CN104419703B - A kind of method of high flux quick detection common pathogen - Google Patents

Abstract

The invention provides a kind of method of high flux quick detection common pathogen, methods described includes：Using the universal primer for the significant DNA sequence dna of various pathogens to entering performing PCR amplification to sample, so as to obtain the significant DNA sequence dna of the pathogenic bacteria；So that the significant DNA sequence dna of the pathogenic bacteria is contacted with being directed to the specific capture probe of the significant DNA sequence dna of the pathogenic bacteria respectively, the hybrid product with different detectables is obtained；The signal of detectable is detected to determine the presence of pathogenic bacteria or quantity in sample.Present invention also offers the kit for detecting pathogenic bacteria.The method and kit of the present invention can it is accurately quick, detect pathogenic bacteria with high throughput, have the advantages that easy to operate, high specificity, sensitivity are high, its application prospect is extensive.

Description

A kind of method of high flux quick detection common pathogen

Technical field

The present invention relates to clinical detection, food inspection, public health and bacteriology field.Specifically, the present invention relates to A kind of high flux, the new method of quick detection pathogenic bacteria (preferably clinical common pathogenic bacteria).

Background technology

Bacterial infection disease (such as urinary system infection contamination, such as urinary tract infections) seriously threatens human health and the incidence of disease day Benefit is improved.Common pathogenic bacteria can cause a variety of diseases, for example：By diarrhoea, sepsis caused by Escherichia coli (E.coli) Disease；Suppurative infection, food poisoning, pneumonia as caused by staphylococcus aureus (Staphyloccocus aureus)；By pneumonia The upper respiratory tract, enteric infection caused by klebsiella (K.peneumoniae)；By being urinated caused by enterococcus faecalis (E.faecalis) Road feel dye, endocarditis, cholecystitis, meningitis and wound infection etc.；By enterobacter cloacae (Enterobacter cloacae) Caused hospital-acquired infection, urethral infection, respiratory tract infection and septicemia etc.；By pseudomonas aeruginosa (P.Aeruginosa) hospital-acquired infection, postoperative wound infection, otitis media suppurative etc. caused by；By proteus vulgaris (P.vulgaris) urinary system infection contamination, infected wound, respiratory tract infection, food poisoning and septicemia etc. caused by；By clayey Pulmonary infection caused by husky thunder bacterium (Serratia marcescens), meningitis, endocarditis, urinary tract infections, burn after sepsis Disease etc..

Directed toward bacteria infectious diseases largely uses broad-spectrum antibiotic, although can suppress most of pathogenic bacteria, but can lead Antibody-resistant bacterium and dissociant is caused to continuously emerge, long-term use can also trigger a variety of side effects, increase patient burden and clinic are controlled The complexity for the treatment of.Also, some diseases may jointly be caused by various pathogens, the cause of disease is complicated.Therefore, specific pathogenic bacteria are detected And targetedly suppress measured pathogenic bacteria, be conducive to rational therapy bacterial infection disease.

However, traditional pathogenic bacteria detection method based on culture is present, time-consuming, detection sensitivity is by condition of culture The shortcomings of limitation, the need for can not increasingly meeting clinic, thus exploitation is quick, sensitive, detection pathogen exactly method The target that always people pursue.The biochip technology developed in recent years has high flux, integrated, miniaturization and automated The features such as, it is widely used in the field such as detection gene loci difference and analysis gene expression dose, and caused a disease in clinic Bacterium and the context of detection of drug resistance, then can provide scientific basis for the reasonable employment of clinical antibiotics.

At present, the upper Bacteria Identification main method of clinical and Food Inspection quarantine has：Traditional bacteria distribution culture and identification Method, PCR, Southern Blot hybridization (i.e. southern blotting technique method), ELISA equimoleculars biology and immunological method.But, pass Detection method of uniting is cumbersome, time and effort consuming, generally requires 3-5 days, although ELISA method sensitivity is high, vulnerable to pollution goes out Existing false positive；Using multiple PCR technique, although can reach quick, the accurate and convenient diagnostic purpose to single bacterium, but , it is necessary to be tested using a variety of different primers when pathogen is unknown, the diversity of this complexity and PCR programs to pathogen For be dissatisfactory.

With reaching its maturity for biochip technology, efficient, quick, accurate, sensitive biochip technology is applied to Increasing field, wherein just including clinical bacteria quick diagnosis field.Liquid-phase chip technology is develop recently new Generation molecular diagnostic techniques platform, the platform both can guarantee that information quality, and can provide relatively high-throughout detection, its high pass Amount, high precision and it is time-consuming short the characteristics of provide thinking for the detection of clinical common bacteria, can effectively prevent antibiotic medicine Abuse.

Current state-of-the-art technology is Tem-PCR (the target enriched of scientist doctor Han Jian invention Multiplex PCR, target sequence enrichment multiplex PCR) technology and liquid-phase chip detection technique R. concomitans, the technology can be one In secondary response a variety of target sequences are carried out with extremely sensitive and special amplification and detection, its cardinal principle is, for be amplified Each target sequence, designs the specific primer of two pairs of nidos：F0, R0；Fi, Ri.Fi and Ri primers therein are with an energy The sequence label recognized by general super primer (Super Primer).The concentration pole of the target sequence specific primer of nido It is low, for being enriched with target sequence in the circulation of PCR first few.The concentration of only super primer is sufficient for exponential amplification, And only reversely super primer has carried out the mark of biotin.Finally by liquid-phase chip detection platform output signal, reach Testing goal.The technology have compared with regular-PCR technology compatible good, high specificity, efficiency superelevation, can sxemiquantitative etc. it is excellent Point, but the technology exist to required DNA profiling require height, PCR reaction time length, sensitiveness is not strong enough the shortcomings of.

Bacterium rRNA is divided into 3 kinds, respectively 5S, 16S and 23S rRNA by sedimentation coefficient.16S rDNA are bacterial chromosomes DNA sequence dna corresponding upper coding 16S rRNA, is present in all bacterial chromosomal genes, and its internal structure is comprising conservative Area and variable region.16S rDNA are the genes for encoding prokaryotes small subunit ribosome rRNA (16S rRNA), and its length is about 1500pb, is in systematic bacteriology research the most frequently used, most useful " molecular clock ".

In rRNA (rRNA) characteristic sequence, 16S rRNA are thought and its similar rRNA gene orders through research The most suitable as biosystem development index, its Main Basis is：They are common to cell；Its function is homologous and the most ancient Always；Not only containing conserved sequence but also containing variable sequence；Molecular size is adapted to operation；Its sequence variation is adapted with evolutionary distance. The life concern tree drawn according to 16S rRNA sequences, karr Butterworth (Carl Woese) is by tellurian all cell biologicals Being divided into 3 domains (domain), i.e. Archimycetes (Archaea, also referred to as Archaebacteria), bacterium, (Bacteria is also referred to as ) and eucaryote (Eukarya) Eubacteria.16S rRNA sequence analyses as microorganism classification system Main Basiss Extensive approval is obtained, increasingly perfect with microorganism ribosomes database, the technology turns into the one of division bacteria and identification Individual powerful.

Gene on the 16S rDNA more other taxonomic identifications of database information and analysis software is far richer, such as RDP(http://rdp.cme.msu.edu/html/)、ARB(http://www.ard-home.de/)、ORS(http:// soul.mikro.biologie.tu-muenchen.de/ORS/)、OPD(http://www.com.msu.eduOPD/) and PRIMROSE, CLUSTAL-X, PRIMER PREMIER, DNA START etc., each analysis software is each because of the algorithm of use difference There is the chief.

However, not yet providing the method for detecting various pathogens in sample simultaneously in this area.It is still urgent in this area Needing to develop can overcome the shortcomings of in current pathogenic bacteria detection, and can high flux, the method for quick detection various pathogens.

The content of the invention

It is a primary object of the present invention to provide a kind of method of high flux, quick detection common pathogen, this method tool Have the advantages that high specificity, sensitiveness are high, detection time is short, cross reaction is few.It is another object of the present invention to provide with In the kit of the inventive method, and the present invention the application in the detection of clinical common bacteria of method and kit.

There is provided a kind of method for obtaining the significant DNA sequence dna of pathogenic bacteria in sample in the first aspect of the present invention, The pathogenic bacteria are the one or more being selected from the group in bacterium：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA)；Methods described includes：

(i) obtain and be directed to SEQ ID NO：The CCTTACC of sequence ACGCGAAGAA shown in 10 general sense primer and it is directed to SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGAG shown in 11 or SEQ ID NO：Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA general reverse primer；

(ii) performing PCR amplification is entered to the sample using the general sense primer and general reverse primer, so as to obtain The significant DNA of the pathogenic bacteria, wherein, the significant DNA sequence dna is located in the 16S rDNA of the pathogenic bacteria, and comprising The respective exclusive specific sequence of one or more pathogenic bacteria.

In some preferences, that obtained by above-described PCR amplification method is SEQ ID NO respectively:21-28 institutes The significant DNA sequence dna of each bacterium shown.

In some preferences, the sequence of the general reverse primer is directed to SEQ ID NO:Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA。

In some preferences, the sequence such as SEQ ID NO of the general sense primer:1 or SEQ ID NO:Shown in 3； The sequence of the general reverse primer such as SEQ ID NO:2、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6 or SEQ ID NO:Shown in 7.

In other preferences, the pathogenic bacteria are at least two in upper group of bacterium.

In some embodiments, the general sense primer is and SEQ ID NO：15~17 companies of sequence shown in 10 The completely the same sequence of continuous nucleotide sequence；The general reverse primer be and SEQ ID NO：11 or or SEQ ID NO：12 The sequence of 15~23 continuous nucleotide sequence complete complementaries.

In some preferences, the general reverse primer is and SEQ ID NO:Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA or 15~23 continuous nucleotide sequence complete complementaries sequence.

In other embodiments, the general sense primer is and SEQ ID NO：15~17 of sequence shown in 10 The sequence of continuous nucleotide sequence complete complementary；The general reverse primer be and SEQ ID NO：11 or SEQ ID NO:12 The completely the same sequence of 15~23 continuous nucleotide sequences.

In some preferences, the general reverse primer is and SEQ ID NO:Sequence shown in 12 The completely the same sequence of TGTTGGGTTAAGTCCCGCAACGA 15~23 continuous nucleotide sequences.

In some preferences, the significant DNA sequence dna difference of the pathogenic bacteria is as follows：a)SEQ ID NO:Shown in 21 The significant DNA sequence dna of Escherichia coli；b)SEQ ID NO:The significant DNA sequence dna of Klebsiella Pneumoniae shown in 22；c)SEQ ID NO:The significant DNA sequence dna of enterococcus faecalis shown in 23；d)SEQ ID NO:Enterobacter cloacae shown in 24 it is significant DNA sequence dna；e)SEQ ID NO:The significant DNA sequence dna of pseudomonas aeruginosa shown in 25；f)SEQ ID NO:Shown in 26 The significant DNA sequence dna of proteus vulgaris；g)SEQ ID NO:The significant DNA sequence dna of Serratia marcescans shown in 27；h) SEQ ID NO:The significant DNA sequence dna of staphylococcus aureus shown in 28.

There is provided a kind of method for detecting pathogenic bacteria in sample in the second aspect of the present invention, the pathogenic bacteria are choosing From the one or more in the following group：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae, i.e. KPN), excrement intestines Coccus (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e. PV), Serratia marcescans (Serratia Marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus aureus, i.e. SA)；Methods described includes：

(A) the significant DNA sequence dna of pathogenic bacteria described in sample is obtained using method of the present invention；

(B) the corresponding specific capture probe of significant DNA sequence dna respectively for the pathogenic bacteria is provided；

(C) under hybridization conditions, the significant DNA sequence dna of the pathogenic bacteria is made to be contacted with the specific capture probe, And before the contact, when or afterwards with specific capture probe or described described in different detectable label substance markers The significant DNA sequence dna of pathogenic bacteria and the compound of the specific capture probe formation, obtain and carry different detectable labels The hybrid product of thing；

(D) detection is connected to the signal of the detectable on the hybrid product, various to be measured in sample to determine The presence of pathogenic bacteria or quantity.

In other preferences, methods described is used to detect at least two in upper group of bacterium in sample simultaneously.

In some embodiments, methods described be used for clinical sample detection, Food Inspection, food processing process detect or Cosmetics are detected, are preferred for clinical sample detection.

In further embodiments, the detectable is selected from：Coding microball or other carriers (such as fluorescence labeling Thing, luminescent protein etc.).

In further embodiments, methods described is additionally included in after step (A), separates and/or purify described cause The significant DNA sequence dna of germ, and/or the significant DNA sequence dna of the pathogenic bacteria is connected with detectable. In some embodiments, the detectable is biotin, antibiotin, antibody, mark cell or luminescent protein.

In some embodiments, the sample source in：Biological tissue, body fluid, blood, urine or food.

In further embodiments, the sample is DNA sample or bacterium solution.

In further embodiments, can be comprising the one or more in pathogenic bacteria in the bacterium group in the sample.

In other embodiments, it is characterised in that the specific capture probe is selected from：

A) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of Escherichia coli shown in 21；B) it is directed to SEQ ID NO:The specific capture probe of the significant DNA sequence dna of Klebsiella Pneumoniae shown in 22；C) SEQ ID NO are directed to: The specific capture probe of the significant DNA sequence dna of enterococcus faecalis shown in 23；D) SEQ ID NO are directed to:Cloaca intestines shown in 24 The specific capture probe of the significant DNA sequence dna of bacillus；E) SEQ ID NO are directed to:Pseudomonas aeruginosa shown in 25 is significant The specific capture probe of DNA sequence dna；F) SEQ ID NO are directed to:The spy of the significant DNA sequence dna of proteus vulgaris shown in 26 Different in nature capture probe；G) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of Serratia marcescans shown in 27； And h) it is directed to SEQ ID NO:The specific capture probe of staphylococcus aureus shown in 28.

In other preferences, the G/C of the specific capture probe is 45~60%, preferably 50~55%.

In further embodiments, the length of the specific capture probe is 20-25bp, more preferably 22bp.

In further embodiments, the Tm values of the specific capture probe are 40-60 DEG C, preferably 52 DEG C.

In further embodiments, the 5' ends of the specific capture probe will be modified or close, in order to micro- with coding Ball is coupled.

In further embodiments, the specific capture probe is selected from the group：

a)SEQ ID NO:The specific capture probe of Escherichia coli shown in 13；

b)SEQ ID NO:The specific capture probe of Klebsiella Pneumoniae shown in 14；

c)SEQ ID NO:The specific capture probe of enterococcus faecalis shown in 15；

d)SEQ ID NO:The specific capture probe of enterobacter cloacae shown in 16；

e)SEQ ID NO:The specific capture probe of pseudomonas aeruginosa shown in 17；

f)SEQ ID NO:The specific capture probe of proteus vulgaris shown in 18；

h)SEQ ID NO:The specific capture probe of Serratia marcescans shown in 19；With

i)SEQ ID NO:The specific capture probe of staphylococcus aureus shown in 20.

In other embodiments, the detectable in step (C) is coding microball, the coding microball Encoded using the label that can produce different signals.

In certain embodiments, the label is selected from：The combination of the label of different colours or its different proportion.Another In some embodiments, the label is selected from：The fluorescent marker of different colours, or different proportion two or more The combination of fluorescent marker.

In certain embodiments, the coding microball is coupled with capture probe.In certain embodiments, the coupling passes through EDC methods are carried out.In further embodiments, the coupling is carried out by NHS coupling agents.In further embodiments, institute It is polystyrene microsphere to state microballoon, and the difference of the molecule residues carried according to its surface, can combine different probe molecules.

In other embodiments, the detection in step (D) using the one or more systems being selected from the group or Instrument：Liquid-phase chip detection system, flow cytometer or solid phase chip.

There is provided a kind of examination for being used to detect pathogenic bacteria and/or treat pathogenic infection in the third aspect of the present invention Agent box, the pathogenic bacteria are the one or more in being selected from the group：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA)；The kit is included：

(i') SEQ ID NO are directed to：The CCTTACC of sequence ACGCGAAGAA shown in 10 general sense primer and for SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGAG shown in 11 or or SEQ ID NO：Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA general reverse primer, wherein using the general sense primer and general reverse primer Enter performing PCR amplification to the sample, the significant DNA of the pathogenic bacteria can be obtained, wherein, the significant DNA sequence dna is located at In the 16SrDNA of the pathogenic bacteria, and include the respective exclusive specific sequence of one or more pathogenic bacteria；

(ii') corresponding specific capture probe, the various detectable labels of the significant DNA sequence dna of the pathogenic bacteria are directed to Thing or each species specificity capture probe and the attachment of detectable；

(iii') one or more containers and/or packing material；

(iv') it is optional, PCR reagent for amplification；

(v') it is optional, the reagent for connecting the specific capture probe and detectable；

(vi') it is optional, detect the reagent and/or instrument of signal；

(vii') it is optional, operation instructions；

(viii') it is optional, pathogenic bacteria therapeutic agent.

In some preferences, the kit is used to detect in sample at least two bacterium for being selected from upper group simultaneously.

In the fourth aspect of the present invention detection pathogenic bacteria and/or treatment pathogenic bacteria sense are being prepared there is provided following substances Purposes in the kit of dye：

(i) SEQ ID NO are directed to：The CCTTACC of sequence ACGCGAAGAA shown in 10 general sense primer and for SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGAG shown in 11 or or SEQ ID NO：Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA general reverse primer, wherein using the general sense primer and general reverse primer Enter performing PCR amplification to the sample, the significant DNA of the pathogenic bacteria can be obtained, wherein, the significant DNA sequence dna is located at In the 16SrDNA of the pathogenic bacteria, and include the respective exclusive specific sequence of one or more pathogenic bacteria；

(ii) corresponding specific capture probe, the various detectable labels of the significant DNA sequence dna of the pathogenic bacteria are directed to Thing or each species specificity capture probe and the attachment of detectable；

(iii) one or more containers and/or packing material；

(iv) it is optional, PCR reagent for amplification；

(v) it is optional, the reagent for connecting the specific capture probe and detectable；

(vi) it is optional, detect the reagent and/or instrument of signal；

(vii) it is optional, operation instructions；

(viii) it is optional, pathogenic bacteria therapeutic agent.

In certain embodiments, the detectable is microballoon.

In other aspects of the invention, additionally provide the above method of the present invention and kit detection pathogenic bacteria and/or Treat the purposes in pathogenic infection.

The other side of the present invention, due to this disclosure, is apparent to those skilled in the art 's.

Brief description of the drawings

The invention will be further described below in conjunction with the accompanying drawings, and wherein these show to illustrate the reality of the present invention Scheme is applied, rather than in order to limit to the scope of the present invention.

Fig. 1：The design diagram of universal primer and specific capture probe for bacterium A- bacterium F 16S rDNA genes.

Fig. 2：Using universal primer to (SEQ ID NO:1、SEQ ID NO:2) PCR expands the gel electrophoresis of different strains Figure.

Fig. 3：Using universal primer to (SEQ ID NO:3、SEQ ID NO:4) PCR expands the gel electrophoresis of different strains Figure.

Fig. 4：Using universal primer to (SEQ ID NO:3、SEQ ID NO:5) PCR expands the gel electrophoresis of different strains Figure.

Fig. 5：Using universal primer to (SEQ ID NO:3、SEQ ID NO:6) PCR expands the gel electrophoresis of different strains Figure.

Fig. 6：Using universal primer to (SEQ ID NO:3、SEQ ID NO:7) PCR expands the gel electrophoresis of different strains Figure.

Fig. 7：Using universal primer to (SEQ ID NO:8、SEQ ID NO:9) PCR expands the gel electrophoresis of different strains Figure.

Embodiment

The present invention primarily to overcome the shortcomings of current pathogenic bacteria (especially clinical common pathogenic bacteria) detection in there is provided A kind of method of high flux quick detection pathogenic bacteria, is designed using a pair of universal primers and specific capture probe, passes through liquid phase The method that chip realizes signal output, can simultaneously, quick detection various pathogens.This method is efficient, sensitive, high specificity, friendship Fork reaction is few, overcomes the reactions of PCR present in multiplex PCR and fluorescence detecting system design of primers cumbersome and produces cross reaction etc. Shortcoming.

The new pathogenic bacteria Fast Detection Technique by core of 16S rDNA round pcrs of the present inventor's exploitation, need to only be adopted The 16S rRNA characteristic informations of a variety of different bacteriums can just be expanded with a pair of universal primers, acquisition is comprising multiple The PCR primer of the 16S rDNA information of property.This conventional PCR method, can complete amplified reaction within a hour.Institute The PCR primer of acquisition, using the coding microball being coupled with specific primer, with liquid-phase chip detection system (such as Luminex200), it is possible to achieve multiplicity and high-throughout detection target.

The method for obtaining the significant DNA sequence dna of pathogenic bacteria

A kind of method for obtaining the significant DNA sequence dna of pathogenic bacteria in sample is provided in the present invention, the pathogenic bacteria are One or more in being selected from the group：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae, i.e. KPN), excrement Enterococcus (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e. PV), Serratia marcescans (Serratia Marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus aureus, i.e. SA), methods described includes：

(i) obtain and be directed to SEQ ID NO：The general sense primer of sequence ACGCGAAGAACCTTACC shown in 10 and it is directed to SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGAG shown in 11 or SEQ ID NO：Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA general reverse primer；

(ii) performing PCR amplification is entered to the sample using the general sense primer and general reverse primer, so as to obtain The significant DNA of the pathogenic bacteria, wherein, the significant DNA sequence dna is located in the 16S rDNA of the pathogenic bacteria, and comprising The respective exclusive specific sequence of one or more pathogenic bacteria.

As used herein, term " significant DNA sequence dna " refer to be located at various pathogenic bacteria 16S rDNA in and can be by this hair The particular sequence that bright universal primer is obtained to amplification, the two ends of the sequence include the conserved sequence that each bacterium has, and at this Interior sequences have the exclusive specific sequence of various pathogenic bacteria.In certain embodiments of the present invention, the pathogenic bacteria Significant DNA sequence dna difference is as follows：a)SEQ ID NO:The significant DNA sequence dna of Escherichia coli shown in 21；b)SEQ ID NO:The significant DNA sequence dna of Klebsiella Pneumoniae shown in 22；c)SEQ ID NO:The significant DNA sequences of enterococcus faecalis shown in 23 Row；d)SEQ ID NO:The significant DNA sequence dna of enterobacter cloacae shown in 24；e)SEQ ID NO:P. aeruginosa shown in 25 The significant DNA sequence dna of bacterium；f)SEQ ID NO:The significant DNA sequence dna of proteus vulgaris shown in 26；g)SEQ ID NO:27 The significant DNA sequence dna of shown Serratia marcescans；And h) SEQ ID NO:The significant DNA sequences of staphylococcus aureus shown in 28 Row.

As used herein, term " specific sequence " or " variable region " are used interchangeably, and are each meant positioned at various causes to be measured One section of exclusive region of germ 16S rDNA gene internals, various pathogenic bacteria to be measured.It is various to be measured pathogenic by analyzing and comparing The 16S rDNA sequences of bacterium can determine that presence and the particular location of the specific sequence.Generally, the specific sequence two ends have The shared conserved sequence of various pathogenic bacteria.Described specific sequence can be used for the species for distinguishing pathogenic bacteria.

Can using sequence alignment, bibliography (multi-analyte suspension assay quantitatively determining human change of serum C EA, AFP, NSE and TPSA, fine strain of millet favour instrument etc., J Mol Diagn Ther, in July, 2010, Vo1.2, No.4；Wang Jiali etc.；High-Throughput, Sensitive,and Accurate Multiplex PCR-Microsphere Flow Cytometry System for Large-Scale Comprehensive Detection of Respiratory Viruses are (with new technical platform The drug-fast Golden yellow staphylococcus of Luminex quick detections tool methicillin BRL-1241) shift to an earlier date public affairs on May 30th, 2007 Open .10.1128/JCM.02501-06.2007,45 (8):2626.DOI:J.Clin.Microbiol.James R.Prudent Deng), this area such as experimental verification routine techniques determine suitable for each pathogenic bacteria to be measured of the inventive method specific sequence or Significant DNA sequence dna comprising the sequence.Database information and analysis software on 16S rDNA are known in the art , such as RDP (http：//rdp.cme.msu.edu/html/)、ARB(http://www.ard-home.de/)、ORS (http://soul.mikro.biologie.tu-muenchen.de/ORS/)、OPD(http:// Www.com.msu.eduOPD/) and PRIMROSE, CLUSTAL-X, PRIMER PREMIER, DNA START etc., respectively analyze soft Part is had his own strong points because the algorithm of use is different, and these databases and software are used equally in the present invention.

As used herein, term " conserved sequence " or " consensus sequence " are used interchangeably, and each mean the 16S of various pathogenic bacteria Concensus sequence in the significant DNA sequence dna of rRNA genes (16S rDNA).For " conserved sequence " design it is of the invention Universal primer can be used for the significant DNA sequence dna for amplifying various pathogenic bacteria to be measured.In order to realize the purpose of universal amplification, generally The conserved sequence is located at the two ends of variable region.

As used herein, term " universal primer to " refer to the conservative region being directed in the significant DNA sequence dna of pathogenic bacteria, can For a pair of universal primers of the significant DNA sequence dna of pathogenic bacteria for amplifying the specific sequence for including various pathogenic bacteria.It is general Sense primer (or " positive universal primer ") is generally directed to the upstream of significant DNA sequence dna；General sense primer (or it is " anti- To universal primer ") generally directed to the downstream of significant DNA sequence dna.

The design of universal primer pair can be carried out according to design of primers conventional in the art rule, set using known primer Count software and/or provide special service by the company of offer design of primers.The general sense primer of the present invention and general downstream Primer is directed to SEQ ID NO respectively：Sequence ACGCGAAGAACCTTACC shown in 10 and for SEQ ID NO：Sequence shown in 11 TGTTGGGTTAAGTCCCGCAACGAG or SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGA shown in 12.For example exist In one embodiment of the present of invention, SEQ ID NO can be used:1 or 3 general sense primer and SEQ ID NO:2nd, 4,5,6 or 7 General reverse primer combine to form universal primer pair.

In the method for the invention, can be using PCR method as known in the art and normal condition, using the logical of the present invention With primer pair, performing PCR amplification is entered to sample.Also performing PCR amplification can be entered to the strain of known type, and amplified production is surveyed Sequence, and sequencing information is designed for follow-up specific capture probe.

Pathogenic bacteria detection method

A kind of method for detecting pathogenic bacteria is provided in the present invention, methods described includes：

(A) the significant DNA sequence dna of pathogenic bacteria described in sample is obtained using method as described above；

(B) phase of significant DNA sequence dna respectively for the pathogenic bacteria (one or more, preferably at least two kinds) is provided Should specific capture probe；

(C) under hybridization conditions, the significant DNA sequence dna of the pathogenic bacteria is made to be contacted with the specific capture probe, And before the contact, when or afterwards with specific capture probe or described described in different detectable label substance markers The significant DNA sequence dna of pathogenic bacteria and the compound of the specific capture probe formation, obtain and carry different detectable labels The hybrid product of thing；

(D) detection is connected to the signal of the detectable on the hybrid product, various to be measured in sample to determine The presence of pathogenic bacteria or quantity.

As used herein, term " specific capture probe " or " capture probe " are used interchangeably, and are each meant for possible Specific sequence design of certain pathogenic bacteria existed in the significant DNA sequence dnas of 16S rDNA, so as to specificity capture The probe of the 16S rDNA amplified productions of this kind of pathogenic bacteria.As needed, capture probe of the invention can with or without mark Remember thing (such as radioactivity, biotin, fluorescent marker).Probe can be designed according to probe design rule conventional in the art, And artificial synthesized probe.

In certain embodiments of the present invention, SEQ ID NO：13~20 sequence capture probe distinguishes specifically pin Pair and can capture Escherichia coli, Klebsiella Pneumoniae, enterococcus faecalis, enterobacter cloacae, pseudomonas aeruginosa, common variation respectively The significant DNA sequence dna of bacillus, Serratia marcescans and staphylococcus aureus, in being more specifically significant DNA sequence dna Specific sequence.

It can be connected with various detectables with capture probe, to cause band in the sequence captured by specific capture probe There is specific mark, so that specific detectable label be mapped with the sequence of specified germ, be easy to distinguish different bacteriums.Institute Detectable is stated to include but is not limited to：Coding microball, carrier (such as fluorescent marker, luminescent protein), optimized encoding Microballoon.The method of linker and capture probe is well known in the art, and those of ordinary skill in the art can be according to institute The label of choosing is modified or transformed to capture probe or label, can be connected with each other with to obtain both and (see, for example, perhaps Gorgeous army, Xiamen University's master thesis in 2008：In liquid-phase chip carboxyl functionality polystyrene microsphere preparation, characterize and The document such as its application in biological detection and its cited bibliography).

As used herein, term " coding microball " refers to different detectable feature (such as sizes and/or face distinguished Color), can with capture probe be coupled and can be detected equipment differentiation various microballoons.The material of microballoon can be：Polystyrene, such as MultiAnalyte microballoons or SeroMap microballoons etc..The diameter of microballoon can be 20nm-200 μm, preferably 5~10 μm, more preferably 5.6μm.Microballoon can dye different colors (such as iridescent) with the dyestuff (preferably fluorescent dye) of different ratio, can so as to obtain Up to several, ten several, tens of kinds, even over one hundred kind different coding microballs.Coding microball, example can be obtained by commercially available approach Such as it is purchased from triumphant outstanding biological, BIO-RAD or as needed designed, designeds and prepares coding microball and (for example refers to Chen Wei, liquid phase core The principle of chip technology is in progress with application, Chengdu Medical College's Pathological Staff Room, Chengdu hospital journal, 2008 (3):225-231, this article Offer and be hereby incorporated by referring to its full text).

The capture probe of the present invention can be by modification or transformation with the joint or group that are suitable to be coupled with coding microball, example AMB can be such as connected at the 5' ends of capture probe to be further connected with coding microball.The idol of capture probe and coding microball Connection, method as known in the art can be used to carry out, and (such as referring to Han Wei rather, liquid-phase chip technology is in detection of nucleic acids Application study is in progress, modern preventive medicine, 2008 (10):1911-1915, the document is hereby incorporated by referring to its full text). For example under conditions of the joint or group being adapted on capture probe are connected or reacted with the corresponding construction on coding microball, mixing With hatching capture probe and coding microball.

Under proper condition, make the PCR primer and different capture probe-codings that are obtained using universal primer to amplification micro- Ball conjugate hybridizes, to cause PCR primer to carry the detectable signal from coding microball.Hybridization conditions can refer to manufacturer's offer The operational procedure standard practice instructions of such as luminex coupling reagent kits (carry out) or this area in normal condition carry out.

The signal for the coding microball being connected in the PCR primer can be detected using method as known in the art, to survey Determine presence or the quantity of pathogenic bacteria.Such as can use fluorescent microsphere detecting system, flow cytometer or solid phase chip.Work as detection During to the specific coding microballoon signal being coupled with the capture probe of specific pathogenic bacteria, show to carry such a spy in detected sample Fixed pathogenic bacteria.If required, can be by the quantity of pathogenic bacteria in the strong and weak determination sample of coding microball signal.

The application of kit and reagent

A kind of kit for being used to detect pathogenic bacteria is additionally provided in the present invention, it is included：

(i') SEQ ID NO are directed to：The CCTTACC of sequence ACGCGAAGAA shown in 10 general sense primer and for SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGAG shown in 11 or SEQID NO：Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA general reverse primer, wherein using the general sense primer and general reverse primer Enter performing PCR amplification to the sample, the significant DNA of the pathogenic bacteria can be obtained, wherein, the significant DNA sequence dna is located at In the 16S rDNA of the pathogenic bacteria, and include the respective exclusive specific sequence of one or more pathogenic bacteria；

(ii') corresponding specific capture probe, the various detectable labels of the significant DNA sequence dna of the pathogenic bacteria are directed to Thing or each species specificity capture probe and the attachment of detectable；

(iii') one or more containers and/or packing material；

(iv') it is optional, PCR reagent for amplification；

(v') it is optional, the reagent for connecting the specific capture probe and detectable；

(vi') it is optional, detect the reagent and/or instrument of signal；

(vii') it is optional, operation instructions；

(viii') it is optional, pathogenic bacteria therapeutic agent.

Method or kit the detection pathogenic bacteria and/or treatment pathogenic bacteria using the present invention are further provided in the present invention Purposes in infection.

Advantages of the present invention

, can be in a short time (in 4 hours, such as 2-3 hours) to various clinical common pathogen using the technology of the present invention And its mixture carries out accurate, quick detection；With traditional detection method (Bacteria Culture, biochemical identification, serotype etc.) with And (such as Siemens walkaway96 microbial identification systems, the system principle or tradition now detect with Other Instruments in hospital The principle of detection method) to compare, the characteristic and novelty of new technology are mainly reflected in：Directly it can be made with bacterium solution or measuring samples Quick multiplexed PCR amplification is carried out for pcr template, high-flux parallel detection can be carried out to a variety of common pathogens simultaneously, it is once real Whole results can be drawn by testing, easy to operate quick, and high specificity, sensitivity are high.

Sequence table explanation

Corresponding relation in sequence table of the present invention between sequence number and particular sequence is as shown in table 1 below：

The sequence table explanation of table 1.

Embodiment

With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention Rather than limitation the scope of the present invention.Those skilled in the art can make appropriate modification, variation, these modifications to the present invention It is within the scope of the present invention with variation.

The experimental method of unreceipted actual conditions in the following example, can use the conventional method in this area, for example, join Examine《Molecular Cloning:A Laboratory guide》(third edition, New York, CSH Press, New York：Cold Spring Harbor Laboratory Press, 1989) or according to the condition proposed by supplier.DNA sequence measurement is that this area is normal The method of rule, also can provide test by commercial company.

Unless otherwise indicated, otherwise percentage and number are calculated by weight.Unless otherwise defined, it is all used in text Specialty is identical with meaning known to one skilled in the art with scientific words.In addition, any similar or equal to described content Deng method and material all can be applied in the inventive method.Preferable implementation described in text only presents a demonstration it with material With.

Materials and methods

1. major experimental instrument

The major experimental instrument of this experiment is PCR instrument (BIO-RAD S1000Thermal cycler), fluorescent microsphere detection System (luminex liquichip200), QIAxcel Advanced systems (Kai Jie company QIAGEN).

2. experimental strain

Experimental strain used in the embodiment of table 2. is described

3. major experimental reagent

Escherichia coli, enterobacter cloacae, Klebsiella Pneumoniae, enterococcus faecalis, proteus vulgaris, Serratia marcescans, copper Green pseudomonad and staphylococcus aureus use 37 DEG C of overnight incubations of LB culture mediums.

LB culture mediums：Yeast extract 0.5%, tryptone 1%, NaCl1%；

HotStar Taq Plus standards mix reagent box (HotStar Taq Plus Master mix kit (1000), Cat.No.203645, Germany's just root is biological (QIAGEN)), EDC (Sigma (Sigma)), coupling microballoon (COOH Beads#171-5060** Bole company (BIO-RAD)), sheath fluid (cat.NO922902, Germany's just root is biological), S-PE (cat.NO922721 Germany just root is biological).

Primer and probe are synthesized by Sangon Biotech (Shanghai) Co., Ltd..

4. universal primer and capture probe design

The design and biotin labeling of universal primer, according in the 16S rDNA of pathogenic bacteria significant DNA sequence dna it is conservative Region, designs a pair of universal primers, the position of the primer and sequence are as follows：

General sense primer 16S-for is directed to SEQ ID NO：Sequences Design shown in 10；General reverse primer 16S-rev pins To SEQ ID NO：Sequence shown in 11 or SEQ ID NO:Sequences Design shown in 12：

The universal primer of the present invention of table 3.

SEQ ID NO：	Universal primer	Sequence	5 is terminal modified
				1	General sense primer 1	5’-ACGCGAAGAACCTTACC-3’
2	General reverse primer 2	5’-TGCGGGACTTAACCCAAC-3’	BIO
				3	General sense primer 3	5’-GCGAAGAACCTTACC-3’
4	General reverse primer 4	5’-TGCGGGACTTAACCC-3’	BIO
				5	General reverse primer 5	5’-TCGTTGCGGGACTTAACCCAACA-3’	BIO
6	General reverse primer 6	5’-GTTGCGGGACTTAACCCAACA-3’	BIO
				7	General reverse primer 7	5’-CTCGTTGCGGGACTTAACCCAA-3’	BIO

The pair of primers for separately designing amplifiable 16S rDNA most long segments (refers to Zhou Huang, 16S rRNA sequence analysis exist Application in medical microbial identification, Beijing Institute of Microbiology and Epidemiology, biotechnology communications, Vol.10, NO4,1999)：

Sense primer 16S-for at the 16S rDNA of each bacterium 8-28bp for designing；Anti-sense primer 16S-rev is for each Designed at the 16S rDNA of bacterium 1460-1510：

The total length 16S rDNA universal primers of table 4.

SEQ ID NO：	Universal primer	Sequence	5 is terminal modified
				8	The general sense primer 8 of total length 16	5’-AGAGTTTGATCCTGGCTCAG-3’
9	The general reverse primer 9 of total length 16	5’-ACGGTTACCTTGTTACGACTT-3’	BIO

Each bacterium 16S rDNA Genebank are as follows：Enterobacter cloacae：AJ251469.1；Klebsiella Pneumoniae： Y17657.1；Enterococcus faecalis：KC699230.1；Proteus vulgaris：DQ205432.1；Serratia marcescans：FM163485.2；Copper Green pseudomonad：FJ194518.1；Staphylococcus aureus：DQ269498.1.

SEQ ID NO:1-7 expanding fragment lengths are 130-140bp, SEQ ID NO:8-9 expanding fragment lengths are 1500bp or so, designed anti-sense primer is in 5 ' ends biotin (Biotin) mark, for luminex instruments Luminex- Streaming fluorescent technique (also known as liquid chip, liquid-phase chip)) signal detection.

Sequence after PCR is obtained by DNA sequencing, then in conjunction with database Taxonomy in NCBI, each bacterial strain is obtained 16S rDNA, compare software DNAMAN using nucleic acid and are compared, obtain significant sequence of each bacterial strain in universal primer interval Arrange, the targeted sequence of the specific probe as designed (as designs the targeted sequence of capture probe).Caused a disease to every kind of Bacterium respectively designs a capture probe, and Tm values are 52 DEG C or so, and in 5 ' end phosphorylations closings, the coupling for probe and microballoon. Design concept is as shown in Figure 1.The particular sequence of capture probe is as shown in table 5：

Probe sequence of the table 5. designed by each bacterial strain

AMB (being completed to modify by synthetic primer Probes) is chemical substance aminolink (Aminolinker) C12/ 5' Amino End Groups are modified, for linking probe and magnetic bead.

5. universal primer PCR is reacted and condition

PCR reaction system includes (50 μ l) in experiment：The μ L of Hotstar enzymes 25, the μ L of water 22, universal primer (10 μm of ol/L) (bacteria concentration in template is more than 1 × 10 by each 4 μ L, the μ L of template 10⁵CFU/ml)。

PCR programs are：95 DEG C, 5 minutes；94 DEG C, 40 seconds；55 DEG C, 40 seconds；72 DEG C, 1 minute；34 circulations；72 DEG C, 2 points Clock；16 DEG C, 5 minutes；Terminate.

Resulting PCR primer is sequenced by Invitrogen (Shanghai) Trading Co., Ltd..

6. the coupling of probe, microballoon

(concentration of microballoon is 1.25 × 10 to vortex microballoon⁷Individual/mL) 5min, 100 μ L microballoons are gone in coupling pipe, kept away Light, microballoon is washed with 0.1M MES.Microballoon 12000rpm, 3min are centrifuged, supernatant is abandoned, then suspended with 50 μ L0.1M MES.It is micro- by 5 The probe reagent for rising 100pmol/L is added in each corresponding microballoon (i.e. the microballoon of different coding) suspension.Immediately plus Enter 2.5 μ L10mg/mL EDC into each mixing tube comprising probe and microballoon, be vortexed 10 seconds, hatch mixed liquor at room temperature 30 minutes.

Second of EDC addition and hatching (step is ibid).

The EDC solution (10mg/mL) of secondary hatching plus 2.5 μ L0.1M MES dissolvings is into the mixing tube of probe-microballoon, whirlpool Rotation 10 seconds, hatches 30 minutes, is placed in room temperature dark place.

Then, microballoon is washed with 0.02% polysorbas20,1mL0.02% polysorbas20s are added to the coupling pipe for the microballoon being each coupled In, it is vortexed 10 seconds, is centrifuged 3 minutes with 12000rpm, abandon supernatant.Plus 1mL0.1%SDS cleaning, be vortexed 10 seconds, with 12000rpm from The heart 3 minutes.Again suspend, be vortexed 5 seconds with 250 μ L1 × TE.4 DEG C of preservations.

7. fluorescent microsphere system detectio

Step 1：Universal primer PCR amplification (described in the 5th part)

Step 2：The reaction of universal primer PCR amplified production and probe-microballoon conjugate

A. in reaction system related reagent addition：

Microballoon mixed system (microballoon concentration：More than 5 × 10³Individual/ml)：500μL-50×N=M

50 represent extension rate；N represents the volume (μ L) of various probe-microspheres solutions；M represents 1 × TE volume (mol/ L)。

1 × TE (10mM Tris-HCl, pH=8.0,0.1mM EDTA pH=8.0) preparation：

1M Tris-HCl pH=8.0,1mL；0.5M EDTA pH=8.0,0.2mL；

100mL is settled to ultra-pure water.

The reaction system of table 6. is constituted

Composition	Volume μ L/r × n
		Microballoon mixed system	10
Detect buffer solution	35
		PCR primer	5

" r " is writing a Chinese character in simplified form for " reaction (reaction) "；

" n " is writing a Chinese character in simplified form for " quantity (number) "；

" volume μ L/r × n " represents the reagent volume needed for single reaction system.

Detect the formula of buffer solution (1.8L)：606.6mL ultra-pure waters, 1080mL 5M TMAC, 9mL 20% flesh aminoacyl (Sarkosyl), 90mL 1M Tris-HCl (pH=8.0), 14.4mL 0.5M EDTA (pH=8.0).

Crossover process：

Microballoon dilution (microballoon mixed system+detection buffer solution) is vortexed 15 seconds, hybrid pipe or 96 are added to after mixing In orifice plate, per the μ L of hole 45, PCR primer is added in respective aperture, per the μ L of hole 5, after mixing, orifice plate is incubated 10 points in 52 DEG C Clock；After incubation, 10 μ L S-PE are added per hole, 52 DEG C are incubated 5 minutes；After incubation, per hole, 120 microlitres of addition is preheated in advance ddH₂O, terminates crossover process, to be measured.

Using fluorescent microsphere detecting system (luminex liquichip200), detected respectively by red, green two beams laser Microballoon encodes with reporter fluorescence to carry out quantitative and semi-quantitative.

Embodiment 1. is using SEQ ID NO:General sense primer and SEQ ID NO shown in 1:General downstream shown in 2 Primer pair clinical common pathogenic bacteria enters performing PCR amplification

Cultivate the clinical common pathogenic bacteria to be detected (urine being common in, also seen in other samples)：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), cloaca intestines bar Bacterium (Enterobacter cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e. PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus aureus, i.e. SA).

Bacterial concentration is adjusted to be more than 10⁵CFU/ml, directly enters performing PCR amplification.

PCR amplifications are as shown in Figure 2.

Fig. 2 show strain PCR gel electrophoresis figures, is from left to right Escherichia coli (E.coli), kerekou pneumonia primary successively Bacterium (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA), more than 8 kinds of bacterium Mixed Microbes sample, blank and molecular weight marker (Marker100-2000bp).

The result is shown：Designed primer can be with high sensitivity, the corresponding bacterial strain of specific amplification and bacterial strain mixed liquor.

Embodiment 2. is using SEQ ID NO:General sense primer and SEQ ID NO shown in 3:General downstream shown in 4 Primer pair clinical common pathogenic bacteria enters performing PCR amplification

Ibid (embodiment 1), PCR amplifications are as shown in Figure 3 for the amplification method of bacterium solution.

Fig. 3 show strain PCR gel electrophoresis figures, is from left to right Escherichia coli (E.coli), kerekou pneumonia primary successively Bacterium (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA), more than 8 kinds of bacterium Mixed Microbes sample, blank and molecular weight marker (Marker100-2000bp).

The result is shown：Designed primer can also effectively expand acquisition PCR primer, can be used as universal primer.

Embodiment 3. is using SEQ ID NO:General sense primer and SEQ ID NO shown in 3:General downstream shown in 5 Primer pair clinical common pathogenic bacteria enters performing PCR amplification

Ibid (embodiment 1), PCR amplifications are as shown in Figure 4 for the amplification method of bacterium solution.

Fig. 4 show strain PCR gel electrophoresis figures, is from left to right Escherichia coli (E.coli), kerekou pneumonia primary successively Bacterium (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA), more than 8 kinds of bacterium Mixed Microbes sample, blank and molecular weight marker (Marker100-2000bp).

The result is shown：Designed primer can also obtain corresponding PCR primer and Mixed Microbes as universal primer PCR primer.

Embodiment 4. is using SEQ ID NO:General sense primer and SEQ ID NO shown in 3:General downstream shown in 6 Primer pair clinical common pathogenic bacteria enters performing PCR amplification

Ibid (embodiment 1), PCR amplifications are as shown in Figure 5 for the amplification method of bacterium solution.

Fig. 5 show strain PCR gel electrophoresis figures, is from left to right Escherichia coli (E.coli), kerekou pneumonia primary successively Bacterium (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA), more than 8 kinds of bacterium Mixed Microbes sample, blank and molecular weight marker (Marker100-2000bp).

The result is shown：Designed primer can also obtain corresponding PCR primer and Mixed Microbes as universal primer PCR primer.

Embodiment 5. is using SEQ ID NO:General sense primer and SEQ ID NO shown in 3:General downstream shown in 7 Primer pair clinical common pathogenic bacteria enters performing PCR amplification

Ibid (embodiment 1), PCR amplifications are as shown in Figure 6 for the amplification method of bacterium solution.

Fig. 6 show strain PCR gel electrophoresis figures, is from left to right Escherichia coli (E.coli), kerekou pneumonia primary successively Bacterium (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA), more than 8 kinds of bacterium Mixed Microbes sample, blank and molecular weight marker (Marker100-2000bp).

The result is shown：Designed primer can also obtain corresponding PCR primer and Mixed Microbes as universal primer PCR primer.

Embodiment 6. is using SEQ ID NO:Sense primer and SEQ ID NO shown in 8:Anti-sense primer shown in 9 is to facing Bed common pathogen enters performing PCR amplification (amplification length is about in 1500bp)

Ibid (embodiment 1), PCR amplifications are as shown in Figure 7 for the amplification method of bacterium solution.

Fig. 7 show strain PCR gel electrophoresis figures, is from left to right Escherichia coli (E.coli), kerekou pneumonia primary successively Bacterium (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), enterobacter cloacae (Enterobacter Cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e., PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus Aureus, i.e. SA), more than 8 kinds of bacterium Mixed Microbes sample, blank and molecular weight marker (Marker100-2000bp).

The result shows：When designed total length 16S rDNA universal primers expand single bacterium, target product can be obtained, But, must fall short product when entering performing PCR amplification to mixed bacteria liquid.In other words, the primer pair can not be carried out to mixed bacteria liquid Effectively amplification.And the sample to be detected in actual applications be typically mixed bacteria liquid (such as：Urine, body fluid, blood, food etc., Microorganism more than one included in it), therefore total length 16S rDNA universal primers are to cannot function as universal primer utilization In this experiment and most of clinical settings.On the contrary, the specific universal primer pair of the invention employed in embodiment 1-5 can be right Mixed bacteria liquid is effectively expanded.

Embodiment 7. uses Luminex system detectio clinical common pathogenic bacterias

By the PCR primer comprising gained in single bacterial strain or the embodiment of hybrid bacterial strain sample 1 with being coupled the micro- of probe Ball reacts, and is then detected using Luminex systems.The PCR primer of other non-targeted bacterial strains is also added to detection simultaneously System, the specificity (i.e. cross reaction situation) of detection architecture.

Probe will have been joined with microballoon lotus root to be combined with PCR primer, signal output is realized with liquid-phase chip, represented with MFI values, examined Survey result as shown in table 7 below：

Table 7：Using Luminex system detectio clinical common pathogenic bacterias

Data type：Average value, n=14

Positive findings judgment basis：The fluorescence intensity median (MPI) obtained is more than 250, or is the flat of negative findings Average adds 5 times of negative findings standard deviationWhen numerical value is left 250 When right, 2 kinds of result of determination are all used, and when all in critical value, should be judged to the positive.

With the data instance in form on ECL bacterium, standard deviation positive value is calculated.

Negative findings average value=(102+46+46+78+59+14+103+103+85+81+59+26)/12=66.83

Positive findings critical value=66.83+5 × 28.80=210.86, i.e., when obtaining result more than 210.86, it is believed that It is positive findings.

The result that the reagent and method of the present invention are detected to enterobacter cloacae is used for the positive.

Other results can according to said method be analogized.

The test for being first single positive sample is that monoxenic PCR primer is detected to sample, to determine detection Feasibility, sensitivity and the specificity of probe design.It can be drawn by the numbering 1-8 of table 7：Probe design is feasible, and sensitivity is high, And high specificity.

Numbering 9-12 is not include the existing other strains in laboratory in probe design, is not detected using the system and is Bacterium beyond system design, shows present system high specificity, does not occur cross reaction.

By this experiment it is concluded that：The system of the present invention can be used as the strong special of detection clinical common pathogenic bacteria Property effective system.

Embodiment 8. uses Luminex system detectio clinical samples

Detected using 382 middle segment urine sample samples, its liquid-phase chip Luminex200 and Siemens walkaway96 The testing result of microbial identification system is as shown in table 8：

Table 8：Using Luminex system detectio clinical samples

Note：In blood plate testing result, "+" is represented：The flat-plate bacterial colony number of 5 μ L urines is more than 20；

In PCR testing results, "+" is represented：Compared with blank, band concentration is more than blank；

In Siemens System testing result, "+" is represented：With (the reference of hospital's goldstandard《National clinical examination operational procedure》 The third edition, Department of Medical Administration of Ministry of Health of the People's Republic of China) decision-making system instrument display result, bacterium is dense to be more than 1 × 10⁵CFU/mL；

In liquid-phase chip system detection results, "+" is represented：MFI (fluorescence intensity median) is more than 250.

The identification brief introduction of Siemens's walkaway96 microbial identification systems and process are summarized as follows：Siemens's identification systems Based on microorganism in-depth is theoretical, by microbial information coding techniques, the system according to microorganism to various physiological conditions, Biochemical indicator, metabolic response are analyzed, and result is converted into the data that software can be recognized, carry out clustering, and The reference strains database known is compared, and finally unknown bacterium is identified.Experimental identification process：Urine is 37 on blood plate DEG C culture 24 hours, further experiment is judged whether by technician, it was observed that not growing bacterium colony on flat board or grow less bacterium Fall or report that flat board that miscellaneous bacteria is more is abandoned is negative, picking is judged as the microbiological contamination bacterium colony on the flat board of microbiological contamination, access Siemens reagent In box, in Siemens System culture 24-72 hours, instrument result of determination.That is, which kind of strain determined into Siemens System Before, flat board primary dcreening operation has first been carried out, has artificially eliminated that colony growth on flat board is less or it's too late the flat board containing Mixed Microbes, or inspection The personnel of testing are considered to contaminate the flat board of miscellaneous bacteria.

To being detected from 382 clinical midstream urine samples of infection from hospital, wherein every testing result of 234 samples Display is negative findings, and 61 sample E. coli detections are positive.The liquid-phase chip for having 14 samples in addition is defined as greatly Enterobacteria is positive, but is shown as negative using the Siemens System testing result of goldstandard.This is due to that hospital is carrying out west gate Subsystem has carried out blood plate primary dcreening operation when examining, and the sample for artificially judging and abandoning containing 2 and more than 2 strains (can not be examined Survey Mixed Microbes sample) and the less sample of clump count (i.e. detection sensitivity is limited) (special sample 2), or only selective advantage sample Detection (i.e. detection sensitivity limited) (special sample 1), by contrast, using the inventive method liquid-phase chip system without Primary dcreening operation and detect it is sensitive, liquid-phase chip can show low bacteria concentration or Mixed Microbes positive findings.Also, during the detection of the inventive method Between only need 2-3 hours, and without primary dcreening operation sample, have the advantages that efficient, easy.

Conclusion

Because the sequence analysis of 16S rRNA genes fundamentally have impact on reason of the people to evolutionary relationship between bacterium 16S rRNA sequencings have been carried out in solution, the taxonomic identification of many microorganisms.However, not yet using 16S in this area RDNA, PCR are expanded and by the species of microorganism in instrument quick discriminating unknown sample.

In this experiment using PCR amplifications by 16S rRNA fragment amplifications into 16S rDNA.Then, by comparing a variety of bacterium 16S rDNA sequences, find the high degree of specificity region of each bacterium, the height of these bacterium are found at the two ends in high degree of specificity region Conserved regions design universal primer simultaneously makes its band biotin labeling.

The multipair primer of sequences Design that this experiment is about 1500bp or so to 16S rDNA, Fig. 2-7 shows in 16S rDNA About 900~1200bp at (such as at Serratia marcesens 16S rDNA 975-1108bp) design primer, it is amplifiable about to exist 130-140bp fragments, can obtain efficient amplification, and total length 16S rDNA universal primers 16S-FOR (SEQ ID NO:8) and 16S-REV(SEQ ID NO:9) object bacteria and effective fragment of Mixed Microbes sample can not be expanded simultaneously, it is impossible to met and detected simultaneously The requirement of a variety of bacterium.So-called conserved sequence design primer in this explanation, any selection 16S rDNA, usually can not be in Mixed Microbes Target DNA product is obtained under the situation of multiplex PCR.

Inventor has found by testing and attempting repeatedly：For specific 8 kinds of clinical common pathogenic bacterias：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae, i.e. KPN), enterococcus faecalis (E.faecalis, i.e. EF), cloaca intestines bar Bacterium (Enterobacter cloacae, i.e. ECL), pseudomonas aeruginosa (P.Aeruginosa, i.e. PAE), proteus vulgaris (P.vulgaris, i.e. PV), Serratia marcescans (Serratia marcescens, i.e. SM), staphylococcus aureus (Staphyloccocus aureus, i.e. SA), separately designs upstream and downstream universal primer, each bacterium can be expanded simultaneously significant DNA.The design of this experiment primer solves conventional pathogenic bacteria using the cross reaction caused by the amplification of multiplex PCR, and primer is set Meter is simple, cost reduction.

High degree of specificity area of the design of capture probe mainly for each bacterium in gained sequence after universal primer PCR is expanded Domain.(such as amination) is modified so as to the coupling of the probe and microballoon, each one coding of probe conjugate to 5 ' ends of probe (such as color coding) microballoon so that instrument recognize PCR primer and probe microballoon combine after microballoon signal, so as to realize single Reaction system detects the purpose of a variety of bacterial strains simultaneously.

The reaction system of the present invention detects that sensitive, high specificity, detection speed are fast, and detection process can be completed in 15min, Liquid-phase chip technology changes the situation that conventional general-purpose chip needs probe to be fixed on chip, chip cost is high, and only needs to One sterile reaction system (such as 96 porocyte culture plates), it is possible to once complete the measure of multiple (such as 96) samples, cost Low, efficiency high, is the prefered method of batch samples detection.

The advantages of liquid-phase chip technology can be high, reproducible with its high flux, detection sensitivity in the near future, and The advantages such as detection wide dynamic range are widely used and each research field.

In addition, although universal primer sequence and capture probe in embodiment are set for specific clinical common pathogenic bacteria Count and prepare, those of ordinary skill in the art can be determined in other pathogenic bacteria available for the present invention's according to the design of the present invention Variable region sequences, and design and prepare corresponding universal primer sequence and capture probe, to realize the detection to other pathogenic bacteria.

All documents referred in the present invention are all incorporated as reference in this application, independent just as each document It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited Enclose.

Claims (11)

1. a kind of method for obtaining the significant DNA sequence dna of pathogenic bacteria in sample, the pathogenic bacteria are one be selected from the group in bacterium Plant or a variety of：Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae), enterococcus faecalis (E.faecalis), the moon Enterobacter cloacae (Enterobacter cloacae), pseudomonas aeruginosa (P.Aeruginosa), proteus vulgaris (P.vulgaris), Serratia marcescans (Serratia marcescens), staphylococcus aureus (Staphyloccocus aureus)；Methods described includes：

(i) obtain and be directed to SEQ ID NO：The general sense primer of sequence ACGCGAAGAACCTTACC shown in 10 and for SEQ ID NO：Sequence TGTTGGGTTAAGTCCCGCAACGAG shown in 11 or SEQ ID NO：Sequence shown in 12 TGTTGGGTTAAGTCCCGCAACGA general reverse primer；

(ii) performing PCR amplification is entered to the sample using the general sense primer and general reverse primer, so as to obtain described The significant DNA of pathogenic bacteria, wherein, the significant DNA sequence dna is located in the 16S rDNA of the pathogenic bacteria, and comprising described The respective exclusive specific sequence of one or more pathogenic bacteria,

Wherein, methods described is used for non-diseases diagnosis and/or therapeutic purposes.

2. the method as described in claim 1, it is characterised in that the general sense primer is and SEQ ID NO：Sequence shown in 10 The completely the same sequence of 15~17 continuous nucleotide sequences of row；Single-primed PCR is carried out to the sample, so as to obtain The significant DNA of the pathogenic bacteria, wherein, the significant DNA sequence dna is located in the 16S rDNA of the pathogenic bacteria, and comprising The respective exclusive specific sequence of one or more pathogenic bacteria.

3. the method as described in claim 1, it is characterised in that the general reverse primer is and SEQ ID NO：11 or 12 The completely the same sequence of 15~23 continuous nucleotide sequences, single-primed PCR is carried out to the sample, so as to obtain described The significant DNA of pathogenic bacteria, wherein, the significant DNA sequence dna is located in the 16S rDNA of the pathogenic bacteria, and comprising described The respective exclusive specific sequence of one or more pathogenic bacteria.

4. a kind of method for detecting pathogenic bacteria in sample, the pathogenic bacteria are the one or more being selected from the group in bacterium：Large intestine bar Bacterium (E.coli), Klebsiella Pneumoniae (K.peneumoniae), enterococcus faecalis (E.faecalis), enterobacter cloacae It is (Enterobacter cloacae), pseudomonas aeruginosa (P.Aeruginosa), proteus vulgaris (P.vulgaris), glutinous Matter sand thunder bacterium (Serratia marcescens), staphylococcus aureus (Staphyloccocus aureus)；Methods described Including：

(A) the significant DNA sequence dna of pathogenic bacteria described in sample is obtained using method according to any one of claims 1 to 3；

(B) the corresponding specific capture probe of significant DNA sequence dna respectively for the pathogenic bacteria is provided；

(C) under hybridization conditions, the significant DNA sequence dna of the pathogenic bacteria is made to be contacted with the specific capture probe, and Before the contact, when or with specific capture probe described in different detectable label substance markers or described cause a disease afterwards The significant DNA sequence dna of bacterium and the compound of the specific capture probe formation, are obtained with different detectables Hybrid product；

(D) detection is connected to the signal of the detectable on the hybrid product, various to be measured pathogenic in sample to determine The presence of bacterium or quantity,

Wherein, methods described is used for non-diseases diagnosis and/or therapeutic purposes.

5. method as claimed in claim 4, it is characterised in that methods described is used for clinical sample detection, Food Inspection, food Process is detected or cosmetics detection.

6. method as claimed in claim 4, it is characterised in that methods described is used for clinical sample and detected or food quarantine.

7. method as claimed in claim 4, it is characterised in that the specific capture probe is selected from：

A) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of Escherichia coli shown in 21；

B) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of Klebsiella Pneumoniae shown in 22；

C) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of enterococcus faecalis shown in 23；

D) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of enterobacter cloacae shown in 24；

E) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of pseudomonas aeruginosa shown in 25；

F) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of proteus vulgaris shown in 26；

G) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of Serratia marcescans shown in 27；With

H) SEQ ID NO are directed to:The specific capture probe of the significant DNA sequence dna of staphylococcus aureus shown in 28.

8. method as claimed in claim 4, it is characterised in that the detectable in step (C) is coding microball, The coding microball use can produce the label coding of different detectable signals.

9. method as claimed in claim 4, it is characterised in that the detection in step (D) is using the one kind being selected from the group Or multiple systems or instrument：Liquid-phase chip detection system, flow cytometer or solid phase chip.

10. a kind of kit for being used to detect pathogenic infection, the pathogenic bacteria are the one kind or many two kinds being selected from the group in bacterium： Escherichia coli (E.coli), Klebsiella Pneumoniae (K.peneumoniae), enterococcus faecalis (E.faecalis), enterobacter cloacae It is (Enterobacter cloacae), pseudomonas aeruginosa (P.Aeruginosa), proteus vulgaris (P.vulgaris), glutinous Matter sand thunder bacterium (Serratia marcescens), staphylococcus aureus (Staphyloccocus aureus)；The reagent Box is included：

(i') SEQ ID NO are directed to：The general sense primer of sequence shown in 10 and for SEQ ID NO：11 or SEQ ID NO: The general reverse primer of sequence shown in 12, wherein entering performing PCR to sample using the general sense primer and general reverse primer Amplification, can obtain the significant DNA of the pathogenic bacteria, wherein, the significant DNA sequence dna is located at the 16S of the pathogenic bacteria In rDNA, and include the respective exclusive specific sequence of one or more pathogenic bacteria；

(ii') for the corresponding specific capture probe of significant DNA sequence dna of the pathogenic bacteria, various detectables, Or each species specificity capture probe and the attachment of detectable；

(iii') one or more containers and/or packing material；

(iv') it is optional, PCR reagent for amplification；

(v') it is optional, the reagent for connecting the specific capture probe and detectable；

(vi') it is optional, detect the reagent and/or instrument of signal；

(vii') it is optional, operation instructions.

11. purposes of the following substances in the kit for preparing detection pathogenic infection：

(i) SEQ ID NO are directed to：The general sense primer of sequence shown in 10 and for SEQ ID NO：Sequence shown in 11 or SEQ ID NO：The general reverse primer of sequence shown in 12, wherein being entered using the general sense primer and general reverse primer to sample Performing PCR is expanded, and can obtain the significant DNA of the pathogenic bacteria, wherein, the significant DNA sequence dna is located at the pathogenic bacteria In 16S rDNA, and include the respective exclusive specific sequence of one or more pathogenic bacteria；

(ii) for the corresponding specific capture probe of significant DNA sequence dna of the pathogenic bacteria, various detectables or The attachment of each species specificity capture probe and detectable；

(iii) one or more containers and/or packing material；

(iv) it is optional, PCR reagent for amplification；

(v) it is optional, the reagent for connecting the specific capture probe and detectable；

(vi) it is optional, detect the reagent and/or instrument of signal；

(vii) it is optional, operation instructions.