CN104634769A - Preparation and application of real-time living cell structural mechanics fluorescent detection probe real-time living cell structural mechanics detection method and application of the method - Google Patents
Preparation and application of real-time living cell structural mechanics fluorescent detection probe real-time living cell structural mechanics detection method and application of the method Download PDFInfo
- Publication number
- CN104634769A CN104634769A CN201410699905.2A CN201410699905A CN104634769A CN 104634769 A CN104634769 A CN 104634769A CN 201410699905 A CN201410699905 A CN 201410699905A CN 104634769 A CN104634769 A CN 104634769A
- Authority
- CN
- China
- Prior art keywords
- fluorescence
- probe
- cell
- mechanics
- fluorescin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a real-time living cell structural mechanics detection method and application of the method, and belongs to the technical field of bioengineering. The method disclosed by the invention comprises the following steps: selecting fluorescent protein pairs capable of being subjected to fluorescence resonance energy transfer, connecting the protein pairs to angle positions by using short peptide chains, and constructing a mechanical detection probe by utilizing the fluorescence resonance energy transfer caused by the angle change of the protein pairs; and integrating the probe into the cell skeleton proteins by adopting a molecular cloning method and by connecting the probe with a skeleton protein. The fluorescence energy transfer is detected, so that the mechanical change of cell skeleton transfer can be estimated. The lengths of short peptide chains are changed, the initial angles of the protein pairs can be regulated, the sensitivity of the fluorescence probe is improved, and research on a mechanism related to the cell structure mechanics is effectively realized. The improved probe has the detection characteristics of slight influence on a culture medium, rapidness, micro amount, sensitivity, accuracy and high flux and can be used for constructing a cell platform for screening drugs related to the cell structure mechanics.
Description
Technical field
The present invention relates to " fluorescin to " probe construction and application that FRET (fluorescence resonance energy transfer) can occur.This probe is applicable to the detection of living cells micromechanism mechanical change index, especially to the in vitro of power molecular induction with at the real-time quantitative of body living cells and organization mechanics change or semiquantitative determination.
Background technology
Myocyte finds the cell relevant to mechanics the earliest.In fact, all cells can generative power and esthesis, as nerve, endothelium, bone and stem cell etc.All life processes all relate to effect and the adjustment of mechanics, as differentiation, anti-differentiation, division, polarization, motion, invasion and attack transfer and apoptosis etc.Meanwhile, the mechanics activity of different tissues organ exists with " stable state " form.Once this mechanics stable state is broken, histiocytic pathology will be caused, as cancer cell malignant proliferation and invasion and attack transfer, neural axon growth obstacle, endothelial cell diastole imbalance etc.
Cell interior mechanics effect generally depends on dynein--and kinesin (kinesin), dynein (dynein) and myosin (myosin) act on.Power molecular exercises mechanics effect by skelemin, also realizes intracellular organic matter transport by interacting with skelemin.When external force and endogenetic process cell, skelemin can transmit mechanical change, activates mechanosensor, mechanical signal is converted to chemistry or electric signal, coordinates cyto-mechanics correlated activation.Cell is this to be depended on the mechanical function of skeleton structure and mechanical signal and transmits form and be named as eucaryotic cell structure mechanics.But cytoskeletal structure can not generative power, can not experience mechanical change, be only cell transmit mechanical change must obligato medium.
The biophysics Micromechanics detection technique " atomic force microscope, magnetic pincers and laser pincers " set up; Usual employing " micro-cantilever ", by perception external cell monolayer surface structure Strength Changes, infers isolated cells mechanical change, brings the revolution that biophysics Micromechanics detects.But this detection technique, has some limitations, the needs of living cells Real-Time Monitoring, subcellular structure mechanics and clump cells (blastular) and the detection of in-vivo tissue mechanical change can not be met.
" fluorescence tension detect probe " is the intracellular structure mechanics detection technique based on the research and development of FRET (fluorescence resonance energy transfer) principle.By gene clone, transfection and expression, fluorescence tension force probe is inserted in structural protein or between albumen, make the mechanical change of the skeleton structure transmission such as microfilament, microtubule, median fiber silk be converted into optical signalling, obviously can make up the defect of existing cyto-mechanics detection technique.Meanwhile, this fluorescence probe of research and development can detect interaction and the regulatory mechanism of mechanical signal and chemistry and electric signal, for identifying the drug target relevant with cyto-mechanics, and the structure of the cell screening platform of new drug relevant to tension force.Thus, its research and development and application may bring eucaryotic cell structure mechanics in the revolution of biophysics Micromechanics, disease incidence Mechanism Study and clinical new drug development.
Summary of the invention
According to FRET (fluorescence resonance energy transfer) (FRET) principle, the fluorescin that FRET can occur, to being incorporated into cytoskeletal structure, realizing cell micromechanism mechanical change and is converted to optical signalling.By observing the FRET efficiency change that fluorescence causes Angulation changes, infer living cells or biological tissue inner structure mechanical change in real time.
So-called FRET (fluorescence resonance energy transfer) (FRET), when referring to two kinds of fluorescins (donor and acceptor) close proximity (several atomic diameter scope), when donor emission fluorescence is overlapping with the absorption spectrum of acceptor chromophoric group, oscillating dipole is produced with the excitation of spectra donor of appropriate frequency, and then resonate with acceptor dipoles, finally cause the phenomenon that energy shifts from donor on-radiation to acceptor.Wherein, the efficiency of energy trasfer depends on that fluorescence is to distance apart and both position angles.There is the fluorescin of higher FRET efficiency to having: blue (eBFP2) and green (eGFP), orange (venus) and redness (mcherry), cyan (eCFP) and orange (eYFP).
Adopt gene clone technology, the fluorescin pair connected by 5-11 amino acid short peptide in the middle of building, as the fluorescence probe detecting tension variation; And adopting proline (Pro) as fluorescin to the turning point forming angle, formation fluorescence is to change in angular position (Fig. 1).Concrete structure is " FP
1"-naa-Pro-naa-" FP
2".
The mode adopting amino acid chain to connect, embeds probe between two skelemins (as actin β-actin, tubulin α/β-tubulin, vimentin vimentin, I/II type keratin (keratin) and nuclear skeleton albumen lamin A/C, B1 and B2 etc.).Its concrete gene clone pattern is: eukaryotic promoter-skelemin-Pro-6aa-fluorescin 1-naa-Pro-naa-fluorescin 2-6aa-Pro-skelemin.
By plasmid (pEGFP-C1) or virus (slow virus or adenovirus) as carrier, by probe and connected skelemin gene clone thereof to isolated cells or in-vivo tissue, induce its cell inner expression, then be incorporated in cytoskeletal structure, fluorescence probe is made to be suspended on (Fig. 1) outside cytoskeletal structure, to reduce the impact on normal skeleton structure function.When external force or internal force inducing cell morphologic change, the change of skelemin mechanical strength can be caused, then use FRET (fluorescence resonance energy transfer) (FRET) principle, read wherein mechanical tension change.
Application fluorescence is to the sensitivity of initial angle different adjustment probe.Derive according to FRET spectroscope rule and spring Hooke law: fluorescence transfer efficiency (E) and fluorescence are adjusted the distance the mathematical relation of (R): E=1/ (1+ (R/R
0)
6), R
0it is the right eigenwert of fluorescence; And E and fluorescence are to angle (θ
dA) mathematical relation be: E=cos
2θ
dA/ (cos
2θ
dA+ 1/3).Because cos
2θ
dA[0
o, 90
o] be continuous subtraction function, cos
2θ
dAscope is [0,1].
Wherein, 0-30 degree, the change of E value is more weak; When initial angle is greater than 30 degree (30-50), the relation of E value and angle is slope; Initial angle is greater than 50 degree (50-80 degree), and both slopes increase (Fig. 2).By increasing or shorten fluorescence to the amino acid chain connected, initial angle between the two can be regulated, improve the detection sensitivity of probe.Because the mechanics overwhelming majority in cell biology is tensile force instead of force of compression, therefore tension force energy induced fluorescence donor and receptor protein " angle " change are generally increase, and are changed (parallel to 90 degree of right angles changes by 0 degree) by parallel to obtuse angle; And FRET efficiency is lowered, both inversely.Namely tension force is stronger, and both angles are larger, and FRET transfer is more weak.
Adopt donor fluorescence excitation spectrum to irradiate, measure the utilizing emitted light numerical value of two kinds of fluorescins, then according to specific computing formula (as FRET/ donor-emitted light), infer and the change of its angle, thus semi-quantitative assessment cell Micromechanics numerical value.According to the non-covalent linking feature of skelemin and film integrated structure, can infer that this fluorescence tension detect probe can be used for piconewton (pN) mechanics and detects.
Detect the instrument of FRET (fluorescence resonance energy transfer): all fluorescence detection equipment (Fig. 3) that can measure FRET change, as multimode fluorescent microscope (two channel light can be added and be separated filter), laser co-focusing or FRET fluorescence microplate reader (Fig. 3).Detection method for FRET efficiency has: the observational techniques such as the recovery of photobleaching fluorescence, fluorescence lifetime imaging, light spectrum image-forming, fluorescence polarization imaging.First measure: in the cell of label probe or cell aggregation, the change of two kinds of fluorescence, then by specific FRET computing formula, calculate the tension variation of cell or cell aggregation.
After probe proceeds to cell, the exciting light of donor and acceptor fluorescent protein is adopted to identify the validity that two fluorescins proceed to respectively, the power molecular mechanics effect adopting osmotic pressure and Ca2+ oscillations to stimulate detects: fluorescence probe evaluates the feasibility of cyto-mechanics, adopts cytoskeletal protein depolymerizing agent to detect the combination of fluorescin and skelemin.
Advantage of the present invention has:
1, the tension detect probe adopting FRET (fluorescence resonance energy transfer) principle to build, be incorporated in cytoskeletal structure, the change of cell interior mechanics can be converted into optical signalling, complete living cells, the Real Time Observation of clump cells (blastular) and in-vivo tissue mechanical change, and can realize living cells or the Continuous Observation organizing agglomerate.
2, this detector probe of exploitation, is mainly used in the research of microfilament, microtubule, median fiber silk and nuclear skeleton structural mechanics.Well-conserved in view of microfilament protein (β-actin), tubulin (tubulin), vimentin (vimentin) and nuclear skeleton albumen (lamin), the probe of research and development can be used for the detection of multiple biological cell inner framework structure mechanics.Can probe be inserted between specific protein by transformation, also can be used in a certain structural proteins and the detection of subcellular structure specificity mechanics, breach the restriction that existing unicellular mechanics of surface detects.
3, adopt fluorescin " angle " to be changed to the FRET change caused, infer structural mechanics change.Because fluorescin is to being suspended on outside skelemin structure, reduce the impact of foreign protein on cytoskeletal structure, overcome " biological spring (α spiral or β-pleated sheet) linking probe " structure in the past larger, easily cause the defect on the impact of cell protein conformation, greatly reduce probe harmful effect.Thus, this probe have be widely used, succinct and little to impact cell feature.
4, combined with fluorescent enzyme connection instrument and long wavelength's fluorescin pair, can realize the change of high-flux cell structural mechanics and detect, this detection system can be used for the structure of drug screening cell platform, meets the new medicament screen demand being feature with eucaryotic cell structure mechanics.
The present invention is further elaborated by the following drawings and enforcement, but does not limit the scope of the invention.
Accompanying drawing explanation
Fig. 1 tension force fluorescence probe and the schematic diagram be combined with fibril framework structure thereof
The fluorescin that left side is connected to form for short peptide chain is to angle position; Right side is that fluorescence probe is incorporated into schematic diagram outside fibril framework.
Fig. 2 FRET efficiency (E) and fluorescence are to angle (θ
dA) mathematical relation
Ordinate represents the efficiency (E) of FRET; Horizontal ordinate is the right angle (θ of fluorescence
dA).
Fig. 3 detects FRET principle of instrument figure
Specific wavelength fluorescence forms the light wave of phase co-wavelength (or direction of vibration) by filter (or partially) light microscopic, and after irradiating histocyte, exciting light forms the light beam of two wavelength (or polarization direction is orthogonal) and imaging by spectroscope.
Fig. 4 adopts eBFP2 and eGFP fluorescence to the fibril framework tension force probe plasmid map built
Be followed successively by figure: eukaryotic promoter pCMVie-β actin-Pro-6aa-eBFP2-naa-Pro-naa-eGFP-6aa-Pro – β actin-UAA(terminator codon).
Fig. 5 adopts eBFP2 and eGFP fluorescence to microtubule " heterodimer " the skeleton tension force probe plasmid map built
Be followed successively by figure: eukaryotic promoter pCMVie-α tubulin-Pro-6aa-eBFP2-naa-Pro-naa-eGFP-6aa-Pro – β tubulin-UAA(terminator codon).
Fig. 6 fluoroscopic examination tension force probe proceeds to eukaryotic FRET efficiency (E value) and measures
A. donor is adopted to excite wave spectrum irradiating and detecting donor emission peak value; B. acceptor emission peak value (FRET value) is detected; C. transferring efficiency of fluorescence resonance energy (E); Right side histogram represents the value that employing 16 color table shows FRET/ donor-emitted light.
The validity of the hypotonic evaluation of Fig. 7 " passive tension enhancing " induced tension fluorescence probe change
Be followed successively by: cell isotonic solution 8min, changes ddH into
2o effect 8min, then change normal cell isotonic solution 8min, observation per minute 1 time, drafting ordinate is FRET efficiency (E), horizontal ordinate is the curve of time variations.
Fig. 8 endoplasmic reticulum Ca2+ oscillations release irritation cell tension force strengthens the validity causing tension force fluorescence probe to change
Be followed successively by: cell isotonic solution 8min, change endoplasmic reticulum IP3 receptor stimulating agent caffeine (caffeine, 10mM) into and act on 8min, then change normal cell isotonic solution 8min, observation per minute 1 time, drafting ordinate is FRET efficiency (E), horizontal ordinate is the curve of time variations.
Embodiment
1, business obtains the right gene order of fluorescin and main skeleton protein gene ORF sequence clone, as following table:
2, adopt gene clone technology, following various skelemin ORF is cloned on carrier for expression of eukaryon.With pEGFP-C1 plasmid for carrier, eBFP and eGFP be fluorescence probe to being example, build various skelemin fluorescence associated probe, the restriction enzyme of employing mainly contains: AgeI, ApaI, BamHI, KpnI, NheI, SpeI, XhoI.DNA probe clonal structure is as follows:
β-actin
pCMVie-gctagc(NheI)-βactin -
ccaaccggt(AgeI)ggtggcggaggg-eBFPggtacc(KpnI) gga
ccaggtggcggt-eGFP-ggaggtggcggtactagt(SpeI)
cca-βactin-gggccc(ApaI)-
vimentin
pCMVie-gctagc(NheI)-vimentin-
ccaaccggt(AgeI)ggtggcggaggg-eBFPggtacc(KpnI) gga
ccaggtggcggt-eGFP-ggaggtggcggtactagt(SpeI)
cca-vimentin-gggccc(ApaI)-
laminB1
pCMVie-gctagc(NheI)-laminB1-
ccaaccggt(AgeI)ggtggcggaggg-eBFPggtacc(KpnI)
gga
ccaggtggcggt-eGFP-ggaggtggcggtactagt(SpeI)
cca-laminB1-gggccc(ApaI)-
α/β- tubulin
pCMVie-gctagc(NheI)-α-tubulin-
ccactcgag(XhoI)ggtggcggaggg-eBFPggtacc(KpnI)
gga
ccaggtggcggt-eGFP-ggaggtggcggtactagt(SpeI)
cca-β-tubulin-gggccc(ApaI)-
lamin B2
pCMVie-gctagc(NheI)-laminB2-
ccaaccggt(AgeI)ggtggcggaggg-eBFPggtacc(KpnI)
gga
ccaggtggcggt-eGFP-ggaggtggcggtactagt(SpeI)
cca- laminB2-ggatcc(BamHI)-
lamin A/C
pCMVie-gctagc(NheI)-laminA/C-
ccactcgag(XhoI)ggtggcggaggg-eBFPggtacc(KpnI) gga
ccaggtggcggt-eGFP-ggaggtggcggtactagt(SpeI)
cca-laminA/C-ggatcc(BamHI)-
Underscore is proline codon, as the turning point of amino acid chain.
The structure structure of above tension force fluorescence probe clone, is equally applicable to mVenus/mcherry and eCFP/eYFP two kinds of fluorescence to the structure of probe.
(2) the pcr amplification primer (the ORF sequence see fluorescin and skelemin) of anamorphic zone cloning site, specific as follows:
Fluorescin 1
Upstream primer pCGG
aCCGGT(AgeI) GGTGGCGGAGGG-fluorescin 1 upstream 20bp
Downstream primer pGAA
gGTACC (KpnI)-fluorescin 1 downstream is to side chain 20bp
Fluorescin 2
Upstream primer pGAC
gGTACC (KpnI) GGA
cCAgGTGGCGGT-fluorescin 2 upstream 20bp
Downstream primer pCAG
aCTAGT (SpeI) ACCGCCACCTCC-fluorescin 2 downstream is to side chain 20bp
Skelemin 1
Upstream primer pTCC
gCTAGC(NheI)
-skelemin upstream 20bp
Downstream primer pCCT
aCCGGT (AgeI)
tGG -skelemin downstream is to side chain 20bp
(not forgiving terminator codon)
Skelemin 2
Upstream primer pGAC
aCTAGT (SpeI)
cCA -skelemin upstream 20bp
Downstream primer pCAT
gGGCCC (ApaI)
-terminator codon+skelemin downstream is to side chain 17bp
Wherein AgeI cloning site (ACCGGT) can by XhoI(CTCGAG) replace; ApaI (GGGCCC) can be replaced by BamHI (GGATCC).
Have for the upstream and downstream primer of fluorescin to (FP1 and FP2) open reading frame (ORF) sequence:
Enhancement mode blue fluorescent protein (eBFP2) length 717bp
Upstream primer: pATGGTGAGCAAGGGCGAGGA downstream primer: pCTTGTACAGCTCGTCCATGC
Enhanced green fluorescence protein (eGFP2) length 717 bp
Upstream primer: pATGGTTTCCAAGGGTGAGGA downstream primer: pTTTGTAAAGTTCATCCATTC
Golden fluorescin (mVenus) length 717 bp
Upstream primer: pATGGTGAGCAAGGGCGAGGA downstream primer: pCTTGTACAGCTCGTCCATGC
Bright cherry-red fluorescin (mcherry) length 705 bp
Upstream primer: pATGAGCAAAGGAGAAGAAGA downstream primer: pTTTGTAAAGCTCATCCATTC
Enhancement mode cyan fluorescent protein (eCFP) length 717 bp
Upstream primer: pATGGTGAGCAAGGGCGAGGA downstream primer: pCTTGTACAGCTCGTCCATGC
Enhancement mode orange fluorescent protein (eYFP) length 717 bp
Upstream primer: pATGGTTTCTAAAGGTGAAGA downstream primer: pTTTATATAATTCATCCATAC.
Upstream and downstream primer for open reading frame (ORF) sequence of skelemin has:
Fibril framework albumen (β-actin) length 1125bp
Upstream primer: ATGGATGATGATATCGCCGC downstream primer:
cTAgAAGCATTTGCGGTGGACGA
Microtubule skeleton albumen (α-tubulin) length 1353bp
Upstream primer: ATGCGTGAGTGCATCTCCAT downstream primer:
tTAgTATTCCTCTCCTTCTTCCT
Microtubule skeleton albumen (β-tubulin) length 1332 bp
Upstream primer: ATGAGGGAAATCGTGCACAT downstream primer:
tTAgGCCTCCTCTTCGGCCTCCT
Vimentin (vimentin) length 1398 bp
Upstream primer: ATGTCCACCAGGTCCGTGTC downstream primer:
tTAtTCAAGGTCATCGTGATGCT
Lamin A/C (Lamin A/C) length 1992 bp
Upstream primer: ATGGAGACCCCGTCCCAGCG downstream primer:
tTAcATGATGCTGCAGTTCTGGG
Lamin B 1(Lamin B1) length 1758 bp
Upstream primer: ATGGCGACTGCGACCCCCGT downstream primer:
tTAcATAATTGCACAGCTTCTAT
Lamin B 2(Lamin B2) length 1860 bp
Upstream primer: ATGAGCCCGCCGAGCCCGGG downstream primer:
tCAcATCACGTAGCAGCCTCTTG
Underscore is terminator codon, and as skelemin 2, design primer needs to add terminator codon.
(3) adopt restriction enzyme, cut out the pcr amplified fragment cohesive end of coupling mutually, concrete restriction enzyme has AgeI, ApaI, BamHI, KpnI, NheI, SpeI, XhoI, cuts the PCR fragment of amplification respectively; DNA Purification Kit amplified fragments.
Bacillus coli DH 5 alpha amplification pEGFP-C1 plasmid, adopt restriction enzyme cutting plasmid, electrophoretic separation cutting fragment, rubber tapping is separated large fragment, adopts " glue recovery kit " and " DNA purification kit ", Isolation and purification plasmid large fragment.
(4) with ligase, annealing connects the pcr amplified fragment with coupling cohesive end.First the skelemin of band two kinds of joints is connected with pEGFP-C1 plasmid vector; Again eBFP-naa+eGFP fluorescence probe is connected; After being finally connected with skelemin+pEGFP-C1 plasmid vector by eBFP-naa+eGFP fluorescence probe, be transformed into bacillus coli DH 5 alpha, slat chain conveyor, and adopt the resistance to the action of a drug (G418) to screen acquisition positive colony.
(5) cultivate the Escherichia coli of transfection probe plasmid, plasmid extraction kit extracts the plasmid DNA containing probe.
2, the qualification of cloning efficiency
1, after probe being proceeded to eukaryotic, identify that the method for its integrality is: adopt donor or acceptor to excite wave spectrum can detect donor or acceptor emission peak value respectively, and adopt donor to excite wave spectrum also can measure acceptor emission peak value.As do not seen above-mentioned arbitrary specific spectra emission peak, all show: the cloning probe proceeded to may exist sudden change, wherein one or two fluorescin lacks, and causes FRET (fluorescence resonance energy transfer) to inefficacy.It should be noted that high concentration urea, Trypsin or protein kinase K possibility cracking probe, cause FRET efficiency significantly to weaken or complete failure.
2, identify that the method for tension force probe validity is:
(1) change osmotic pressure and detect the change of tension force probe, concrete operations are: change cell culture fluid into ddH
2o, observes about 10min, and detect tension force and strengthen whether induced fluorescence becomes large to angle, FRET efficiency weakens gradually.Then change normal cell isotonic solution again, observe about 10min(1 pictures/min), detect FRET efficiency and whether strengthen recovery.
(2) impact of Ca2+ oscillations release on tension force probe is stimulated, concrete operations are: give effective concentration endoplasmic reticulum IP3 receptor stimulating agent caffeine and observe about 10min, the tension force that the power molecular mechanics effect that observing Ca2+ oscillations stimulates causes strengthens, can become large to angle by induced fluorescence, FRET efficiency weakens gradually.Then change normal cell isotonic solution again, observe about about 10min (1 pictures/min), whether FRET efficiency strengthens recovery successively.
Open reading frame (ORF) sequence of FRET fluorescin
Enhancement mode blue fluorescent protein (eBFP2) Genebank EF517318.1 length 717 bp
atggtgagcaagggcgagga gctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgaggggcgagggcgagggcgatgccaccaacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgagccacggcgtgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcacctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcgtcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacttcaacagccacaacatctatatcatggccgtcaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacgtggaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacagccactacctgagcacccagtccgtgctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttccgcaccgccgccgggatcactctcg
gcatggacgagctgtacaag
Enhanced green fluorescence protein (eGFP2) Genebank HQ423139 717 bp
atggtttccaagggtgagga gcttttcactggcgtcgttccaatcttggtcgaactcgatggtgacgtcaatggccataagttctcagtcagcggagagggtgagggagacgctacatatggtaaattgactcttaagttcatctgcaccacaggtaaattgcctgtaccttggcctacactcgtcaccaccctcacctacggagttcaatgcttttcccgttacccagatcacatgaaacaacatgactttttcaagtctgcaatgccagagggatatgtccaagagagaacaatcttctttaaggatgacggaaattataagactcgtgccgaggttaagttcgagggtgatactctcgtcaaccgtattgagttgaagggcatcgatttcaaggaagacggaaatatcctcggccataagcttgaatacaactacaacagtcacaacgtttatatcatggccgacaagcaaaaaaatggaatcaaggtcaacttcaaaatcagacacaacattgaggatggctctgttcaattggcagatcactaccaacagaatactccaattggtgatggtccagtcttgctcccagataaccattacctctccactcaatctgctctttcaaaggaccctaacgaaaagcgtgaccacatggttcttctcgaatttgtcacagcagccggaattaccttgg
gaatggatgaactttacaaa
Golden fluorescin (mVenus) Genebank DQ092360.1 717 bp
atggtgagcaagggcgagga gctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagctgatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcggcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcg
gcatggacgagctgtacaag
Bright cherry-red fluorescin (mcherry) Genebank KJ908190 705 bp
atgagcaaaggagaagaaga taacatggcaatcatcaaagaatttatgcgtttcaaagttcacatggaaggttctgtaaacggacacgaatttgaaattgaaggtgaaggtgaaggccgtccttatgaaggaacacaaacggcaaagctgaaagtaacaaaaggcggaccgcttccgtttgcatgggatatcctttctccgcaattcatgtacggttcaaaagcatacgtgaagcatccggctgatattcctgattatttgaagctgtcattccctgaaggcttcaaatgggagcgtgtgatgaactttgaagatggcggtgttgttactgttactcaagattcaagccttcaagacggtgaatttatttacaaagtgaagctgcgcggaacaaacttcccatctgacggacctgtcatgcaaaagaaaacaatgggctgggaagcaagctctgaacgcatgtatccagaggacggtgctttaaaaggagaaatcaaacagcgtttgaagctgaaagacggcggacactatgacgctgaagtgaaaacaacttacaaagcgaaaaagccggttcagcttccaggtgcttacaacgtaaacatcaaacttgatattacaagccacaatgaagattatacgattgttgaacaatatgaacgcgctgaaggccgtcattcaactggcg
gaatggatgagctttacaaa
Enhancement mode cyan fluorescent protein (eCFP) Genebank AB435576.1 717 bp
atggtgagcaagggcgagga gctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaggttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgtaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggcccacttcaagatccgccacaacatcgaggacggcggcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccaagctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcg
gcatggacgagctgtacaag
Enhancement mode orange fluorescent protein (eYFP) Genebank AB634497.1 717bp
atggtttctaaaggtgaaga attattcactggtgttgttccaattttagttgaattagatggtgatgttaatggtcataaattctctgtttctggtgaaggtgaaggtgatgctacttacggtaaattaactttaaaattaatttgtactactggtaaattaccagttccatggccaactttagttactactttaggttatggtttacaatgtttcgctagatacccagatcatatgaaacaacatgatttcttcaaatctgctatgccagaaggttacgttcaagaaagaactattttcttcaaagatgatggtaattacaaaactagagctgaagttaaattcgaaggtgatactttagttaatagaattgaattaaaaggtattgatttcaaagaagatggtaatattttaggtcataaattagaatacaattacaattctcataatgtttatattactgctgataaacaaaaaaatggtattaaagctaatttcaaaattagacataatattgaagatggtggtgttcaattagctgatcattaccaacaaaatactccaattggtgatggtccagttttattaccagataatcattacttatcttatcaatctgctttatctaaagatccaaatgaaaaaagagatcatatggttttattagaatttgttactgctgctggtattactttag
gtatggatgaattatataaa
Cytoskeletal protein ORF sequence (Homo sapiens)
Fibril framework albumen (β-actin) Genebank X00351.1 1125bp
atggatgatgatatcgccgc gctcgtcgtcgacaacggctccggcatgtgcaaggccggcttcgcgggcgacgatgccccccgggccgtcttcccctccatcgtggggcgccccaggcaccagggcgtgatggtgggcatgggtcagaaggattcctatgtgggcgacgaggcccagagcaagagaggcatcctcaccctgaagtaccccatcgagcacggcatcgtcaccaactgggacgacatggagaaaatctggcaccacaccttctacaatgagctgcgtgtggctcccgaggagcaccccgtgctgctgaccgaggcccccctgaaccccaaggccaaccgcgagaagatgacccagatcatgtttgagaccttcaacaccccagccatgtacgttgctatccaggctgtgctatccctgtacgcctctggccgtaccactggcatcgtgatggactccggtgacggggtcacccacactgtgcccatctacgaggggtatgccctcccccatgccatcctgcgtctggacctggctggccgggacctgactgactacctcatgaagatcctcaccgagcgcggctacagcttcaccaccacggccgagcgggaaatcgtgcgtgacattaaggagaagctgtgctacgtcgccctggacttcgagcaagagatggccacggctgcttccagctcctccctggagaagagctacgagctgcctgacggccaggtcatcaccattggcaatgagcggttccgctgccctgaggcactcttccagccttccttcctgggcatggagtcctgtggcatccacgaaactaccttcaactccatcatgaagtgtgacgtggacatccgcaaagacctgtacgccaacacagtgctgtctggcggcaccaccatgtaccctggcattgccgacaggatgcagaaggagatcactgccctggcacccagcacaatgaagatcaagatcattgctcctcctgagcgcaagtactccgtgtggatcggcggctccatcctggcctcgctgtccaccttccagcagatgtggatcagcaagcaggagtatgacgagtccggcccctcca
tcgtccaccgcaaatgcttc tag(terminator codon)
Microtubule skeleton albumen (α-tubulin) Genebank DQ400107 1353bp
atgcgtgagtgcatctccat ccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgactccttcaacaccttcttcagtgagacgggcgctggcaagcacgtgccccgggctgtgtttgtagacttggaacccacagtcattgatgaagttcgcactggcacctaccgccagctcttccaccctgagcagctcatcacaggcaaggaagatgctgccaataactatgcccgagggcactacaccattggcaaggagatcattgaccttgtgttggaccgaattcgcaagctggctgaccagtgcaccggtcttcagggcttcttggttttccacagctttggtgggggaactggttctgggttcacctccctgctcatggaacgtctctcagttgattatggcaagaagtccaagctggagttctccatttacccagcaccccaggtttccacagctgtagttgagccctacaactccatcctcaccacccacaccaccctggagcactctgattgtgccttcatggtagacaatgaggccatctatgacatctgtcgtagaaacctcgatatcgagcgcccaacctacactaaccttaaccgccttattagccagattgtgtcctccatcactgcttccctgagatttgatggagccctgaatgttgacctgacagaattccagaccaacctggtgccctacccccgcatccacttccctctggccacatatgcccctgtcatctctgctgagaaagcctaccatgaacagctttctgtagcagagatcaccaatgcttgctttgagccagccaaccagatggtgaaatgtgaccctcgccatggtaaatacatggcttgctgcctgttgtaccgtggtgacgtggttcccaaagatgtcaatgctgccattgccaccatcaaaaccaagcgcagcatccagtttgtggattggtgccccactggcttcaaggttggcatcaactaccagcctcccactgtggtgcctggtggagacctggccaaggtacagagagctgtgtgcatgctgagcaacaccacagccattgctgaggcctgggctcgcctggaccacaagtttgacctgatgtatgccaagcgtgcctttgttcactggtacgtgggtgaggggatggaggaaggcgagttttcagaggcccgtgaagatatggctgcccttgagaaggattatgaggaggttggtgtggattctgttgaaggagagggtg
aggaagaaggagaggaatac taa(terminator codon)
Microtubule skeleton albumen (β-tubulin) Genebank AF070593.1 1332 bp
atgagggaaatcgtgcacat ccaggctggtcagtgtggcaaccagatcggtgccaagttctgggaggtgatcagtgatgaacatggcatcgaccccaccggcacctaccacggggacagcgacctgcagctggaccgcatctctgtgtactacaatgaagccacaggtggcaaatatgttcctcgtgccatcctggtggatctagaacctgggaccatggactctgttcgctcaggtccttttggccagatctttagaccagacaactttgtatttggtcagtctggggcaggtaacaactgggccaaaggccactacacagagggcgccgagctggttgattctgtcctggatgtggtacggaaggaggcagagagctgtgactgcctgcagggcttccagctgacccactcactgggcgggggcacaggctctggaatgggcactctccttatcagcaagatccgagaagaataccctgatcgcatcatgaataccttcagtgtggtgccttcacccaaagtgtctgacaccgtggtcgagccctacaatgccaccctctccgtccatcagttggtagagaatactgatgagacctattgcattgacaacgaggccctctatgatatctgcttccgcactctgaagctgaccacaccaacctacggggatctgaaccaccttgtctcagccaccatgagtggtgtcaccacctgcctccgtttccctggccagctcaatgctgacctccgcaagttggcagtcaacatggtccccttcccacgtctccatttctttatgcctggctttgcccctctcaccagccgtggaagccagcagtatcgagctctcacagtgccggaactcacccagcaggtcttcgatgccaagaacatgatggctgcctgtgacccccgccacggccgatacctcaccgtggctgctgtcttccgtggtcggatgtccatgaaggaggtcgatgagcagatgcttaacgtgcagaacaagaacagcagctactttgtggaatggatccccaacaatgtcaagacagccgtctgtgacatcccacctcgtggcctcaagatggcagtcaccttcattggcaatagcacagccatccaggagctcttcaagcgcatctcggagcagttcactgccatgttccgccggaaggccttcctccactggtacacaggcgagggcatggacgagatggagttcaccgaggctgagagcaacatgaacgacctcgtctctgagtatcagcagtaccaggatgccaccgcagaagaggaggaggatttcggtg
aggaggccgaagaggaggcc taa(terminator codon)
Vimentin (vimentin) Genebank NM_003380.3 1398 bp
atgtccaccaggtccgtgtc ctcgtcctcctaccgcaggatgttcggcggcccgggcaccgcgagccggccgagctccagccggagctacgtgactacgtccacccgcacctacagcctgggcagcgcgctgcgccccagcaccagccgcagcctctacgcctcgtccccgggcggcgtgtatgccacgcgctcctctgccgtgcgcctgcggagcagcgtgcccggggtgcggctcctgcaggactcggtggacttctcgctggccgacgccatcaacaccgagttcaagaacacccgcaccaacgagaaggtggagctgcaggagctgaatgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaataagatcctgctggccgagctcgagcagctcaagggccaaggcaagtcgcgcctgggggacctctacgaggaggagatgcgggagctgcgccggcaggtggaccagctaaccaacgacaaagcccgcgtcgaggtggagcgcgacaacctggccgaggacatcatgcgcctccgggagaaattgcaggaggagatgcttcagagagaggaagccgaaaacaccctgcaatctttcagacaggatgttgacaatgcgtctctggcacgtcttgaccttgaacgcaaagtggaatctttgcaagaagagattgcctttttgaagaaactccacgaagaggaaatccaggagctgcaggctcagattcaggaacagcatgtccaaatcgatgtggatgtttccaagcctgacctcacggctgccctgcgtgacgtacgtcagcaatatgaaagtgtggctgccaagaacctgcaggaggcagaagaatggtacaaatccaagtttgctgacctctctgaggctgccaaccggaacaatgacgccctgcgccaggcaaagcaggagtccactgagtaccggagacaggtgcagtccctcacctgtgaagtggatgcccttaaaggaaccaatgagtccctggaacgccagatgcgtgaaatggaagagaactttgccgttgaagctgctaactaccaagacactattggccgcctgcaggatgagattcagaatatgaaggaggaaatggctcgtcaccttcgtgaataccaagacctgctcaatgttaagatggcccttgacattgagattgccacctacaggaagctgctggaaggcgaggagagcaggatttctctgcctcttccaaacttttcctccctgaacctgagggaaactaatctggattcactccctctggttgatacccactcaaaaaggacacttctgattaagacggttgaaactagagatggacaggttatcaacgaaacttctc
agcatcacgatgaccttgaa taa(terminator codon)
Lamin A/C (Lamin A/C) Genebank BC014507.1 1992 bp
atggagaccccgtcccagcg gcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggctgcgccttcgcatcaccgagtctgaagaggtggtcagccgcgaggtgtccggcatcaaggccgcctacgaggccgagctcggggatgcccgcaagacccttgactcagtagccaaggagcgcgcccgcctgcagctggagctgagcaaagtgcgtgaggagtttaaggagctgaaagcgcgcaataccaagaaggagggtgacctgatagctgctcaggctcggctgaaggacctggaggctctgctgaactccaaggaggccgcactgagcactgctctcagtgagaagcgcacgctggagggcgagctgcatgatctgcggggccaggtggccaagcttgaggcagccctaggtgaggccaagaagcaacttcaggatgagatgctgcggcgggtggatgctgagaacaggctgcagaccatgaaggaggaactggacttccagaagaacatctacagtgaggagctgcgtgagaccaagcgccgtcatgagacccgactggtggagattgacaatgggaagcagcgtgagtttgagagccggctggcggatgcgctgcaggaactgcgggcccagcatgaggaccaggtggagcagtataagaaggagctggagaagacttattctgccaagctggacaatgccaggcagtctgctgagaggaacagcaacctggtgggggctgcccacgaggagctgcagcagtcgcgcatccgcatcgacagcctctctgcccagctcagccagctccagaagcagctggcagccaaggaggcgaagcttcgagacctggaggactcactggcccgtgagcgggacaccagccggcggctgctggcggaaaaggagcgggagatggccgagatgcgggcaaggatgcagcagcagctggacgagtaccaggagcttctggacatcaagctggccctggacatggagatccacgcctaccgcaagctcttggagggcgaggaggagaggctacgcctgtcccccagccctacctcgcagcgcagccgtggccgtgcttcctctcactcatcccagacacagggtgggggcagcgtcaccaaaaagcgcaaactggagtccactgagagccgcagcagcttctcacagcacgcacgcactagcgggcgcgtggccgtggaggaggtggatgaggagggcaagtttgtccggctgcgcaacaagtccaatgaggaccagtccatgggcaattggcagatcaagcgccagaatggagatgatcccttgctgacttaccggttcccaccaaagttcaccctgaaggctgggcaggtggtgacgatctgggctgcaggagctggggccacccacagcccccctaccgacctggtgtggaaggcacagaacacctggggctgcgggaacagcctgcgtacggctctcatcaactccactggggaagaagtggccatgcgcaagctggtgcgctcagtgactgtggttgaggacgacgaggatgaggatggagatgacctgctccatcaccaccacggctcccactgcagcagctcgggggaccccgctgagtacaacctgcgctcgcgcaccgtgctgtgcgggacctgcgggcagcctgccgacaaggcatctgccagcggctcaggagcccaggtgggcggacccatctcctctggctcttctgcctccagtgtcacggtcactcgcagctaccgcagtgtggggggcagtgggggtggcagcttcggggacaatctggtcacccgctcctacctcctgggcaactccagcccccgaacccagagcc
cccagaactgcagcatcatg taa(terminator codon)
Lamin B 1(Lamin B1) Genebank BC012295.1 1758 bp
atggcgactgcgacccccgt gccgccgcggatgggcagccgcgctggcggccccaccacgccgctgagccccacgcgcctgtcgcggctccaggagaaggaggagctgcgcgagctcaatgaccggctggcggtgtacatcgacaaggtgcgcagcctggagacggagaacagcgcgctgcagctgcaggtgacggagcgcgaggaggtgcgcggccgtgagctcaccggcctcaaggcgctctacgagaccgagctggccgacgcgcgacgcgcgctcgacgacacggcccgcgagcgcgccaagctgcagatcgagctgggcaagtgcaaggcggaacacgaccagctgctcctcaactatgctaagaaggaatctgatcttaatggcgcccagatcaagcttcgagaatatgaagcagcactgaattcgaaagatgcagctcttgctactgcacttggtgacaaaaaaagtttagagggagatttggaggatctgaaggatcagattgcccagttggaagcctccttagctgcagccaaaaaacagttagcagatgaaactttacttaaagtagatttggagaatcgttgtcagagccttactgaggacttggagtttcgcaaaagcatgtatgaagaggagattaacgagaccagaaggaagcatgaaacgcgcttggtagaggtggattctgggcgtcaaattgagtatgagtacaagctggcgcaagcccttcatgagatgagagagcaacatgatgcccaagtgaggctgtataaggaggagctggagcagacttaccatgccaaacttgagaatgccagactgtcatcagagatgaatacttctactgtcaacagtgccagggaagaactgatggaaagccgcatgagaattgagagcctttcatcccagctttctaatctacagaaagagtctagagcatgtttggaaaggattcaagaattagaggacttgcttgctaaagaaaaagacaactctcgtcgcatgctgacagacaaagagagagagatggcggaaataagggatcaaatgcagcaacagctgaatgactatgaacagcttcttgatgtaaagttagccctggacatggaaatcagtgcttacaggaaactcttacaaggcgaagaagagaggttgaagctgtctccaagcccttcttcccgtgtgacagtatcccgagcatcctcaagtcgtagtgtacgtacaactagaggaaagcggaagagggttgatgtggaagaatcagaggcgagtagtagtgttagcatctctcattccgcctcagccactggaaatgtttgcatcgaagaaattgatgttgatgggaaatttatccgcttgaagaacacttctgaacaggatcaaccaatgggaggctgggagatgatcagaaaaattggagacacatcagtcagttataaatatacctcaagatatgtgctgaaggcaggccagactgttacaatttgggctgcaaacgctggtgtcacagccagccccccaactgacctcatctggaagaaccagaactcgtggggcactggcgaagatgtgaaggttatattgaaaaattctcagggagaggaggttgctcaaagaagtacagtctttaaaacaaccatacctgaagaagaggaggaggaggaagaagcagctggagtggttgttgaggaagaacttttccaccagcagggaaccccaagagcatcca
atagaagctgtgcaattatg taa(terminator codon)
Lamin B 2(Lamin B2) Genebank NM_032737.3 1860 bp
atgagcccgccgagcccggg ccgccgtcgggagcagcgcaggccgcgagccgccgccaccatggccacgccgctgcccggccgcgcgggcgggcccgccacgccgctgtcgcccacgcgcctgtcgcggctgcaggagaaggaggagctgcgcgagctcaacgaccgcctggcgcactacatcgaccgcgtccgcgcgctggagctggagaacgaccggctcctgctcaagatctcagagaaggaggaggtgaccacgcgcgaggtgagtggcatcaaggcgctgtacgagtcggagctggccgatgcccggagagtcctggatgagacggctcgagagcgtgcccggctgcagatagagattgggaagctgagggcagagttggacgaggtcaacaagagcgccaagaagagggagggcgagcttacggtggcccagggccgtgtgaaggacctggagtccctgttccaccggagcgaggtggagctggcagctgccctcagcgacaagcgcggcctggagagtgacgtggctgagctgcgggcccagctggccaaggccgaggacggtcatgcagtggccaaaaagcagctggagaaggagacgctgatgcgtgtggacctggagaaccgctgccagagcctgcaggaggagctggacttccggaagagtgtgttcgaggaggaggtgcgggagacgcggcggcggcacgagcggcgcctggtggaggtggacagcagccggcagcaggagtacgacttcaagatggcacaggcgctggaggagctgcggagccagcacgacgagcaagtgcggctctacaagctggagctggagcagacctaccaggccaagctggacagcgccaagctgagctctgaccagaacgacaaggcggccagtgcggctcgcgaggagctgaaggaggcccgcatgcgcctggagtccctcagctaccagctctccggcctccagaagcaggccagtgccgctgaagatcgcattcgggagctggaggaggccatggccggggagcgggacaagttccggaagatgctggacgccaaggagcaggagatgacggagatgcgggacgtgatgcagcagcagctggccgagtaccaggagctgctggacgtgaagctggccctggacatggagatcaacgcctaccggaagctcctggagggcgaggaggagaggctgaagctgtcccccagcccatcctcgcgcgtcaccgtctcacgagccacctcgagcagcagcggcagcttgtccgccaccgggcgcctgggccgcagtaagcggaagcggctggaggtggaggagcccttgggcagcggcccaagcgtcctgggcacgggcacgggtggcagcggtggcttccacctggcccagcaggcctcggcctcgggtagcgtcagcatcgaggagatcgacctggagggcaagtttgtgcagctcaagaacaactcggacaaggatcagtctctggggaactggagaatcaagaggcaggtcttggagggggaggagatcgcctacaagttcacgcccaagtacatcctgcgcgccggccagatggtcacggtgtgggcagctggtgcgggggtggcccacagccccccctcgacgctggtgtggaagggccagagcagctggggcacgggcgagagcttccgcaccgtcctggttaacgcggatggcgaggaagtggccatgaggactgtgaagaagtcctcggtgatgcgtgagaatgagaatggggaggaagaggaggaggaagccgagtttggcgaggaggatcttttccaccaacagggggacccgaggaccacct
caagaggctgctacgtgatg tga(terminator codon)
Claims (2)
1. a fluorescence probe detects cytoskeletal structure mechanics method, it is characterized in that, adopt gene clone technology, to build be turning point with proline, be changed to feature with angle can there is the right gene clone of " FRET (fluorescence resonance energy transfer) " fluorescin, and to be connected in cytoskeletal protein gene coded sequence or between; By transfectional cell, induce probe at cell inner expression, be incorporated in cytoskeletal structure.
When external force or endogenetic process cytoskeletal structure transmit mechanics effect, position " angle " can be changed induced fluorescence albumen, cause the change of its transferring efficiency of fluorescence resonance energy, accordingly, infer and the quantitative and semi-quantitative degree that cytoskeletal structure transmits mechanical change.
2. the preparation method of fluorescence probe according to claim 1, its preparation process comprises:
A. there is the selection of FRET (fluorescence resonance energy transfer) " fluorescin to ", mainly contain: enhancement mode blue fluorescent protein (eBFP2) and enhanced green fluorescence protein (eGFP); Golden fluorescin (mVenus) and bright cherry-red fluorescin (mcherry); Enhancement mode cyan fluorescent protein (eCFP) and enhancement mode orange fluorescent protein (eYFP).
B. the design of tension detect fluorescence probe and structure
Fluorescin between insert be made up of restriction enzyme site (as KpnI) and proline (CCA) and glycocoll (GG#) 3 with upper amino acid short chain, being formed with proline is the different initial angle fluorescins pair of turning point, regulates its tension force sensitivity.
C. the design of fluorescence probe integrator cell skeleton and structure
Adopt short peptide sequence (taking proline as the amino acid residue of turning point) to be connected between skelemin above-mentioned fluorescence probe clone, basic structure is:
-skelemin-
pro-cloning site-nGly-FP
1-nAA-FP
2 -nGly-cloning site-Pro-skelemin-.
D. the proceeding to and abduction delivering of fluorescence probe
Take plasmid as carrier, by above-mentioned sequence clone to eukaryotic promoter rear end, adopt liposomal transfection teclmiques, import eukaryotic, induce it to express, probe is incorporated into outside cytoskeletal structure.
E. fluorescence probe evaluates the mode of eucaryotic cell structure mechanics
When external force or endogenetic process cytoskeletal structure, the cytoskeleton of tension force induction stretches and fluorescin can be caused to become large to angle, and fluorescence reduces transferring efficiency of fluorescence resonance energy (E).Adopt the FRET detection techniques such as multimode fluorescent microscope, laser co-focusing or fluorescence microplate reader, changing by observing FRET efficiency (E value), can infer that fluorescence is to Angulation changes, finally detect that cytoskeletal structure stretches the mechanical change born.
F. fluorescence probe high flux detection architecture mechanical change
By " long wavelength " fluorescence of above-mentioned structure to " tension detect probe ", be cloned into viral vectors (slow or adenovirus), conjugated compound impact can be reduced, improve probe transfection efficiency; And adopt the resistance to the action of a drug to screen monoclonal cell; The detection of fluorescence microplate reader " high flux " can be realized, can be used for " structural mechanics " structure for target drug screening cell platform.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410699905.2A CN104634769A (en) | 2014-11-28 | 2014-11-28 | Preparation and application of real-time living cell structural mechanics fluorescent detection probe real-time living cell structural mechanics detection method and application of the method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410699905.2A CN104634769A (en) | 2014-11-28 | 2014-11-28 | Preparation and application of real-time living cell structural mechanics fluorescent detection probe real-time living cell structural mechanics detection method and application of the method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104634769A true CN104634769A (en) | 2015-05-20 |
Family
ID=53213761
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410699905.2A Pending CN104634769A (en) | 2014-11-28 | 2014-11-28 | Preparation and application of real-time living cell structural mechanics fluorescent detection probe real-time living cell structural mechanics detection method and application of the method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104634769A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106290988A (en) * | 2015-05-25 | 2017-01-04 | 中国科学院上海应用物理研究所 | saturated resonance energy transfer super-resolution probe and its preparation method and application |
| CN113444047A (en) * | 2016-07-20 | 2021-09-28 | 纳莹(上海)生物科技有限公司 | Fluorescent probe and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101124472A (en) * | 2004-03-17 | 2008-02-13 | 夏威夷大学 | Sensor constructs and detection methods |
| CN103038640A (en) * | 2009-01-22 | 2013-04-10 | 波茨坦大学 | Method for detecting an analyte in a sample by multiplexing fret analysis and kit |
| CN103228669A (en) * | 2010-09-27 | 2013-07-31 | 国立大学法人京都大学 | Linker for unimolecular FRET biosensor based on principle of fluorescence resonance energy transfer |
-
2014
- 2014-11-28 CN CN201410699905.2A patent/CN104634769A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101124472A (en) * | 2004-03-17 | 2008-02-13 | 夏威夷大学 | Sensor constructs and detection methods |
| CN103038640A (en) * | 2009-01-22 | 2013-04-10 | 波茨坦大学 | Method for detecting an analyte in a sample by multiplexing fret analysis and kit |
| CN103228669A (en) * | 2010-09-27 | 2013-07-31 | 国立大学法人京都大学 | Linker for unimolecular FRET biosensor based on principle of fluorescence resonance energy transfer |
Non-Patent Citations (1)
| Title |
|---|
| JUN GUO ET AL.: "Fluorescence-Based Force/Tension Sensors: A Novel Tool to Visualize Mechanical Forces in Structural Proteins in Live Cells", 《ANTIOXIDANTS & REDOX SIGNALING》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106290988A (en) * | 2015-05-25 | 2017-01-04 | 中国科学院上海应用物理研究所 | saturated resonance energy transfer super-resolution probe and its preparation method and application |
| CN113444047A (en) * | 2016-07-20 | 2021-09-28 | 纳莹(上海)生物科技有限公司 | Fluorescent probe and preparation method and application thereof |
| CN113444047B (en) * | 2016-07-20 | 2023-06-16 | 纳莹(上海)生物科技有限公司 | Fluorescent probe and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tirnauer et al. | EB1 targets to kinetochores with attached, polymerizing microtubules | |
| Shcherbakova et al. | Near-infrared fluorescent proteins: multiplexing and optogenetics across scales | |
| Köhler et al. | Superresolution microscopy reveals the three-dimensional organization of meiotic chromosome axes in intact Caenorhabditis elegans tissue | |
| Ishikawa-Ankerhold et al. | Advanced fluorescence microscopy techniques—Frap, Flip, Flap, Fret and flim | |
| Cane et al. | Elevated polar ejection forces stabilize kinetochore–microtubule attachments | |
| WO2007035553A2 (en) | Methods and compositions for detecting neoplastic cells | |
| Louka et al. | Proteins that control the geometry of microtubules at the ends of cilia | |
| Liu et al. | Simultaneous visualization of parental and progeny viruses by a capsid-specific HaloTag labeling strategy | |
| Danquah et al. | Direct interaction of baculovirus capsid proteins VP39 and EXON0 with kinesin-1 in insect cells determined by fluorescence resonance energy transfer-fluorescence lifetime imaging microscopy | |
| Kim et al. | Near-infrared lipophilic fluorophores for tracing tissue growth | |
| Pan et al. | Near-infrared light remotely up-regulate autophagy with spatiotemporal precision via upconversion optogenetic nanosystem | |
| Liu et al. | In vitro assays: friends or foes of cell-penetrating peptides | |
| Wang et al. | Nonmuscle myosin II in cardiac and skeletal muscle cells | |
| Stirnnagel et al. | Differential pH-dependent cellular uptake pathways among foamy viruses elucidated using dual-colored fluorescent particles | |
| Hoffmann et al. | Live cell imaging reveals actin-cytoskeleton-induced self-association of the actin-bundling protein WLIM1 | |
| Chojnacki et al. | Investigation of HIV‐1 assembly and release using modern fluorescence imaging techniques | |
| Anobile et al. | Nuclear localization and dynamic properties of the Marek's disease virus oncogene products Meq and Meq/vIL8 | |
| CN104634769A (en) | Preparation and application of real-time living cell structural mechanics fluorescent detection probe real-time living cell structural mechanics detection method and application of the method | |
| CN113667694B (en) | Bimolecular fluorescence complementary system based on photopigment protein miRFP670nano | |
| Gardini et al. | Three-dimensional tracking of quantum dot-conjugated molecules in living cells | |
| Wilson | Motor skills: recruitment of kinesins, myosins and dynein during assembly and egress of alphaherpesviruses | |
| Kim et al. | Fluorescent protein-based autophagy biosensors | |
| Katoh et al. | Biophysical analysis of mechanical signals in immotile cilia of mouse embryonic nodes using advanced microscopic techniques | |
| CN100557031C (en) | Detect the polynucleotide sequence of matrix metal proteinase activity | |
| Sanfeliu-Cerdán et al. | A rigidity phase transition of Stomatin condensates governs a switch from transport to mechanotransduction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150520 |
|
| WD01 | Invention patent application deemed withdrawn after publication |