CN104419711A - Application of gene NgAUREO1 of nannochloropsis gaditana to adjustment and control of metabolism of fatty acid - Google Patents

Abstract

In the invention, a full-length blue-light induced bZIP type transcription factor (NgAUREO1) of 2080bp of nannochloropsis gaditana is cloned. The gene NgAUREO1 comprises an ORF of 1398bp, a 5'-end noncoding region of 192bp and a 3'-end noncoding region of 490bp and is capable of coding 465 amino acids. The gene NgAUREO1 comprises a bZIP structural domain and an LOV structural domain, wherein the bZIP structural domain can be combined with the promoter region of a specific gene to adjust and control the expression of the specific gene, and the LOV structural domain can sense the blue light of about 470nm, so that the gene NgAUREO1 has the characteristic of being capable of being adjusted and controlled by the blue light. The similarity between the sequence of the amino acid in the gene NgAUREO1 and the sequence of the amino acid in the gene aureochromel of vaucheria is 59%. A yeast expression vector of the gene NgAUREO1 is constructed, and the gene NgAUREO1 is introduced into saccharomyces cerevisiae to increase the content of oil in the yeast. The stimulation of the blue light to the recombinant saccharomyces cerevisiae proves that the blue light can serve as a switch to participate in adjusting and controlling the metabolism pathway of the fatty acid.

Description

The application of micro-plan ball algae NgAUREO1 gene in regulation and control fatty acid metabolism

One, technical field:

The present invention relates to from micro-plan ball algae, to have cloned the transcription factor genes involved (NgAUREO1) regulated by blue light that a new coding region is 1398bp, and demonstrate this gene and regulating the New function in fatty acid metabolism.

Two, background technology:

Along with being on the rise of world today's energy dilemma, people progressively sight from traditional petrochemical complex fuel, turn in biomass energy.But the height of organism fat content is one of key issue affecting biomass energy development.There are many scientists in this problem, done large quantifier elimination.The organism relatively high by screening fat content had as raw material, but still cannot meet the demand of biomass energy; What have is placed in the adverse circumstance such as nitrogen stress, low temperature to promote increasing of organism fat content by organism, but this must cause the reduction of biomass; Somebody proposes to be transformed organism by genetically engineered, make it can accumulate grease in a large number, but experimental result majority is unsatisfactory.Mainly utilized gene of tracing it to its cause mostly is the functional gene of single path, and its modification scope is narrow, and capability of influence is weak, thus cannot reach desirable effect.

Transcription factor also claims trans-acting factor, refer to can with the interactional DBP of cis-acting elements generation specificity in gene promoter region, by between them and and other associated protein between interaction can activate or suppress transcribing of some gene.To be positioned to transform individual gene different from gene engineering, and many metabolic pathway of transcription factor technique influence series of genes, these metabolic pathway act on down the regulation and control completing forward or negative sense at the same time.This technology has been proved and can have promoted the accumulation of secondary metabolite in vegetable cell at present.

Aureochromel, in 2007 from without being found every algae, studying and showing that the albumen of this genes encoding has functional transcription factor, can be specific in conjunction with TGACGT sequence.This sequence is the binding site of typical S type or D type bZIP.This gene is made up of a basic leucine zipper structural domain (bZIP) and a LOV structural domain experiencing blue light.The characteristic of this transcription factor by Induced by Blue Light is imparted just because of this special structure.Research shows, this Gene Handling without the branch's growth activity every algae.But not there are some researches prove that this gene has other functions.

We have cloned the bZIP class transcription factor of a new Induced by Blue Light from micro-plan ball algae (Nannochloropsis gaditana), and called after NgAUREO1.The albumen of this coded by said gene has the specific sequence of a bZIP structural domain for binding purposes gene promoter area, and one can sensitive wave be the LOV structural domain of the blue light of 470nm.This gene is 59% with nothing amino acid sequence similarity of aureochromel in algae.We construct the Yeast expression carrier of this gene and import in yeast saccharomyces cerevisiae by this transcription factor, by measuring the content of yeast fat acid, demonstrate the increase that this transcription factor can promote fat content in yeast cell.We also by having the yeast saccharomyces cerevisiae of this gene to carry out blue light illumination to turning, and measure fatty acid content, demonstrate blue light and can control the composition and decomposition that this transcription factor participates in lipid acid.

Three, summary of the invention:

1, the Induced by Blue Light transcription factor NgAUREO1 in micro-plan ball algae has been cloned

From micro-plan ball algae transcript profile database that this laboratory is set up, find the fragment of aureochromel gene, devise two pairs of gene-specific primers (5GSP1,5GSP2 and 3GSP1,3GSP2) according to this fragment.Utilize TransZol Plant total RNA to extract test kit and extract micro-plan ball algae RNA, cDNA is formed with the reverse transcription of TransScript RT Reverse Transcription box, the total length of NgAUREO1 gene is obtained by pcr amplification, be connected on pMD19-T carrier, import competence intestinal bacteria, select positive colony bacterial strain and carry out bacterium liquid PCR and identify.Finally the intestinal bacteria with goal gene fragment are served Hai Shenggong order-checking.Sequencing result shows that the ORF of this gene is 1398bp; 5 ' end non-coding region is 192bp; 3 ' end non-coding region is 490bp, 465 amino acid of encoding.Sequencing result is carried out similarity system design with without the sequence of aureochromel gene in algae, finds the aminoacid sequence of the aureochromel genes encoding in micro-plan ball algae and the homology having 59% without the aminoacid sequence that corresponding gene is encoded in algae.This protein sequence is carried out BLAST analysis, and the 241-300 amino acids showing this albumen is a bZIP transcription factor structural domain; 341-444 amino acids is a LOV structural domain can experiencing blue light.This gene of above analytic explanation is the bZIP class transcription factor can experiencing blue light that the class in micro-plan ball algae is new, called after NgAUREO1.

2, the Yeast expression carrier pYES2-NgAUREO1 of NgA UREO1 gene is constructed

Design a pair primer (P1 with HindIII and SacI restriction enzyme site, P2) with micro-plan ball algae cDNA for template amplification NgAUREO1 gene, and will be connected on pMD19-T carrier after amplified production purifying, import in intestinal bacteria and breed.Extract plasmid utilizes HindlII and SacI Restriction Enzyme to carry out double digestion to pMD19-T and pYES2 simultaneously, obtain small segment and large fragment respectively, utilize T4 ligase enzyme to carry out connecting rear transformation of E. coli and go forward side by side after performing PCR and enzyme cut qualification and obtain recombinant plasmid pYES2-NgAUREOl.

3, demonstrate this gene and can promote the New function that lipid acid accumulates

Respectively by the recombinant plasmid pYES2-NgAUREO1 that builds and empty plasmid pYES2, the method respectively by electric shock transforms and enters in brewing yeast cell.The semi-lactosi of 2% is utilized to induce, the fat content of both mensuration.Experiment shows, the fat content turning the yeast cell of pYES2-NgAUREO1 plasmid is higher than the fat content of the yeast cell turning empty plasmid pYES2.This demonstrate, NgAUREO1 is the transcription factor that a class can promote Cellular Accumulation grease.The present invention demonstrates the function that micro-plan ball algae aureochromel gene has accumulation grease first, point out gene NgAUREO1 of the present invention to may be used for the genetic modification of micro-algae and even other kinds Bio-Energy Material, thus obtain the biological raw material of high fat content.For exploitation biomass energy, there is important theory significance and practical significance.

4, demonstrate NgAUREO1 gene and can carry out the adjustment of fatty acid metabolism as switch by blue light

Two groups of recombination yeasts to be first placed under dark condition inducing culture two days, to stimulate, under another group then remains on dark condition then to wherein one group of blue light carried out 48 hours.Utilize the fat content of these two groups of yeast of Nile red Determination Staining.Result shows, after blue light stimulates, the fat content of yeast obviously reduces, and when transferring under dark condition, the fat content of yeast can rise again to some extent again.Point out gene NgAUREO1 of the present invention can regulate fatty acid content under the control of blue light.

Four, Brief Description Of Drawings:

Fig. 1 represents that Yeast expression carrier pYES2-NgAUREO1 builds the figure of flow process.

Fig. 2 is the PCR qualification of recombination yeast.

In figure, amplified band size is about 1400bp, electrophoresis band is from left to right numbered 1 respectively, 2,3, M.1-3 is positive colony, and M is molecule marker Marker.

Fig. 3 is the Nile red fluorescent value of yeast saccharomyces cerevisiae in different time sections.

X-coordinate is the time, and ordinate zou is fluorescent value.The yeast saccharomyces cerevisiae turning pYES2 is expressed as ▲; The yeast saccharomyces cerevisiae turning pYES2-NgAUREO1 is expressed as ■.

Fig. 4 is the fat content of the yeast saccharomyces cerevisiae turning pYES2 and turn pYES2-NgAUREO1.

Ordinate zou is the mass percent that grease accounts for yeast dry weight.

Fig. 5 is the Nile red fluorescent value of yeast saccharomyces cerevisiae under blue light and dark condition turning pYES2-NgAUREO1.

X-coordinate is the time, and ordinate zou is fluorescent value.▲ represent that the blue light carried out after second day 48 hours in induction stimulates, then proceed in dark; ■ represents the induction fat content of 7 days under dark condition.

Five, embodiment:

All with reference to " Molecular Cloning: A Laboratory guide ", (Huang Peitang etc. translate for microorganism culturing in all embodiments and DNA operation, Science Press, Beijing (2002)) and " fine works Molecular Biology " (Yan Ziying etc. translate, Science Press, Beijing (1998)).Toolenzyme in molecule manipulation is if restriction enzyme is all purchased from Takara company.

The clone of embodiment 1NgAUREO1 gene

From micro-plan ball algae transcript profile database that this laboratory is set up, find the fragment of aureochromel gene, devise two pairs of gene-specific primers (5GSP1,5GSP2 and 3GSP1,3GSP2) according to this fragment.Utilize TransZol Plant total RNA to extract test kit and extract micro-plan ball algae RNA, form cDNA with the reverse transcription of TransScriptRT Reverse Transcription box, obtained the total length of NgAUREO1 gene by pcr amplification.Primer sequence is as follows:

5GSP1：5'-GCTTCCTTGTTCAGTTCCTTCG-3’

5GSP2：5'-CAACCACTACCTCCGCCTCA-3’

3GSP1：5'-TACATCTGGCACTACGGGGC-3’

3GSP2：5'-GCTAACACCGACGCTCAAACT-3’。

To pass through pcr amplification NgAUREO1 product out, purified recovery, is connected on pMD19-T carrier, serves Hai Shenggong and carries out sequencing.Sequencing result shows that the ORF of this gene is 1398bp; 5 ' end non-coding region is 192bp; 3 ' end non-coding region is 490bp, 465 amino acid of encoding.Sequencing result is carried out similarity system design with without the sequence of aureochromel gene in algae, finds the aminoacid sequence of the aureochromel genes encoding in micro-plan ball algae and the homology having 59% without the aminoacid sequence that corresponding gene is encoded in algae.By this albumen

Sequence carries out BLAST analysis, and the 241-300 amino acids showing this albumen is a bZIP transcription factor structural domain; 341-444 amino acids is a LOV structural domain can experiencing blue light.This gene of above analytic explanation is the bZIP class transcription factor can experiencing blue light that the class in micro-plan ball algae is new, called after NgAUREO1.

The extraction of micro-plan ball algae RNA:

(1) in f/2 liquid nutrient medium, micro-plan ball algae is accessed, at 25 DEG C, intensity of illumination 80001x, Light To Dark Ratio is be cultured to the exponential growth later stage under the condition of 12h/12h;

(2) get 1ml algae liquid in 1.5ml centrifuge tube, collected by centrifugation, grinds in liquid nitrogen;

(3) add 1ml TRIzon, repeatedly blow and beat several times, make the abundant cracking of sample.Room temperature places 5 minutes, and protein nucleic acid mixture is separated completely;

(4) in above solution, add 0.2ml chloroform, build pipe lid, thermal agitation 15 seconds, room temperature places 2-3 minute;

Centrifugal 15 minutes of (5) 4 DEG C of 12000rpm, now sample is divided into three layers: red organic phase, the colourless aqueous phase in middle layer and upper strata, and RNA, mainly in aqueous phase, transfers to aqueous phase in a new Rnase-Free centrifuge tube;

(6) in the aqueous phase solution obtained, add equal-volume Virahol, put upside down mixing, room temperature places 10 minutes;

Centrifugal 10 minutes of (7) 4 DEG C of 12000rpm, abandon supernatant;

(8) 1ml75% washing with alcohol precipitation is added;

Centrifugal 3 minutes of (9) 4 DEG C of 12000rpm, careful suction abandons supernatant;

(10) room temperature places 2-3 minute, dries.Add the water without Rnase of 30 μ l, fully dissolve RNA;

The preparation of bacteria plasmid DNA is (according to E.Z.N.A. ^tMplasmid Miniprep Kit):

(1) picking list colony inoculation is in containing in suitable antibiotic LB liquid nutrient medium, and 37 DEG C of shaking culture are spent the night;

(2) 1.5ml bacterium liquid is got in centrifuge tube, centrifugal 60 seconds of 10000rpm;

(3) bacterial sediment is resuspended in 250 μ l solution I, and vibration mixes and leaves standstill several minutes;

(4) add 250 μ l solution II and put upside down mixing, leave standstill 2 minutes;

(5) solution III adding 350 μ l puts upside down mixing until generate white flock precipitate;

(6) centrifugal 10 minutes of 13000rpm;

(7) supernatant is transferred in clean HiBind Miniprep Column (I); Centrifugal 1 minute of 10000rpm;

(8) remove liquid, in HiBind Miniprep Column (I), add the damping fluid HB of 500 μ l, centrifugal 1 minute of 10000rpm;

(9) remove liquid, add the DNA dcq buffer liquid of 700 μ l, centrifugal 1 minute of 10000rpm;

(10) liquid is removed, by blank pipe under the condition of 13000rpm, centrifugal 2 minutes;

(11) HiBind Miniprep Column (I) is placed on the centrifuge tube of new 1.5ml, adds the sterilized water of 30 μ l, place 2 minutes, centrifugal 1 minute of 13000rpm, obtain DNA;

(12) above theory reagent is all purchased in OMEGA company.

Plasmid enzyme restriction condition:

In 30 μ l reaction systems, add 10 × enzyme cutting buffering liquid 3 μ l, DNA1-5 μ g, restriction enzyme 1 μ l, add aseptic double-distilled water and mend to 30 μ l, 37 DEG C are reacted 1 hour, and agarose gel electrophoresis detects enzyme and cuts result.

The recovery (reclaiming test kit according to AxyPrep DNA gel) of DNA fragmentation:

(1) under ultraviolet lamp, cut the sepharose containing target DNA, exhaust gel surface liquid with paper handkerchief and shred.Calculated for gel weight, this weight is as a gel volume (as 100mg=100 μ l);

(2) add the Buffer DE-A of 3 gel volumes, in 75 DEG C of heating after mixing, be interrupted mixing, until gel piece melts completely;

(3) BufferDE-B of 0.5 BufferDE-A volume is added, mixing;

(4) mixed solution in aspiration step 3, transfers to DNA and prepares in pipe, centrifugal 1 minute of 12000rpm.Abandon filtrate;

(5) putting back 2ml centrifuge tube by preparing pipe, adding 500 μ l BufferW1, centrifugal 30 seconds of 12000rpm, abandons filtrate;

(6) putting back 2ml centrifuge tube by preparing pipe, adding 700 μ l BufferW2, centrifugal 30 seconds of 12000rpm, abandons filtrate;

(7) 2ml centrifuge tube is put back by preparing pipe, centrifugal 1 minute of 12000rpm;

(8) be placed in clean 1.5ml centrifuge tube by preparing pipe, preparing the central deionized water adding 25 μ l of film, room temperature leaves standstill 1 minute.12000

Rpm centrifugal 1 minute eluted dna.

Connect:

Add Insert Fragment and the carrier segments of 5:1 proportional in 1O μ l reaction system, the T4DNA ligase enzyme of 1 μ l, place 10 hours for 16 DEG C.

The conversion of competent cell:

(1) get 100 μ l competent cells (purchasing in Quan Shi King Company) and add 5 μ l connection products, mix gently, ice puts 30 minutes;

(2) heat shock 90 seconds in 42 DEG C of water, is placed in rapidly cooled on ice 2 minutes;

(3) 200 μ l LB liquid nutrient mediums are added, 37 DEG C of shaking culture 1 hour;

(4) be spread evenly across containing on suitable antibiotic LB flat board, be inverted overnight incubation for 37 DEG C.

The selection systems of recombinant plasmid:

A. enzyme cuts qualification: picking list bacterium colony is in containing in suitable antibiotic LB liquid nutrient medium, and 37 DEG C of overnight incubation extract plasmid DNA, carry out enzyme cut to determine whether positive colony with suitable restriction enzyme;

B.PCR detects: be template with plasmid DNA, and do pcr amplification reaction under proper condition with specific primer, whether electrophoresis detection has specific band.

The structure of embodiment 2 Yeast expression carrier pYES2-NgAUREO1:

NgAUREO1 gene is connected on pMD19-T carrier, and called after pT-NgAUREO1.PT-NgAUREO1 HindlII and SacI is carried out enzyme cut, reclaim small segment, pYES2 HindlII and SacI enzyme are cut simultaneously, reclaim large fragment, connect small segment and large fragment, transformation of E. coli competent cell is gone forward side by side after performing PCR and enzyme cut qualification and is obtained pYES2-NgAUREO1.

In operating process, related plasmid extracts, enzyme is cut, reclaims, connected, cell transformation, recombinant plasmid enzyme cut qualification and PCR qualification is all carried out according to step described in embodiment 1.

The genetic transformation of embodiment 3 yeast saccharomyces cerevisiae:

The preparation of competent yeast cells:

(1) yeast saccharomyces cerevisiae to be inoculated in the YPD substratum of 100ml 30 DEG C to spend the night, 250rpm, reaches l × 108cells/ml to density;

(2) cell is placed in ice bath to stop growing upper 15 minute;

(3) cell is sub-packed in the 250ml centrifuge tube of 2 sterilizings, centrifugal 5 minutes of 4 DEG C of 3000rpm;

(4) remove supernatant, centrifuge tube is placed on ice;

(5) add the sterilizing icy water of 50ml, vortex is resuspended, and in each centrifuge tube, constant volume is to 50ml, centrifugal 5 minutes of 4 DEG C of 3000rpm;

(6) (5) repetitive operation is pressed with the sterilizing icy water of 25ml;

(7) add the ice-cold 1M sorbyl alcohol re-suspended cell of the sterilizing of 4ml and forward in the 30ml centrifuge tube of ice, centrifugal 5 minutes of 4 DEG C of 3000rpm, abandon supernatant;

(8) add the cold 1M sorbyl alcohol re-suspended cell of 0.5ml sterilizing, cell volume quantitatively arrives 1.3ml, and cell concn reaches 1 × 1010cells/ml.

The conversion of yeast saccharomyces cerevisiae:

(1) add 10 μ l DNA sample and be placed in 1.5ml centrifuge tube, be placed in precooling on ice;

(2) add 80 μ l competent cells and DNA sample to mix gently and in 5 minutes on ice;

(3) DNA and cell mixture being forwarded to specification is in the electric revolving cup of 0.2cm, is placed in freezing on ice, puts into equipment, shock by electricity;

(4) directly the ice-cold 1M sorbyl alcohol of 1ml is added in electric revolving cup, and gently transfer in the pipe of sterilizing;

(5) electric converted product is coated on the agar plate containing 1M sorbyl alcohol, cultivate 48-72 hour in 30 DEG C.

The qualification of embodiment 4 recombination yeast and detection

Pick single bacterium colony that embodiment 3 middle plateform grows with the toothpick of sterilizing, join in PCR reaction solution, with the Auele Specific Primer of the NgAUREO1 gene synthesized

P1：TGC AAGCTTAAAATGTCTACCACCACCAT

P2：C GAGCTCTTATTCTTCTTCGTCAAAGTTG

(in above-mentioned sequence, dashed part is respectively HindIII and SacI restriction enzyme site)

Carry out pcr amplification, the band of about 1400bp can be obtained, illustrate that NgAUREO1 gene has proceeded in yeast saccharomyces cerevisiae.(see Fig. 2: the PCR qualification of recombination yeast)

Embodiment 5 recombination yeast fatty acid determination

Nile red Determination Staining neutral fat content:

(1) by recombination yeast with turn have the yeast of empty plasmid to access in inducing culture, the semi-lactosi adding 2% is induced;

(2) get the yeast 1ml of different time sections, add the dimethyl sulfoxide (DMSO) of 50 μ l, mixing;

(3) add the Nile red solution of the 0.1g/l of 10 μ l, lucifuge leaves standstill 5 minutes;

(4) be 488nm in excitation wavelength, emission wavelength is the fluorescent value measuring bacterium liquid under the condition of 616nm, and this fluorescent value reflects the content of neutral fat.

Result shows, and when induction the 3rd day, fluorescent value reached the highest, and the fluorescent value of recombination yeast is apparently higher than the yeast turning empty plasmid.(see Fig. 3: yeast saccharomyces cerevisiae is at the Nile red fluorescent value of different time sections)

Thalline grease extracts and assay:

(1) by the induction nutrient solution of 3 days through 3000rpm centrifugal 15 minutes, collect thalline, lyophilize 24 hours, weighs;

(2) every gram of thalline adds the hydrochloric acid of 6m14M, vibration mixing, and ambient temperatare puts 30 minutes;

(3) proceed to boiling water bath 3 minutes ,-20 DEG C of speed are cold;

(4) chloroform of 10ml is added: methyl alcohol (1:1), fully after vibration, centrifugal 15 minutes of 3000rpm;

(5) get chloroform layer, add the sodium chloride solution of equal-volume 0.1%, mixing, centrifugal 15 minutes of 3000rpm;

(6) collect chloroform layer with the test tube of known weight, volatilization removing chloroform layer, weighs, the grease yield obtained.

Result shows, and the fat content turning the yeast saccharomyces cerevisiae of pYES2-NgAUREO1 is higher than the fat content of the yeast saccharomyces cerevisiae turning pYES2 by 27.8%.(see Fig. 4: turn pYES2 and the fat content of yeast saccharomyces cerevisiae turning pYES2-NgAUREO1)

Embodiment 6 recombination yeast is fatty acid determination under blue light stimulates

Two groups of recombination yeasts to be first placed under dark condition inducing culture two days, to stimulate, under another group then remains on dark condition then to wherein one group of blue light carried out 48 hours.Utilize the fat content of these two groups of yeast of Nile red Determination Staining.Result shows, after blue light stimulates, the fat content of yeast obviously reduces, and when transferring under dark condition, the fat content of yeast can rise again to some extent again.This shows, blue light can the effect of control NgAUREO1 in fatty acid metabolism.(see Fig. 5: the Nile red fluorescent value of yeast saccharomyces cerevisiae under blue light and dark condition turning pYES2-NgAUREO1)

In operating process, Nile red mensuration neutral fat carries out according to step described in embodiment 5.

Claims (7)

1. the coding region of cloning from micro-plan ball algae is the transcription factor gene NgAUREO1 by Induced by Blue Light of 1398bp, the feature of this gene is: this genes encoding albumen be made up of 465 amino acid, and the LOV photosensitive structure territory of the basic leucine zipper (bZIP) that this albumen is held by a N and a C end forms.

2. gene according to claim 1, aminoacid sequence and the aminoacid sequence without the aureochromel coded by said gene in algae of this coded by said gene have the homology of 59%, without the GenBank number of the logging in gi|158853253|dbj|BAF91488.1 of this gene in algae.

3. gene according to claim 1, this gene can be used for being built into the Yeast expression carrier pYES2-NgAUREO1 being adapted at expressing in yeast saccharomyces cerevisiae NgAUREO1 gene.

4. Yeast expression carrier pYES2-NgAUREO1 according to claim 3, the feature of this Yeast expression carrier is: the promotor of driving N gAUREO1 gene is galactose promoter (GAL1), terminator is CYC1, and selection markers is Ampicillin resistant gene.

5. Yeast expression carrier pYES2-NgAUREO1 according to claim 3, this carrier imports yeast cell by electroporated method, grows the transgenic yeast containing goal gene NgAUREO1.

6. NgAUREO1 gene according to claim 1 is regulating the application in fatty acid metabolism.

7. the application of NgAUREO1 gene according to claim 1 in light genetics.