of liquid nutrient medium, aseptic technique, 25 DEG C, 120r/min cultivates 24h-48h.
(3) second order fermentation: one-level is cultivated strain inoculation in the 500mL Erlenmeyer flask filling liquid nutrient medium, aseptic technique, 25 DEG C, 120r/min cultivates 36h-72h.
(4) compatibility of strain fermentating liquid: the geotrichum candidum second order fermentation liquid 70 parts-80 parts step (3) prepared, Rhodopseudomonas palustris second order fermentation liquid 30 parts-50 parts, Candida utilis second order fermentation liquid 20 parts-40 parts and Mortierella alpina second order fermentation liquid 10 parts-30 parts mix, and are prepared as the mixed solution of bacterial classification.
(5) auxiliary material is added: be fully adsorbed in carrier by bacterial classification mixed solution prepared by step (4), carrier is warmhouse booth soil; Auxiliary material is urea and calcium superphosphate, and wherein the weight ratio of urea and calcium superphosphate is 1:2.5; The weight ratio of carrier and auxiliary material is 1:3; Add water to water content 40-70%, then by volume every cubic metre add soil-repairing agent 100-300g, and to mix, be the warmhouse booth soil-repairing agent of preparation.
Meanwhile, further, the invention provides the application method of warmhouse booth soil-repairing agent: composting at air themperature 20-30 DEG C; Composting carries out under covering straw screen or mat, and composting starts turning in latter every 30 days once, and during turning, moisturizing is to water content 40-70%, composting time remaining 120 days; Directly soil can be applied to after airing to drying after composting completes.
In the present invention, selected Candida utilis (Candidautilis), Mortierella alpina (Mortierellaalpina) and Rhodopseudomonas palustris (Rhodosedoseudomouaspadustris) are all common bacterial classification, and those of ordinary skill in the art can be obtained by public's channel.Meanwhile, bacterial classification Candida utilis (Candidautilis) used, Mortierella alpina (Mortierellaalpina) and Rhodopseudomonas palustris (Rhodosedoseudomouaspadustris) fermented liquid conventionally in common method and corresponding medium preparing obtain.
The geotrichum candidum being numbered XHS0030B selected by the present invention screens to obtain from warmhouse booth soil, simultaneously, although Rhodopseudomonas palustris, Candida utilis and Mortierella alpina are common bacterial classification, but, the specificity of microbial strains and complicacy, various different bacterial classification can be used by compound compatibility, by the blending of various bacterial classification, compatibleness is combined with each bacterial classification attribute, the security of the composite bacteria considered, particularly be applied in warmhouse booth soil remediation and all need a large amount of infrastest checkings, the present invention is based on fundamental research accumulation in early stage, by adopting the composite test of bacterial classifications different in a large number, prove that the present invention adopts composite bacteria to prepare warmhouse booth soil-repairing agent by adding auxiliary material, the agent of warmhouse booth soil remediation group according to weight ratio proportioning by geotrichum candidum 70 parts-80 parts, Rhodopseudomonas palustris 30 parts-50 parts, Candida utilis 20 parts-40 parts and Mortierella alpina 10 parts-30 parts mixing, bacterial classification mixed solution is fully adsorbed in carrier plastic shed soil, and mix mutually with selecting suitable auxiliary material, the agent of warmhouse booth soil remediation group is prepared by technique, and the soil remediation group agent obtained is applied by booth production practice, for effectively improveing and activating soil, objectionable impurities in degraded soil, solve the aspects such as the secondary salinization problem of soil all have great importance and act on.
Embodiment four: the preparation of warmhouse booth soil remediation group agent
(1) inoculate: the solid medium preparing geotrichum candidum, Rhodopseudomonas palustris, Candida utilis and Mortierella alpina four kinds of bacterial classifications, strictly carry out aseptic technique after sterilizing, be forwarded to flat board from inclined-plane, cultivate 3 days at temperature 25 DEG C.
(2) one-level is cultivated: from the solid medium step (1), picking list bacterium colony is forwarded to and is equipped with in the 50mL Erlenmeyer flask of liquid nutrient medium, aseptic technique, 25 DEG C, 120r/min cultivates 24h-48h.
(3) second order fermentation: one-level is cultivated strain inoculation in the 500mL Erlenmeyer flask filling liquid nutrient medium, aseptic technique, 25 DEG C, 120r/min cultivates 36h-72h.
(4) compatibility of strain fermentating liquid: the geotrichum candidum second order fermentation liquid 80 parts step (3) prepared, Rhodopseudomonas palustris second order fermentation liquid 30 parts, Candida utilis second order fermentation liquid 40 parts and Mortierella alpina second order fermentation liquid 30 parts mix, and are prepared as the mixed solution of bacterial classification.
(5) auxiliary material is added: be fully adsorbed in carrier by bacterial classification mixed solution prepared by step (4), carrier is warmhouse booth soil; Auxiliary material is urea and calcium superphosphate, and wherein the weight ratio of urea and calcium superphosphate is 1:2.5; The weight ratio of carrier and auxiliary material is 1:3; Add water to water content 40-70%, then every cubic metre of carrier adds soil-repairing agent 250g with auxiliary material mixing materials by volume, and mixes, and is the warmhouse booth soil remediation group agent of preparation.
Meanwhile, further, the invention provides the application method of warmhouse booth soil remediation group agent: composting at air themperature 25 DEG C; Composting carries out under covering straw screen or mat, and composting starts turning in latter every 30 days once, and during turning, moisturizing is to water content 60%, composting time remaining 120 days; Directly soil can be applied to after airing to drying after composting completes.
Embodiment five: the agent of warmhouse booth soil remediation group is verified the reparation of warmhouse booth soil
1, test design and process
This test is carried out (30m × 70m) in the pattern plastic warmhouse booth of Korla City.The character of topsoil (0-15cm) is as table 1.Before this research, greenhouse soil planted continuously 2 season cucumber.
Test has 3 process and 1 contrast, that is: the soil remediation group agent group of control group, commercially available soil-repairing agent group, geotrichum candidum list microbial inoculum soil-repairing agent group and above-described embodiment three and embodiment four preparation.Repeat for 4 times, Gong16Ge community, each community 45m
2, the group arrangement of completely random district is taked in test.In order to reduce edge effect, between community, stay the buffer zone of 1.2m; The physico-chemical property of the greenhouse soil adopted is in table 2.
Described geotrichum candidum bacterial classification soil-repairing agent is prepared as: the solid medium preparing geotrichum candidum bacterial classification, strictly carries out aseptic technique, be forwarded to flat board from inclined-plane after sterilizing, cultivates 3 days at temperature 25 DEG C; The liquid bacteria liquid preparing geotrichum candidum XHS0030B bacterial classification is cultivated through one-level cultivation and secondary; Fully be adsorbed in carrier by the bacterial classification geotrichum candidum XHS0030B bacterium liquid of preparation, carrier is warmhouse booth soil, and auxiliary material is urea and calcium superphosphate, and wherein the weight ratio of urea and calcium superphosphate is 1:2.5; The weight ratio of carrier and auxiliary material is 1:3; Add water to water content 40-70%, then every cubic metre of carrier adds soil-repairing agent 250g with the materials that mix of auxiliary material by volume, and mixes, and is and is prepared as geotrichum candidum list microbial inoculum soil-repairing agent.
Table 2: the physico-chemical property of greenhouse soil
| The grains of sand (%) | Powder (%) | Clay (%) | Ph | Specific conductivity | Total carbon (%) | Total nitrogen (%) | Carbon-nitrogen ratio |
| 22.5 | 36.3 | 41.2 | 7.88 | 0.87 | 1.57 | 0.41 | 3.87 |
2, process of the test
Each community is transplanted into by 45000 strain every mu by cultivating 15d and growing homogeneous cucumber seedling.During cucumber growth, adopt furrow irrigation to keep field water holding 70%-80%.At the cucumber result initial stage, cucumber is carried out that sampling and measuring total biomass, climing length, stem are thick, leaf area index and the number of blade.The output of cucumber adopts cumulative method to measure.
3, test-results
(1) warmhouse booth soil-repairing agent is on the impact of greenhouse cucumber growth, yield and quality
As shown in Table 3, compare with contrast, warmhouse booth soil remediation group agent prepared by commercially available normal soil renovation agent, geotrichum candidum list microbial inoculum soil-repairing agent and the present invention all can significantly improve the output of cucumber.But, commercially available normal soil renovation agent improves output 15.9%, geotrichum candidum list microbial inoculum soil-repairing agent raising output is 20.5%, it is 26.7% that warmhouse booth soil remediation group agent prepared by the present invention improves output, and geotrichum candidum list microbial inoculum soil-repairing agent prepared by visible the present invention and the agent of warmhouse booth soil remediation group are obviously better than commercially available normal soil renovation agent.Geotrichum candidum list microbial inoculum soil-repairing agent prepared by the present invention can reduce the nitrate in cucumber, but warmhouse booth soil remediation group agent treatment effect prepared by the present invention is optimum.
Table 3: warmhouse booth soil-repairing agent is on the impact of greenhouse cucumber growth, yield and quality
(2) warmhouse booth soil-repairing agent affects result to cucumber nutritive ingredient
As can be seen from Table 4, warmhouse booth soil-repairing agent does not all have a significant impact nitrogen in cucumber fruits and Fe content.Compare with contrast, warmhouse booth soil remediation group agent prepared by the present invention can significantly improve the content of phosphorus in cucumber fruits, magnesium and potassium.Meanwhile, the copper content in cucumber fruits can be reduced.Visible, warmhouse booth soil remediation group agent prepared by the present invention can improve the soil quality of warmhouse booth, repairs the soil of warmhouse booth.
Table 4: warmhouse booth soil-repairing agent is on the impact of cucumber nutritive ingredient
Obtain the present invention by above-mentioned series embodiment verification experimental verification to screen the bacterial strain of geotrichum candidum (GeotrichumCandidum) XHS0030BCGMCCNO.9435 that seed selection domestication obtains there is stronger growth and breeding ability, growth velocity is fast, hereditary property is stablized, and have specific effect to soil remediation, be a kind of geotrichum candidum list microbial inoculum soil-repairing agent; By practice and other Rhodopseudomonas palustriss, Candida utilis and Mortierella alpina four kinds of bacterial classification test for fusion, facts have proved that the soil remediation group agent of preparation is applied to the soil of improvement warmhouse booth, for improvement and activating soil, degraded soil in objectionable impurities, solution soil salinification problem, disadvantageous effect in being produced fruits and vegetables by soil is reduced to bottom line, be conducive to the yield and quality improving vegetables, obtain significantly outstanding technique effect, therefore there is the extensively value be suitable in warmhouse booth soil remediation.
Above-described embodiment is only for example of the present invention is clearly described, and the restriction not to embodiment.For those of ordinary skill in the field, can also make other changes in different forms on the basis of the above description.Here exhaustive without the need to also giving all embodiments.And apparent change extended thus or variation are still among protection scope of the present invention.
SEQUENCELISTING
<110> Huisen Biotech Co., Ltd., Xinjiang
<120> geotrichum candidum and the application in warmhouse booth soil remediation thereof
<130> geotrichum candidum
<160>1
<170>PatentInversion3.3
<210>1
<211>371
<212>DNA
<213> geotrichum candidum
<220>
<221>ITSrDNA
<222>(1)..(371)
<400>1
tccgtaggtgaacctgcggaaggatcattatgaattaataatatttgtgaaatttcaaca60
aacaacatcaattttatagtctattatttttaattaaaacttttaacaatggatctcttg120
gttctcgtatcgatgaagaacgcagcgaaacgcgatatttcttgtgaattgcagaagtga180
atcatcagtttttgaacgcacattgcactttggggtatcccccaaagtatacttgtttga240
gcgttgtttctctcttggaattgctttgctcttctaaaatttcgaatcaaattcgtttga300
aaaacaacactattcaacctcagatcaagtaggattacccgctgaacttaagcatatcaa360
taagcggagga371
Claims (6)
1. the geotrichum candidum being applicable to warmhouse booth soil remediation (
geotrichumCandidum) XHS0030B, it is characterized in that, described geotrichum candidum (
geotrichumCandidum) XHS0030B deposit number is CGMCCNO.9435.
2. as claimed in claim 1 geotrichum candidum (
geotrichumCandidum) gene order of XHS0030B is as SEQUENCELISTING.
3. as claimed in claim 1 geotrichum candidum (
geotrichumCandidum) application of XHS0030B in warmhouse booth soil remediation.
4. a warmhouse booth soil remediation group agent, is characterized in that, described warmhouse booth soil remediation group agent is obtained by following preparation method:
(1) inoculate: prepare geotrichum candidum (
geotrichumCandidum) solid medium of XHS0030BCGMCCNO.9435, Rhodopseudomonas palustris, Candida utilis and Mortierella alpina four kinds of bacterial classifications, strictly carry out aseptic technique after sterilizing, be forwarded to flat board from inclined-plane, cultivate 3 days at temperature 28 DEG C;
(2) one-level is cultivated: from the solid medium step (1), picking list bacterium colony is forwarded to and is equipped with in the 50mL Erlenmeyer flask of liquid nutrient medium, aseptic technique, 28 DEG C, 120r/min cultivates 24h-48h;
(3) second order fermentation: above-mentioned steps one-level is cultivated strain inoculation in the 500mL Erlenmeyer flask filling liquid nutrient medium, aseptic technique, 28 DEG C, 120r/min cultivates 36h-72h;
(4) compatibility of strain fermentating liquid: assess according to weight part ratio, geotrichum candidum second order fermentation liquid 70 parts-80 parts, Rhodopseudomonas palustris second order fermentation liquid 30 parts-50 parts, Candida utilis second order fermentation liquid 20 parts-40 parts and Mortierella alpina second order fermentation liquid 10 parts-30 parts prepared by optional step (3) mix, and prepare the mixed solution of composite bacteria;
(5) auxiliary material is added: be fully adsorbed in carrier by composite bacteria mixed solution prepared by step (4), carrier selects warmhouse booth soil; Auxiliary material adopts urea and calcium superphosphate, and wherein the weight ratio of urea and calcium superphosphate is 1:2.5; The consumption of carrier and auxiliary material is the mixing of 1:3 proportioning according to weight ratio, add water to water content 40-70%, then every cubic metre of carrier and auxiliary material mixing materials add composite bacteria mixed solution 100-300g prepared by above-mentioned steps (4) by volume, and mix, prepare the agent of warmhouse booth soil remediation group.
5. the using method of warmhouse booth soil remediation group agent as claimed in claim 4, is characterized in that, described using method step is as follows:
By warmhouse booth soil remediation group agent composting at air themperature 20-40 DEG C of preparation; Composting carries out under covering straw screen or mat, and composting starts turning in latter every 30 days once, and during turning, moisturizing is to water content 40-70%, composting time remaining 120 days; Directly soil can be applied to after airing to drying after composting completes.
6. the application of warmhouse booth soil remediation group agent in warmhouse booth soil remediation as claimed in claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510439948.1A CN105154334B (en) | 2015-07-23 | 2015-07-23 | A kind of geotrichum candidum and its application in greenhouse soil remediation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510439948.1A CN105154334B (en) | 2015-07-23 | 2015-07-23 | A kind of geotrichum candidum and its application in greenhouse soil remediation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105154334A true CN105154334A (en) | 2015-12-16 |
| CN105154334B CN105154334B (en) | 2018-11-23 |
Family
ID=54795386
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510439948.1A Active CN105154334B (en) | 2015-07-23 | 2015-07-23 | A kind of geotrichum candidum and its application in greenhouse soil remediation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105154334B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106424125A (en) * | 2016-07-19 | 2017-02-22 | 山东大学 | Microbial agent for treating heavy metal polluted soil, preparation method and applications thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1629104A (en) * | 2003-12-15 | 2005-06-22 | 北京全新绿洲国土治理科学研究院 | Soil environment biological reserving fertilizer |
| CN104629766A (en) * | 2014-12-16 | 2015-05-20 | 镇江拜因诺生物科技有限公司 | Microorganism soil remediation agent |
-
2015
- 2015-07-23 CN CN201510439948.1A patent/CN105154334B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1629104A (en) * | 2003-12-15 | 2005-06-22 | 北京全新绿洲国土治理科学研究院 | Soil environment biological reserving fertilizer |
| CN104629766A (en) * | 2014-12-16 | 2015-05-20 | 镇江拜因诺生物科技有限公司 | Microorganism soil remediation agent |
Non-Patent Citations (1)
| Title |
|---|
| 刘淑霞等: "黑土玉米田土壤纤维素分解真菌物种鉴定及分解能力测定", 《玉米科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106424125A (en) * | 2016-07-19 | 2017-02-22 | 山东大学 | Microbial agent for treating heavy metal polluted soil, preparation method and applications thereof |
| CN106424125B (en) * | 2016-07-19 | 2019-03-08 | 山东大学 | A kind of microbial inoculum and the preparation method and application thereof handling heavy metal pollution of soil |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105154334B (en) | 2018-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108130094B (en) | Sandy soil conditioner and application thereof | |
| CN107513509A (en) | A kind of method of improved soil saline alkali | |
| CN109156110B (en) | Method for improving saline-alkali soil by using cordyceps sinensis fermentation liquor | |
| CN103396182B (en) | Method for producing solanaceous vegetable seedling growing substrate by utilizing salvaged material of cassava processing | |
| CN103203356A (en) | Secondarily-salinized soil microbial agent and preparation and application thereof | |
| CN105964680B (en) | A kind of beach saline land continuous cropping cotton soil ecology renovation agent and the preparation method and application thereof | |
| CN105219656B (en) | A kind of Fusarium oxysporum and its application in Growth of Dendrobium candidum is promoted | |
| Liu et al. | Spatiotemporal differences in the arbuscular mycorrhizal fungi communities in soil and roots in response to long-term organic compost inputs in an intensive agricultural cropping system on the North China Plain | |
| CN107012105A (en) | Composite bacteria agent, animals died of illness harmless treatment fermenting agent, composite microbe fertilizer, solid medium and fluid nutrient medium | |
| CN103320371B (en) | Bacterium having growth-promoting effect in synergism with AM fungus and application of bacterium in vegetable growth promoting | |
| CN104195056A (en) | Umbelopsis dimorpha and application thereof in growth promotion and drought resistance of dendrobium officinale | |
| Wang et al. | Effects of establishing an artificial grassland on vegetation characteristics and soil quality in a degraded meadow | |
| CN105132293A (en) | Alternaria tenuissima and application of alternaria tenuissima to growth promotion and drought resistance of dendrobium officinale | |
| CN104195054B (en) | Mould and the application in dendrobium candidum growth-promoting and drought resisting of a kind of two type umbrellas | |
| CN103724060B (en) | A kind of brown coal bio-fertilizer and production method thereof | |
| CN105154353B (en) | A kind of bacillus subtilis and its application in greenhouse soil remediation | |
| CN106116883A (en) | A kind of preparation method of Paeonia suffruticosa pouring root composite microbic bacterial fertilizer | |
| CN103695335B (en) | Mesorhizobium huakuii and use thereof | |
| CN105154334B (en) | A kind of geotrichum candidum and its application in greenhouse soil remediation | |
| CN103045500B (en) | Mesorhizobium KDRM295 and application thereof | |
| CN105254407A (en) | Black fungus cultivation material and method | |
| CN103937721A (en) | Bacillus safensis, microbial agent and application of bacillus safensis and microbial agent | |
| Shen et al. | Increase in maize yield and soil aggregate-associated carbon in North China due to long-term conservation tillage | |
| CN103756909A (en) | Phosphate-dissolving fungus and application of the same in biological phosphorus fertilizer preparation and mushroom cultivation | |
| CN103160454B (en) | Streptomycetes silaceus carried on Shenzhou 9 spaceship and space microbial fertilizer prepared from streptomycetes silaceus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |