CN104513853A - Field detection kit for resistance of peach brown rot fungus to DMI bactericide - Google Patents
Field detection kit for resistance of peach brown rot fungus to DMI bactericide Download PDFInfo
- Publication number
- CN104513853A CN104513853A CN201410314219.9A CN201410314219A CN104513853A CN 104513853 A CN104513853 A CN 104513853A CN 201410314219 A CN201410314219 A CN 201410314219A CN 104513853 A CN104513853 A CN 104513853A
- Authority
- CN
- China
- Prior art keywords
- dmi
- primer
- brown rot
- test kit
- peach brown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer for field rapid detection of the resistance of peach brown rot fungus to a DMI bactericide. The primer comprises the following two pairs of primers: outer primers and inner primers with the sequences of MoF:TTTAAGGTACGAACACGAATC, MoB:TCGATGTAGGTGATGGAAG, MoFIP:TGTAAAAAGTATCTCTTCAATACCTTTCAAATCTAAACTACGGTA and MoBIP:GAGCAGAGTATCCCATTTAAATGTGTGAGGACTCGTTGTT respectively. The invention also provides a kit prepared by using the primers, and an application of the kit in the detection of whether a peach brown rot fungus strain has resistance to the DMI bactericide or not. The kit can effectively predicate that the bactericide can effectively prevent and treat peach brown rot pathogens or not before the bactericide is sprayed in order to prevent the control failure caused by continuous spraying of pathogens having resistance.
Description
Technical field
The present invention relates to phytopathogen liquefaction resistance technical field, particularly refer to the Fields detection test kit of the anti-DMI series bactericidal agent of a kind of peach brown rot fungus.
Background technology
Peach brown rot is the important disease that the serious harm peach caused by ascomycetes chain sclerotinia sclerotiorum (Monilinia spp.) produces, except the common peach of harm, this disease also endangers the tone fruit trees such as nectarine, cherry, apricot, Lee, and some of them kind even also endangers the pomaceous fruit tree such as apple, pears.Brown heart spreads all over the world, and wherein with the U.S., serious financial consequences the most seriously, all can be caused before adopting and after adopting in Asia, the harm of Some European country.
Current use sterilant is being the Main Means controlling this disease.In production, Monilinia fructicola prevented and treated by conventional sterol demethylation enzyme inhibitors class (DMIs) sterilant, through the use of two more than ten years, State of Georgia, US, the South Carolina, there is DMIs resistant strain all successively in New York and Ohio, many orchards are caused to occur the phenomenon that control is failed causing larger financial loss.
Antagonism bacterial strain carries out molecular studies discovery, and the upstream regulatory region of the MfCYP51 gene of resistant strain all exists the insertion segment ' Mona ' of 65 base pairs, is the reason causing bacterial strain to produce resistance.
If whether just resistant strain can be created in clear and definite field before spray medicine, just can accurately formulate sterilant and spray plan.Detection method relatively more conventional at present comprises two kinds, the traditional colony diameter method namely based on mycelial growth suppresses and the round pcr of based target gene.Traditional colony diameter method needs to gather field bacterial strain, carries out single spore separation, then cultivates on the agricultural chemicals substratum adding a series of concentration, detects agricultural chemicals to the effect of mycelial growth, according to EC
50(in suppression concentration) or MIC (minimum inhibitory concentration) differentiate resistance, according to the discriminating concentration standard of Luo and Schnabel, namely using 0.3mg/L as the standard distinguishing DMI series bactericidal agent resistance and sensitive strain.The insertion of the Mona fragment of the upstream regulatory region 65bp of the MfCYP51 gene of resistant strain is the reason that the most of pathogenic fungi in field develops immunity to drugs to DMI series bactericidal agent.Design corresponding primer on this basis, qualitative detection (Luo can be carried out to the resistance of peach brown rot bacterial strain by expanding fragment length or sequencing result, C.X., Cox, K.D., Amiri, A., and Schnabel, G.2008.Occurrence and detection of the DMI resistance-associated geneticelement'Mona'in Monilinia fructicola.Plant Disease92:1099-1103.).
The sensitivity testing method of traditional mycelia to medicament needs a few time-of-week usually, and workload is large, measures limited sample size, requires strict aseptic technique, is difficult to the existence just finding drug-fast strain in early days.The detection method of PCR-based technology, required instrument price is expensive, higher to the technical requirements of operator, is not suitable for promoting in agricultural sectors such as field or ground cities and counties.
Summary of the invention
For the deficiencies in the prior art, it is long that first object of the present invention is to overcome prior art sense cycle, workload is large, need aseptic condition, and round pcr is to instrument and the high defect of personnel's technical requirements, a kind of, result convenient, sensitive based on molecular level is provided to judge directly perceived and in the peach brown rot liquefaction resistance method of field operation, can ensure that basic unit technician is in field, in two hours, obtain objective, reliable detected result.
Second object of the present invention is development and the matching used test kit of above-mentioned purpose, and the technician of the basic agriculture departments such as Shi Di cities and counties grasps the drug resistance profile of this locality, then peach brown rot bacterial strain in real time, carries out prevention of damage by disease and chemical prevention work.
The invention provides the Fields detection test kit of the anti-DMI series bactericidal agent of a kind of peach brown rot fungus, it is the test kit whether sterol demethylation enzyme inhibitors class (DMIs) sterilant having been produced to resistance at field rapid detection peach brown rot bacterial strain, the peach brown rot fungus detecting anti-DMI series bactericidal agent that can be quick, easy, accurate, sensitive from mycelia in two hours.
For achieving the above object, the primer of the Fields detection of the anti-DMI series bactericidal agent of peach brown rot fungus provided by the present invention, is characterized in that: comprise two pairs of primers, be respectively outer primer and inner primer, its sequence is respectively:
Outer primer:
MoF:TTTAAGGTACGAACACGAATC；
MoB:TCGATGTAGGTGATGGAAG；
Inner primer:
MoFIP:TGTAAAAAGTATCTCTTCAATACCTTTCAAATCTAAACTACGGTA；
MoBIP:GAGCAGAGTATCCCATTTAAATGTGTGAGGACTCGTTGTT。
The test kit that the present invention also provides a kind of above-mentioned primer to prepare, is characterized in that: this test kit comprises: 10 × Thermopol Buffer, BstDNA polysaccharase, dNTP (Mixture), MgCl
2solution, outer primer MoF and MoB, inner primer MoFIP and MoBIP.
Further, described test kit also comprises LyseGo lysate (Thermo Scientific company) and SYBR Green I dyestuff.
The present invention also provides a kind of mentioned reagent box whether detecting peach brown rot bacterial strain to the application in DMI series bactericidal agent generation resistance.
Further, the application of mentioned reagent box, it comprises the steps:
(1) a small amount of mycelia of picking is in 10uL Lyso Go lysate, 100 DEG C of 5min;
(2) according to reaction system obtain solution, described reaction system (25ul) comprising: 10 × Thermopol Buffer2.5uL, dNTPs (10mmol/L) 3uL, Mg
2+(25mmol/L) 5.0uL, MoF (10umol/L) 0.3uL, MoB (10umol/L) 0.3uL, MoFIP (10umol/L) 3.5uL, MoBIP (10umol/L) 3.5uL, DNA profiling 5.9uL, Bst archaeal dna polymerase (8U/uL) 1uL; Described DNA profiling is the Lyso Go lysate of picking mycelia; 61 DEG C of 75min, 85 DEG C of 10min;
(3) in gained amplified production, add 1uL SYBR Green I dyestuff, observe color reaction, obtain a result.
Test kit of the present invention just can go out field and whether created DMI series bactericidal agent resistant strain by Accurate Prediction before spraying sterilant, this test kit can in one and a half hours, under the condition not needing valuable loaded down with trivial details Laboratory Instruments, indicate whether there is resistant strain by color reaction clearly, to the germ Management strategy of the science of formulation, ensure that the sound development of peach industry is significant.
It is consuming time that the present invention overcomes the sensitivity testing method of peach brown rot fungus to DMI series bactericidal agent in conventional art, and workload is large, measures limited sample size, require strict aseptic technique, be difficult to the Problems existing finding drug-fast strain in early days.Also overcome the detection method of PCR-based technology, required instrument price is expensive, high to operator's technical requirements, is difficult to the problem of carrying out in basic agriculture department and field simultaneously.Can in field, fast, accurately detect great amount of samples, Detection accuracy reaches more than 95%, to the germ Management strategy of the science of formulation, ensures that the sound development of peach industry is significant.
The Fields detection test kit of peach brown rot fungus of the present invention anti-DMI series bactericidal agent is compared with existing other technologies, and tool has the following advantages and positively effect:
1, the present invention is on the Research foundation of known peach brown rot fungus anti-DMI series bactericidal agent molecule mechanism, according to the insertion of 65bp base pair, application loop-mediated isothermal amplification technology, detection peach brown rot fungus is made not need expensive PCR instrument device to the resistance of DMI series bactericidal agent, under field condition, just can detect great amount of samples fast, accurately, whether rapid detection field pathogenic bacteria before spraying sterilant has been developed immunity to drugs becomes possibility.
2, the invention provides can four pairs of cyclisation primer combining to the 65bp Insert Fragment that DMI sterilant resistance produces of specificity and peach brown rot fungus, and efficiently and accurately detection kit and amplification condition easily.Apply the peach brown rot fungus detecting anti-DMI series bactericidal agent that this test kit can be quick, easy, accurate, sensitive from mycelia in two hours, highly sensitive genomic dna, detection speed is compared quicker than traditional detection method-colony diameter method, detect than common molecular: separation and purification sample, extract DNA, pcr amplification, more simply, efficiently.
3, step is simple to operation, does not need the senior instrument in the laboratories such as PCR instrument, and this work for basic unit's plant protection unit and field operation is significant.Use Auele Specific Primer and loop-mediated isothermal amplification reaction, very high accuracy rate and sensitivity can be reached, the detection to field sample can be completed in 2h.
Accompanying drawing explanation
Fig. 1 is the amplification electrophoretogram of LAMP Auele Specific Primer MoF/MoB/MoFIP/MoBIP to 41 peach brown rot bacterial strain DNA.
Wherein: M represents Marker, 1-22 represents resistant strain D-7 successively, D-1, Dmap3-08, Bmpc5, DR1, DR2, DR3, DR4, DR5, DR6, DR7, DR8, DR9, DR10, DR11, DR12, DR13, DR14, DR15, DR16, DR17, DR18, 23-41 represents sensitive strain CPL-6-1 successively, HWL10-1b, CPL-3-1, ZM09-2a, YHC11-1, YHC11-2, YHC11-3, YHC11-4, YHC11-5, YHC11-6, HG1a, HG2a, HG6a, HG5a, HG7a, HG8a, HG9a, GTC1a, GTC2a, 42 take sterile purified water as contrast.
Fig. 2 is the LAMP product electrophoresis result of peach brown rot DMI resistance and sensitive strain mycelia.
Wherein: M represents Marker, the resistant strain selected is followed successively by D-7, D-1, Dmap3-08, Bmpc5, DR1, DR2, DR3, DR4, DR5, DR6, and the sensitive strain selected is followed successively by CPL-6-1, HWL10-1b, CPL-3-1, ZM09-2a, YHC11-1, YHC11-2, HG1a, HG2a, GTC1a, GTC2a.
Fig. 3 is the LAMP amplified production after adding dyestuff.
Wherein: resistant strain is D-7, sensitive strain is CPL-3-1.
Embodiment
Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail.
The mechanism of the anti-DMI series bactericidal agent of peach brown rot fungus is the insertion segment ' Mona ' that there are 65 base pairs at the upstream regulatory region of the target gene MfCYP51 gene of this sterilant.Increase the upstream regulatory region of above-mentioned MfCYP51 gene, detect the insertion that whether there are 65 base pairs, according to loop-mediated isothermal amplification technology (loop-mediatedisothermal amplification of DNA, LAMP) Auele Specific Primer is designed, amplified reaction can be carried out under constant temperature, do not need the expensive device such as indoor PCR instrument, its primer sequence is as follows:
Outer primer:
MoF:TTTAAGGTACGAACACGAATC
MoB:TCGATGTAGGTGATGGAAG
Inner primer:
MoFIP:TGTAAAAAGTATCTCTTCAATACCTTTCAAATCTAAACTACGGTA
MoBIP:GAGCAGAGTATCCCATTTAAATGTGTGAGGACTCGTTGTT
Detect the detection kit (400 times) whether having above-mentioned 65bp base pair to insert, contain:
1)10ml10×Thermopol Buffer
2) MgCl of 20ml25mM
2solution
3) dNTP (Mixture) of 12ml10mM
4) outer primer MoF and MoB of 1.2ml10uM
5) inner primer MoFIP and MoBIP of 14ml10uM
6) 3200U (8U/ul) Bst archaeal dna polymerase
7)1ml10000*SYBR Green Ⅰ
8) 5ml Lyse Go lysate (Thermo Scientific company)
The present invention's reaction system (25ul), includes:
10×Thermopol Buffer 2.5uL
dNTPs(10mmol/L) 3uL
Mg
2+(25mmol/L) 5.0uL
MoF(10umol/L) 0.3uL
MoB(10umol/L) 0.3uL
MoFIP(10umol/L) 3.5uL
MoBIP(10umol/L) 3.5uL
DNA profiling 5.9
BstDNA polysaccharase (8U/uL) 1uL
In the present invention, the first a little mycelia of picking, adds 10ul lyse go reagent (Thermo Scientific company), cracking 5 minutes at 100 DEG C.Draw this lysate of 5.9ul to add containing buffer, dNTP, Mg
2+, four specificity cyclisation primers, in the mixed system of DNA Bst I polysaccharase, isothermal duplication 75 minutes at 61 DEG C, 85 DEG C 10 minutes.
After having increased, add 1ul10000*SYBR Green I dyestuff, observe color reaction.If create a large amount of amplified production, then add SYBR Green I dyestuff and can form the clear distinguishable fluorescent green of naked eyes, if do not produce amplified production, then adding nondiscoloration after SYBR Green I dyestuff, is still brown.After adding dyestuff, what produce green fluorescence is resistant strain, and color is russet is sensitive strain (as shown in Figure 3).
If resistant strain, add dyestuff later in fluorescent green, show that cannot re-use DMI series bactericidal agent prevents and treats.If not resistant strain, be brown after adding dyestuff, show to use DMI series bactericidal agent to prevent and treat.
Embodiment one:
The loop-mediated isothermal amplification of the cyclisation Auele Specific Primer MoF/MoB/MoFIP/MoBIP of peach brown rot bacterial strain (M.fructicola):
Gather peach brown rot bacterial strain from American South Ka Lailuona state, indoor conventional single spore separation, obtain the strain of DMI resistant strain 22, gather be separated to DMI sensitive strain 19 strain from Hubei China, Yunnan, Gansu.According to (documents) such as sieve, to increase respectively DMI resistance and sensitive strain according to DMI sterilant target gene MfCYP51 upstream region design primer UpCYP-1F:AGAGCTACCACCCACGAGGAA and UpCYP-1R:GACCGCTGCGAAATCTCTTGA, order-checking finds, all DMI resistant strains contain 65bpMona fragment at MfCYP51 upstream region and insert, and all DMI sensitive strains are not all containing this insertion.
According to this 65bp sequence and its upstream and downstream sequence, the online website utilizing LAMP primer to design (http://primerexplorer.jp/e/) devises cyclisation Auele Specific Primer:
Outer primer:
MoF:TTTAAGGTACGAACACGAATC
MoB:TCGATGTAGGTGATGGAAG
Inner primer:
MoFIP:TGTAAAAAGTATCTCTTCAATACCTTTCAAATCTAAACTACGGTA
MoBIP:GAGCAGAGTATCCCATTTAAATGTGTGAGGACTCGTTGTT
Using the kit formulation in the present invention, use cyclisation Auele Specific Primer MoF/MoB/MoFIP/MoBIP respectively, with the genomic dna of above-mentioned 41 strain peach brown rot bacterial strains for template, and is that pcr amplification is carried out in contrast with sterile purified water.Contain in 25ul reaction system: 1. 2.5ul10 × ThermopolBuffer damping fluid 2. 3.0uLdNTPs (Mixture) (10mmol/L) 3. 5.0uLMgCl
2(25mmol/L) 4. outer primer: MoF and MoB (10umol/L) each 0.3uL 5. inner primer: MoFIP and MoBIP (10umol/L) each 3.5uL is DNA profiling 1uL 7. BstDNA polysaccharase (8U/uL) 1uL 8. 4.9uLddH 6.
20.LAMP amplification reaction condition: 61 DEG C of 75min, 85 DEG C of 10min.
DMI resistant strain obtains corresponding amplified production by cyclisation Auele Specific Primer MoF/MoB/MoFIP/MoBIP, and sensitive strain and water contrast are then without corresponding amplified production (Fig. 1).
As shown in Figure 1, in 42 samples of detection, 1 ~ 22 is DMI resistant strains, and 23 ~ 41 is DMI sensitive strains, and 42 is ddH
20 contrast.Accuracy in detection reaches 100%.
Embodiment two:
Peach brown rot bacterial strain (M.fructicola) mycelia is directly with cyclisation Auele Specific Primer MoF/MoB/MoFIP/MoBIP amplification:
Within 2011, gather the peach brown rot bacterial strain of returning from American South Ka Lailuona state, its mycelia of picking is directly used in liquefaction resistance: a small amount of mycelia of picking is placed in PCR centrifuge tube, adds 10uL Lyse Go, and after heating 5min in 100 DEG C of water, normal temperature places cooling.Get 5.9uL liquid as template, with cyclisation Auele Specific Primer MoF/MoB/MoFIP/MoBIP, it is increased.Use the kit formulation in the present invention, in 25uL reaction system, contain 1. 2.5ul10 × Thermopol Buffer damping fluid 2. 3.0uL dNTPs (Mixture) (10mmol/L) 3. 5.0uL MgCl
2(25mmol/L) 4. outer primer: MoF and MoB (10umol/L) each 0.3uL 5. inner primer: MoFIP and MoBIP (10umol/L) each 3.5uL 6. BstDNA polysaccharase (8U/uL) 1uL 7. 5.9uL lysate (about 5ngDNA) be template.Amplification condition: 61 DEG C of 75min, 85 DEG C of 10min.
The results are shown in Figure 2, illustrate directly with mycelia amplification, resistant strain (D-7, D-1, Dmap3-08, Bmpc5, DR1, DR2, DR3, DR4, DR5, DR6) corresponding amplified production can be obtained, the bacterial strain and sensitive strain (CPL-6-1, HWL10-1b, CPL-3-1, ZM09-2a, YHC11-1, YHC11-2, HG1a, HG2a, GTC1a, GTC2a) cannot be increased accordingly.This method is compared with extraction mycelia genomic dna, and accuracy rate is identical all reaches 100%, and the time is short, only less than 2h, and need not need expensive Laboratory Instruments.
Embodiment three: staining reaction is carried out to cyclisation amplified production
SYBRGreen I is a kind of dyestuff with green excitation wavelength being incorporated into all dsDNA minor groove regions.Under unbound state, SYBRGreen I sends faint fluorescence, but once after being combined with double-stranded DNA, fluorescence strengthens greatly.Utilize this feature, if amplification produces a large amount of double-strand, after adding this dyestuff, can produce naked eyes can the green fluorescence of clear resolution, and if do not produce amplified production, after adding this dyestuff, do not have colour-change and present sorrel.The results are shown in Figure 3, can green fluorescence be produced after resistant strain amplification dyeing, and be sorrel after sensitive strain amplification dyeing.
The Cleaning Principle of test kit of the present invention: the Lyse Go reagent of Thermo Scientific company can discharge the DNA in mycelia at high temperature 2 minutes, thus make to detect bacterial strain resistance from molecular level and become possibility.The insertion of the Mona fragment of the upstream regulatory region 65bp of the MfCYP51 gene of resistant strain is the reason that the most of pathogenic fungi in field develops immunity to drugs to DMI series bactericidal agent.Design corresponding primer on this basis, utilize loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) technology rapid amplifying resistant strain just distinctive Mona fragment.LAMP technology principle designs 4 special primers according to 6 specific regions detecting target gene, under 60 DEG C ~ 65 DEG C isoperibols, utilize in strand displacement archaeal dna polymerase 60 ~ 80min and can complete testing, do not need the steps such as the thermally denature of template, temperature cycle, a large amount of amplified production [8 ~ 10] can be formed.After amplification terminates, add SYBR Green I dyestuff, this dyestuff can be incorporated into all dsDNA minor groove regions, and produces green excitation wavelength.Under unbound state, SYBR Green I sends faint fluorescence, but once after being combined with double-stranded DNA, fluorescence strengthens greatly.In a large amount of amplified productions that this experiment is formed, add this dyestuff, the green fluorescence of the clear identification of naked eyes energy can be produced.If produce green fluorescence after adding dyestuff, explanation is DMI resistant strain, if do not produce green fluorescence and in the sorrel of dyestuff itself, be then sensitive strain.
Claims (5)
1. a primer for the Fields detection of the anti-DMI series bactericidal agent of peach brown rot fungus, is characterized in that: comprise two pairs of primers, be respectively outer primer and inner primer, its sequence is respectively:
Outer primer:
MoF:TTTAAGGTACGAACACGAATC；
MoB:TCGATGTAGGTGATGGAAG；
Inner primer:
MoFIP:TGTAAAAAGTATCTCTTCAATACCTTTCAAATCTAAACTACGGTA；
MoBIP:GAGCAGAGTATCCCATTTAAATGTGTGAGGACTCGTTGTT。
2. the test kit utilizing primer described in claim 1 to prepare, is characterized in that: this test kit comprises: 10 × Thermopol Buffer, Bst archaeal dna polymerase, dNTP (Mixture), MgCl
2solution, outer primer MoF and MoB, inner primer MoFIP and MoBIP.
3. test kit according to claim 2, is characterized in that: described test kit also comprises Lyse Go lysate and SYBR Green I dyestuff.
4. whether a test kit according to claim 2 is detecting peach brown rot bacterial strain to the application in DMI series bactericidal agent generation resistance.
5. the application of test kit according to claim 4, is characterized in that: it comprises the steps:
(1) a small amount of mycelia of picking is in 10uLLysoGo lysate, 100 DEG C of 5min;
(2) according to reaction system obtain solution, described reaction system (25ul) comprising: 10 × Thermopol Buffer2.5uL, dNTPs (10mmol/L) 3uL, Mg
2+(25mmol/L) 5.0uL, MoF (10umol/L) 0.3uL, MoB (10umol/L) 0.3uL, MoFIP (10umol/L) 3.5uL, MoBIP (10umol/L) 3.5uL, DNA profiling 5.9uL, BstDNA polysaccharase (8U/uL) 1uL; Described DNA profiling is LysoGo lysate; 61 DEG C of 75min, 85 DEG C of 10min;
(3) in gained amplified production, add 1uL SYBR Green I dyestuff, observe color reaction, obtain a result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314219.9A CN104513853B (en) | 2014-07-02 | 2014-07-02 | The Fields detection test kit of Fructus Persicae brown rot fungus anti-DMI series bactericidal agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314219.9A CN104513853B (en) | 2014-07-02 | 2014-07-02 | The Fields detection test kit of Fructus Persicae brown rot fungus anti-DMI series bactericidal agent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104513853A true CN104513853A (en) | 2015-04-15 |
| CN104513853B CN104513853B (en) | 2016-09-28 |
Family
ID=52789725
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410314219.9A Active CN104513853B (en) | 2014-07-02 | 2014-07-02 | The Fields detection test kit of Fructus Persicae brown rot fungus anti-DMI series bactericidal agent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104513853B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703310A (en) * | 2022-01-17 | 2022-07-05 | 福建农业职业技术学院 | Monilinia fructicola LAMP (loop-mediated isothermal amplification) detection primers and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045742A (en) * | 2012-12-27 | 2013-04-17 | 西北农林科技大学 | Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification |
-
2014
- 2014-07-02 CN CN201410314219.9A patent/CN104513853B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045742A (en) * | 2012-12-27 | 2013-04-17 | 西北农林科技大学 | Method for detecting Pseudomonas syringae causing kiwi canker by loop-mediated isothermal amplification |
Non-Patent Citations (2)
| Title |
|---|
| CHAO-XI LUO: "Occurrence and Detection of the DMI Resistance-Associated Genetic Element", 《PLANT DISEASE》 * |
| 戴婷婷: "基于环介导等温扩增技术检测橡树疫霉菌", 《南京农业大学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703310A (en) * | 2022-01-17 | 2022-07-05 | 福建农业职业技术学院 | Monilinia fructicola LAMP (loop-mediated isothermal amplification) detection primers and application thereof |
| CN114703310B (en) * | 2022-01-17 | 2024-03-26 | 福建农业职业技术学院 | LAMP (loop-mediated isothermal amplification) detection primer for brown rot of peach and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104513853B (en) | 2016-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schena et al. | Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real‐time PCR | |
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| CN102586461B (en) | Loop mediated isothermal amplification (LAMP) detection method for meloidogyne hapla and application of method | |
| CN103589794A (en) | Method for real-time fluorescence isothermal quantitative detection of citrus huanglongbing | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| Nowakowska et al. | Rapid diagnosis of pathogenic Phytophthora species in soil by real‐time PCR | |
| CN108220474A (en) | A kind of LAMP detection primer of Fusarium graminearum and its application | |
| CN103757093A (en) | Quantitative detection method for FOC race 4 from soil | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| CN110184266A (en) | Citrus leaf DNA rapid extracting method and its application in Citrus Huanglongbing pathogen detection | |
| CN103276057B (en) | LAMP technology based rapid Botrytis cinerea detection method | |
| Tipu et al. | Citrus greening disease (HLB) on Citrus reticulata (Mandarin) caused by Candidatus Liberibacter asiaticus in Bangladesh | |
| CN105524986A (en) | LAMP detection method for rapidly detecting Candidatus Liberibacter asiaticus | |
| CN104694620A (en) | LAMP (loop-mediated isothermal amplification) and primer set adopted molecular detection method of a variety of microorganisms | |
| CN106755339B (en) | Cucumber anthracnose LAMP detection primer and its application | |
| Zhu et al. | Detection and quantification of Fusarium commune in host tissue and infested soil using real‐time PCR | |
| CN104232782A (en) | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer | |
| CN108018374A (en) | For detecting drug-fast kit of the Botrytis cinerea to benzimidazole germicide | |
| Azevedo-Nogueira et al. | Real-time PCR assay for Colletotrichum acutatum sensu stricto quantification in olive fruit samples | |
| CN107828912A (en) | A kind of dosporium cucumerinumand LAMP detection primer and detection method | |
| Dreaden et al. | Development and evaluation of a real‐time PCR seed lot screening method for Fusarium circinatum, causal agent of pitch canker disease | |
| CN107988383A (en) | A kind of LAMP primer group and method that rot stem nematodes are quickly detected from complex samples | |
| CN104513853A (en) | Field detection kit for resistance of peach brown rot fungus to DMI bactericide | |
| CN105200122A (en) | Quantitative detection kit for wheat stripe rust and application thereof | |
| CN104404151A (en) | Kit for detecting blackstem bacteria of sunflowers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |