CN104403951A - Radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment - Google Patents
Radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment Download PDFInfo
- Publication number
- CN104403951A CN104403951A CN201410688785.6A CN201410688785A CN104403951A CN 104403951 A CN104403951 A CN 104403951A CN 201410688785 A CN201410688785 A CN 201410688785A CN 104403951 A CN104403951 A CN 104403951A
- Authority
- CN
- China
- Prior art keywords
- fusarium
- fusariumsp
- cgmcc
- radiation
- acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/77—Fusarium
-
- G—PHYSICS
- G21—NUCLEAR PHYSICS; NUCLEAR ENGINEERING
- G21F—PROTECTION AGAINST X-RADIATION, GAMMA RADIATION, CORPUSCULAR RADIATION OR PARTICLE BOMBARDMENT; TREATING RADIOACTIVELY CONTAMINATED MATERIAL; DECONTAMINATION ARRANGEMENTS THEREFOR
- G21F9/00—Treating radioactively contaminated material; Decontamination arrangements therefor
- G21F9/04—Treating liquids
- G21F9/06—Processing
- G21F9/12—Processing by absorption; by adsorption; by ion-exchange
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- High Energy & Nuclear Physics (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment. Through providing of the self-screening radiation-proof Fusarium sp. F54 CGMCC No. 8359 and application thereof, tests show that the Fusarium sp. F54 CGMCC No. 8359 has tolerance to various metals, and has the maximal tolerance concentrations to Pb <2+>, Zn <2+> and Ni <2+>, which can respectively reach 1000 mg/L, 500 mg/L and 500 mg/L, and the tolerance to Co <2+>, Cr<2+> and Hg<2+> take second place and can reach 200 mg/L. When the radiation-proof Fusarium sp. strain is applied to cesium adsorption, remarkably obvious technical effects are achieved, and accordingly, a favorable application prospect of the radiation-proof Fusarium sp. in cesium adsorption biotreatment is testified.
Description
Technical field
The present invention relates to a kind of microbial strains and be applied to biological adsorption radionuclide technical field, concrete, the present invention relates to the technical field of a kind of radiation hardness Fusarium and application in the absorption of radionuclide caesium thereof.
Background technology
Urbanization, industrialization and population growth cause global energy dilemma, and Sustainable development demand makes the mankind more and more depend on new forms of energy.Nuclear energy is more and more subject to the attention of numerous country with its extremely low Carbon emission and huge development potentiality.While nuclear energy high speed development, also huge pressure is caused to global environment, radiocontamination is made to become one of current great environmental problem, particularly with Chernobyl and the Fukushima, Japan Nuclear power plants nuclear incident that is representative to Environment release a large amount of radioactivity, cause locality and the serious radiocontamination of surrounding enviroment, potential threat huge is for a long time caused to ecotope and human health.
As the important component part of the ecosystem, microbial population is large, distribution is wide, specific surface area is large, breeding is fast, adaptable to environmental change, radioactive radiation is shown to the tolerance of height.Selectivity is strong, the treatment time is short, cost is low to utilize biological action removing, reparation and improvement radiocontamination to have, and does not cause secondary pollution and does not destroy the advantages such as ecotope, having become one of hot research technology of radiocontamination improvement in recent years.
Ce 137 (
137 cs) be one of important fission product, also be one of byproduct of nuclear fission in nuclear bomb, nuclear weapon test and nuclear reactor, its transformation period is longer, there is higher transport property, easily cause radiation hazradial bundle by biologic chain transfer, it can discharge gamma rays, receives much concern in environmental radioactivity pollution amelioration.The transformation period of Ce 137 comparatively reaches 30 years, can retain, accumulate and move in environment or the ecosystem, cause serious environmental pollution and ecological hazard.If through feed or breathe, take in Ce 137, or be subject to being deposited in ground Ce 137 and irradiate, all can have more lasting impact to health.
In improvement radioactive pollution, traditional method is engineering method, chemical method.Engineering method is the method for physically collecting and isolating radioactive substance, and chemical method adopts special chemical fix and remove radiocontamination.Although the application that aforesaid method has been succeeded, horse traction woods as Hiroshima of Japan and Liang Ge city, Nagasaki, the republican Bikini Atoll nuclear test site in the Marshall Islands and Australia adds the Reparation and Reconstruction of nuclear test site, but its cost is very high, be difficult to use in the reparation of big area radiation zone, therefore, engineering is very large with the method limitation of chemistry.Biological restoration is the method utilizing special biomagnification and immobilization of radioactive pollutent, mainly microorganism and plant, particularly microbial function utilize of greatest concern, because its cost is low, be suitable for large area repair, thus biological restoration radiocontamination becomes the focus of current research.
Research shows: microorganism is not only by the radionuclide contamination dissolved and precipitation, biological adsorption and absorption, redox etc. are used in Environment control, and can pass through to change plant rhizosphere microenvironment, thus the absorption of raising plant heavy metal ion and radionuclide, volatilization or fixing efficiency.Relevant research also achieves positive progress, as the researchs such as Jana Sitte prove that the mobility of radioactive nucleus uranium (U) in soil is subject to the impact of microorganism and environmental factor in environment,
eva-Maria Burkhardtresearch shows that the heavy metal ion that the hyperplasia of Fe (III) reducing bacteria is conducive to comprising U is moved to underground water by soil.
c.H wangwith
d.Moreelsdeng research show, bacteria flora can impel soluble state U(VI) to stable U(IV) transform,
beyenalu can be fixed Deng research display sulphate reducing bacteria,
copplestonecan accumulate in a large number Deng separation acquisition
137 cs,
238+239+240 the microorganism strains of the radionuclides such as Pu, the research of Hu etc. shows that many microorganisms can adsorb U, as
pseudomonas aeruginosacSU,
aspergillus fumigatuswith
saccharomyces cerevisiae.The research such as Entry discovery is used AM VA Mycorrhizal Fungi and can be promoted row plant pair
137 cs,
90 the accumulation of Sr, Shewanella MR-1, can effectively by solubility U
6+ , Cr
6+ and Tc
7+ be reduced to insoluble U
5+ , Cr
3+ and Tc
4+ .
Microorganism remediation radioactive pollution is utilized to have successful example, Groudev utilizes indigenous microorganism to Bulgaria south containing the same heavy metal copper of radioelement uranium, radium and thorium, cadmium and lead pollution of soil in calendar year 2001, carry out in-situ immobilization, through the time of 8 months, the level of pollutent dropped to human-body safety scope.
Utilizing the radioactive contaminate environment of microorganism remediation must consider following two aspects: the first, must be strong radiation-resistant microorganism; The second, can not public safety be threatened during microorganism remediation environment, can not secondary pollution be produced.Because most bacterium is more responsive to activity ratio, therefore the ability of their reparation radiocontamination environment can be subject to larger restriction.Therefore, need from physical environment, go to be separated the microorganism with radiation resistance, or by genetic engineering technique transform some microorganisms make it obtain radiation resistance.There is no the report about radiation hardness Fusarium and application in radionuclide absorption thereof at present.
Summary of the invention
For the relevant report that there is no at present about Fusariumsp and application in radionuclide absorption thereof, particularly there is no the application relevant report of radiation hardness Fusarium in caesium biological treatment both at home and abroad.The object of the invention is intended to provide a kind of radiation hardness Fusarium and the application in the biological treatment of Adsorption of Radioactive caesium, particularly the invention provides a kind of Fusariumsp (
fusarium sp.) application of F54 CGMCC No.8359 in the biological treatment of absorption caesium.
The main technical schemes that the present invention adopts:
The present invention samples from In A Certain Place of Xinjiang radiation pollution environment, with different culture temperature, pH value, substratum for enrichment condition, filter out a collection of well-grown microorganism strains, therefrom optimize the bacterial strain that a strain is numbered F54, molecular water equality campaign checking through the physio-biochemical characteristics of microbial strains, colonial morphology, bacterial classification is determined, this bacterial classification be a kind of radiation hardness Fusariumsp (
fusarium sp.) F54, specify preservation Culture Collection through bacterial classification, preserving number is CGMCC No.8359, utilizes the application in radiocesium biological treatment of this bacterial classification.By test prove this radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 bacterial classification has tolerance to various metals, wherein to Pb
2+, Zn
2+, Ni
+tolerable concentration maximum, 1000 mg/L, 500 mg/L and 500 mg/L can be reached respectively; To Co
2+, Cr
2+, Hg
2+tolerance take second place, all can reach 200 mg/L.Simultaneously bacterial strain application in the absorption of radionuclide caesium obtains significantly significantly technique effect, thus demonstrates this bacterial classification in the biological treatment of absorption caesium, have good application prospect.
The present invention specifically provide one utilize radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 and Adsorption of Radioactive caesium biological treatment in application.Radiation hardness Fusariumsp used in the present invention (
fusarium sp.) from In A Certain Place of Xinjiang radiocontamination soil, sample separation by Microorgan Application Inst., Xinjiang Agricultural Academy, with different culture temperature, pH value, substratum is enrichment condition, filter out a collection of well-grown microorganism strains, therefrom optimize the bacterial strain that a strain is numbered F54 and be preserved in budapest treaty microorganism International Depository Authority: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) preservation, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101, preservation date is on October 22nd, 2013, culture presevation number is CGMCC No.8359, this strain culturing temperature 28-30 DEG C, the suitableeest culture temperature about 28 DEG C, this growth in PDA substratum (potato 200g, glucose 20g, agar 15g, distilled water 1L, pH nature), through 28 DEG C, 48h cultivates, F54 comes into being bacteria colony white, fine hair shape, grow prolifically.4 days white in canescence litchi meat afterwards, back side freshwater mussel meat white.Form the thick film of tow intertexture in media surface gradually, be uneven in a some sheet, not easily choose down with inoculating needle.Under microscope, mycelia is separated, and has many spherical spores in old mycelia.After 6 days, gas silk top starts the sporangiocyst enlarging into shape irregularity, has many spores not of uniform size in capsule, sporangiocyst without columella, without outer wall and capsule quilt.According to above morphological specificity, this bacterial strain of preliminary evaluation is a kind of deuteromycetes Moniliales Tuberculariaceae Xian Seduo spore race Fusarium.Identify with reference to " Fungal identification handbook ", in conjunction with F54 bacterial strain being carried out to morphology, Physiology and biochemistry qualification, called after sickle spore (
fusarium sp.), be a kind of radiation hardness Fusarium (
fusarium sp.).
Test through biolog, this bacterial strain can utilize N-ethanoyl--D-Glucose amine, ribitol, apricot glycosides, L-arabinose, D-arabitol, arbutin, D-cellobiose, dextrin, D fructose, D-semi-lactosi, gentiobiose, D-Glucose amine, a-D-glucose, a-D-Cori ester salt, D-glucuronic acid, glycerol, glycogen, Inositol nf12 99, 2-ketone-maltonic acid, a-D-lactose, maltose alcohol, maltose, trisaccharide maltose, PEARLITOL 25C, D glycosides dew sugar, D-melizitose, D-melibiose, a-methyl D-galactoside,-methyl D-galactoside, a-methyl-D-glucoside,-methyl-D-glucoside, 6-O-D-Glucopyranose acyl-D-fructofuranose, D-raffinose, L-rhamnosyl, D-ribose, saligenin, D-glucitol, L-sorbose, stachyose, sucrose, D-trehalose, turanose, Xylitol, D-wood sugar, γ-aminobutyric acid, bromosuccinic acid, FUMARIC ACID TECH GRADE,-hydroxybutyric acid, gamma-hydroxybutyric acid, P-HPAA, a-ketoglutaric acid, D-ALPHA-Hydroxypropionic acid methyl ester, Pfansteihl, D-malic acid, oxysuccinic acid, quinic acid, D-Glucose diacid, succsinic acid, succsinic acid methyl ester, L-Beta Alanine acid amides, L-Beta Alanine, L-alanyl Padil, altheine, L-Aspartic acid, Pidolidone, glycyl-L-glutamic acid, ornithine, L-phenyl handle propylhomoserin, proline(Pro), Pyrrolidonecarboxylic acid, Serine, L-revives amino acid, 2-monoethanolamine, rotten glycosides, adenosine, uridine, adenosine-5 phosphoric acid salt.
The present invention is by the extraction of STb gene, the pcr amplification of ITS sequence and order-checking, according to sequencing result, from the databases such as GenBank, EMBL, the ITS gene order of the higher related strain of similarity is recalled with Blast search software, carry out Multiple Sequence Alignment with Clustal X 2.0, with MEGA 5.0 software choose Saitou and Nei adjacent method (
neighbor Joining) carry out structure and the tetraploid rice of systematic evolution tree.After measured, Fusariumsp (
fusarium sp.) the ITS gene order length of F54 CGMCC No.8359 is 442bp.Analyzed by the above results and ITS DNA homolog, Phylogenetic Analysis result, by the bacterial strain Fusariumsp of purifying (
fusarium sp.) F54 CGMCC No.8359 carries out structure and the diversity analysis of systematic evolution tree, bacterium numbering be F54 with
fusarium oxysporum strainaTCC MYA-3931 homology is the highest, Fusariumsp that to be F54 identification of strains by bacterium numbering be (
fusarium sp.).By the Fusariumsp of multiplication culture (
fusariumsp.) F54 CGMCC No.8359 to be inoculated in PDA substratum (adding CsCl final concentration 20mg/L), 180-200rpm, 28 DEG C, cultivate 70h, to reach the object of cesium ion in adsorbent solution, maximum material removal rate reaches more than 80%.
Meanwhile, the present invention specifically provide one utilize radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 carries out utilisation technology scheme in radiocesium biological treatment:
The bacterial strain that the present invention is used
sickle sporebacterium (
fusarium sp.) F54 CGMCC No.8359 is for Ni
+, Cr
2+,, Zn
2+, Co
2+, Pb
2+, Hg
2+six kinds of ions all have resistance characteristics, wherein to Pb
2+, Zn
2+, Ni
+tolerable concentration maximum, 1000 mg/L, 500 mg/L and 500 mg/L can be reached respectively; To Co
2+, Cr
2+, Hg
2+tolerance take second place, all can reach 200 mg/L.Simultaneously in the absorption of radionuclide caesium, application obtains significantly significantly technique effect, thus demonstrates this bacterial classification in the biological treatment of absorption caesium, have good application prospect.
The present invention so provide radiation hardness Fusariumsp (
fusarium sp.) separation of F54 CGMCC No.8359 and cultural method.
1. isolation medium adopts: PDA substratum is potato 200g, glucose 20g, pH nature.
2. Isolation and screening condition: take gradient dilution method, take 10g pedotheque in 90mL stroke-physiological saline solution, gradient dilution is carried out after 30 ° of C activate 30min, choose 10-2,10-3,10-4 diluent and coat isolation medium PDA culture medium flat plate respectively, each process 3 repetition, puts 28 ° of C and cultivates.The bacterium colony that picking shape, size, color etc. are different after growing bacterium colony distinguishes streak inoculation in corresponding flat board, until fall without miscellaneous bacteria.Screen radiation hardness Fusariumsp (Fusarium sp.) the F54 CGMCC No.8359 that determines to come into being bacteria colony white at PDA substratum through cultivating, fine hair shape, grow prolifically.4 days white in canescence litchi meat afterwards, back side freshwater mussel meat white.Form the thick film of tow intertexture in media surface gradually, be uneven in a some sheet, not easily choose down with inoculating needle.Under microscope, mycelia is separated, and has many spherical spores in old mycelia.After 6 days, gas silk top starts the sporangiocyst enlarging into shape irregularity, has many spores not of uniform size in capsule, sporangiocyst without columella, without outer wall and capsule quilt.Biolog is utilized to test, find that this bacterium can utilize N-ethanoyl--D-Glucose amine, ribitol, apricot glycosides, L-arabinose, D-arabitol, arbutin, D-cellobiose, dextrin, D fructose, D-semi-lactosi, gentiobiose, D-Glucose amine, a-D-glucose, a-D-Cori ester salt, D-glucuronic acid, glycerol, glycogen, Inositol nf12 99, 2-ketone-maltonic acid, a-D-lactose, maltose alcohol, maltose, trisaccharide maltose, PEARLITOL 25C, D glycosides dew sugar, D-melizitose, D-melibiose, a-methyl D-galactoside,-methyl D-galactoside, a-methyl-D-glucoside,-methyl-D-glucoside, 6-O-D-Glucopyranose acyl-D-fructofuranose, D-raffinose, L-rhamnosyl, D-ribose, saligenin, D-glucitol, L-sorbose, stachyose, sucrose, D-trehalose, turanose, Xylitol, D-wood sugar, γ-aminobutyric acid, bromosuccinic acid, FUMARIC ACID TECH GRADE,-hydroxybutyric acid, gamma-hydroxybutyric acid, P-HPAA, a-ketoglutaric acid, D-ALPHA-Hydroxypropionic acid methyl ester, Pfansteihl, D-malic acid, oxysuccinic acid, quinic acid, D-Glucose diacid, succsinic acid, succsinic acid methyl ester, L-Beta Alanine acid amides, L-Beta Alanine, L-alanyl Padil, altheine, L-Aspartic acid, Pidolidone, glycyl-L-glutamic acid, ornithine, L-phenyl handle propylhomoserin, proline(Pro), Pyrrolidonecarboxylic acid, Serine, L-revives amino acid, 2-monoethanolamine, rotten glycosides, adenosine, uridine, 5'-AMP salt.
By implementing the concrete technical indicator of the present invention, realizing content of the present invention, following beneficial effect can be reached:
Radiation hardness Fusariumsp provided by the invention (Fusarium sp.) F54 CGMCC No.8359 and the application in caesium absorption thereof, all there is resistance characteristics to for Ni+, Cr2+, Zn2+, Co2+, Pb2+, Hg2+ six kinds of ions, wherein maximum to the tolerable concentration of Pb2+, Zn 2+, Ni+, 1000 mg/L, 500 mg/L and 500 mg/L can be reached respectively; The tolerance of Co2+, Cr2+, Hg2+ is taken second place, all can reach 200 mg/L.Growth absorption stability caesium and the radiocesium of thalline can be utilized by this law.
Accompanying drawing explanation
Figure 1 shows that Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 hydraulic pressure sheet figure.
Figure 2 shows that Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 Phylogenetic dendrogram.
Figure 3 shows that Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 is at 20mg/L Cs
+growth curve and characterization of adsorption figure under pressure.
Fig. 4 be depicted as pH to Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 growth absorption Cs
+effect diagram.
Figure 5 shows that different metal ion pair Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 growth absorption Cs
+effect diagram.
Figure 6 shows that different biomass to Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 adsorbs Cs
+effect diagram.
Figure 7 shows that adsorption time to Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 thalline absorption Cs
+effect diagram.
Figure 8 shows that temperature to Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 thalline absorption Cs
+effect diagram.
Figure 9 shows that Fusariumsp
(Fusarium sp.)f54 CGMCC No.8359 is to the absorption figure of stable caesium and radiocesium.
Embodiment
Illustrate the present invention further below in conjunction with specific embodiment, certainly, these embodiments only for illustration of the present invention, and are not used in restriction the scope of protection of present invention.
The main raw and auxiliary material, reagent and the plant and instrument that relate in the present invention:
Substratum is selected: PDA media surface is potato 200g, glucose 20g, agar 15g, distilled water 1L, pH nature.
Key instrument and reagent: MSSPX-250 type biochemical cultivation case, MLS-3020 high-pressure steam sterilizing pan, the single two-sided clean work station of SW-CJ-1F Type B, E360K whizzer, constant-temperature table HWY-100.PCR instrument Eppendorf No:5345, electrophoresis apparatus Bio-Rad Mode 200/2.0, gel imaging instrument United-Bio, GK-330C plus, PCR premixed liquid (TaKaRa Biotechnology), all the other reagent are analytical pure.Sonicator is U.S. Sonics, VC130.Xseries II type inductivity coupled plasma mass spectrometry (ICP-MS), THERMO company of the U.S.; The accurate pH meter of Seven Easy Plus S20P type, Shanghai plum Teller-Tuo benefit Instrument Ltd.; DHG-924OA type electric heating constant-temperature blowing drying box, Shanghai Yiheng Scientific Instruments Co., Ltd; THZ-82 gas bath constant temperature oscillation case, Community of Jin Tan County Cheng Hui instrument plant; GMSX-280 pressure steam sterilizer, Beijing is bright Medical Instruments company limited forever.Reagent is analytical pure, and water is ultrapure water, 18.2 M Ω cm.
The all reagent selected in the present invention and instrument are all well known selecting, but do not limit enforcement of the present invention, and other reagent more well known in the art and equipment are all applicable to the enforcement of the following embodiment of the present invention.
embodiment one: Fusariumsp (
fusarium sp.) separation of F54 CGMCC No.8359, cultivation
1. be separated
Radiation hardness Fusariumsp used in the present invention (
fusarium sp.) from In A Certain Place of Xinjiang radiocontamination soil, sample separation by Microorgan Application Inst., Xinjiang Agricultural Academy, traditional plating method is utilized to isolate microorganism in soil layer, plate streak purifying bacterial strain, with different culture temperature, pH value, substratum for enrichment condition, filter out a collection of well-grown microorganism strains, therefrom optimize the bacterial strain that a strain is numbered F54.
Separating step: according to gradient dilution method, take 10g pedotheque in 90mL stroke-physiological saline solution, carries out gradient dilution after 30 ° of C activate 30min, chooses 10
-2 , 10
-3 , 10
-4 diluent coats the flat board of PDA substratum respectively, each process 3 repetition, puts 28 ° of C and cultivates.The bacterium colony that picking shape, size, color etc. are different after growing bacterium colony distinguishes streak inoculation in new isolation medium PDA substratum, until fall without miscellaneous bacteria.A bacterial strain part after purifying is adopted the mode preservations such as freeze-drying ampoul tube, glycerine pipe and liquid nitrogen, and a part is stored in 4 ° of C and is directly used in follow-up study.
2. culture condition
By the bacterial strain Fusariumsp of purifying (
fusarium sp.) F54 is inoculated on solid potato culture medium inclined-plane, in 28 DEG C of cultivations
3my god, put into 4 DEG C of refrigerators and save backup.
Concrete: this strain culturing temperature 28-30 DEG C, the suitableeest culture temperature about 28 DEG C; This growth in PDA media surface be potato 200g, glucose 20g, agar 15g, distilled water 1L, pH nature, through 28 DEG C, 48h cultivate.
Used in the present invention
sickle sporebacterium (
fusarium sp.) F54 samples screening and separating by Microorgan Application Inst., Xinjiang Agricultural Academy and obtain from In A Certain Place of Xinjiang radiocontamination soil, this bacterial strain has been preserved in budapest treaty microorganism International Depository Authority: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) preservation, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101, preservation date is
on October 22nd, 2013, culture presevation number is CGMCC No.8359, this strain culturing temperature 28-30 DEG C, the suitableeest culture temperature about 28 DEG C; This growth in PDA media surface be potato 200g, glucose 20g, agar 15g, distilled water IL, pH nature, through 28 DEG C, 48h cultivates, bacterial classification F54 comes into being bacteria colony white, fine hair shape, grow prolifically.4 days white in canescence litchi meat afterwards, back side freshwater mussel meat white.Form the thick film of tow intertexture in media surface gradually, be uneven in a some sheet, not easily choose down with inoculating needle.Under microscope, mycelia is separated, and has many spherical spores in old mycelia.After 6 days, gas silk top starts the sporangiocyst enlarging into shape irregularity, has many spores not of uniform size in capsule, sporangiocyst without columella, without outer wall and capsule quilt.See accompanying drawing 1.According to above morphological specificity, this bacterial strain of preliminary evaluation is a kind of deuteromycetes Moniliales Tuberculariaceae Xian Seduo spore race Fusarium.Identify with reference to " Fungal identification handbook " (book of reference of bacterial classification preliminary evaluation foundation), carry out morphology, physiological and biochemical analysis in conjunction with to F54 bacterial strain, be accredited as Fusariumsp (
fusarium sp.), through factor analyses such as performance, colonial morphology bacterial classification attributes, this bacterial classification Fusariumsp (
fusarium sp.) F54 be a kind of radiation hardness Fusarium (
fusarium sp.).
Bacterial strain Fusariumsp (
fusarium sp.) physiological and biochemical index of F54 the results are shown in Table 1.
Table 1: the impact that the factor such as temperature, pH grows bacterial strain F54
| Temperature (DEG C) | 4 | 15 | 25 | 30 | 32 | 35 |
| Growing state | - | + | + | ++++ | +++ | +++ |
| Temperature (DEG C) | 38 | 45 | 50 | |||
| Growing state | ++ | + | - | |||
| pH | 1 | 2 | 3 | 4 | 5 | 6 |
| Growing state | - | - | - | + | + | ++ |
| pH | 7 | 8 | 9 | 10 | ||
| Growing state | +++ | + | - | - | ||
| NaCl concentration | 0％ | 1％ | 2％ | 3％ | 4％ | 5％ |
| Growing state | + | ++ | +++ | +++ | +++ | + |
| NaCl concentration | 6％ | 7％ | 8％ | 9％ | 10％ | |
| Growing state | + | + | + | + | - | |
| KCl concentration | 0％ | 1％ | 2％ | 3％ | 4％ | 5％ |
| Growing state | + | ++ | +++ | +++ | +++ | ++ |
| KCl concentration | 6％ | 7％ | 8％ | 9％ | 10％ | |
| Growing state | + | - | - | - | - |
3. bacterial classification describes: radiation hardness Fusariumsp of the present invention (
fusarium sp.) F54 CGMCC No.8359 is after PDA solid medium cultivates 5d, observed by the microscopy of inserted sheet and hydraulic pressure sheet, this bacterial strain white mycelium, fine hair shape, mycelia is separated, and has many spherical spores in old mycelia.After 6 days, gas silk top starts the sporangiocyst enlarging into shape irregularity, has many spores not of uniform size in capsule, sporangiocyst without columella, without outer wall and capsule quilt.N-ethanoyl--D-Glucose amine can be utilized, ribitol, apricot glycosides, L-arabinose, D-arabitol, arbutin, D-cellobiose, dextrin, D fructose, D-semi-lactosi, gentiobiose, D-Glucose amine, a-D-glucose, a-D-Cori ester salt, D-glucuronic acid, glycerol, glycogen, m-Inositol nf12 99, 2-ketone-maltonic acid, a-D-lactose, maltose alcohol, maltose, trisaccharide maltose, PEARLITOL 25C, D glycosides dew sugar, D-melizitose, D-melibiose, a-methyl D-galactoside,-methyl D-galactoside, a-methyl-D-glucoside,-methyl-D-glucoside, 6-O-D-Glucopyranose acyl-D-fructofuranose, D-raffinose, L-rhamnosyl, D-ribose, saligenin, D-glucitol, L-sorbose, stachyose, sucrose, D-trehalose, turanose, Xylitol, D-wood sugar, γ-aminobutyric acid, bromosuccinic acid, FUMARIC ACID TECH GRADE,-hydroxybutyric acid, gamma-hydroxybutyric acid, P-HPAA, a-ketoglutaric acid, D-ALPHA-Hydroxypropionic acid methyl ester, Pfansteihl, D-malic acid, oxysuccinic acid, quinic acid, D-Glucose diacid, succsinic acid, succsinic acid methyl ester, L-Beta Alanine acid amides, L-Beta Alanine, L-alanyl Padil, altheine, L-Aspartic acid, Pidolidone, glycyl-L-glutamic acid, ornithine, L-phenyl handle propylhomoserin, proline(Pro), Pyrrolidonecarboxylic acid, Serine, L-revives amino acid, 2-monoethanolamine, rotten glycosides, adenosine, uridine, adenosine-5 ˊ-phosphoric acid salt.
Radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No. 8359 bacterium colony hydraulic pressure sheet figure is see accompanying drawing 1.
embodiment two: Fusariumsp (
fusarium sp.) qualification of F54 CGMCC No.8359 molecular level
1, fungal gene group is extracted:
From substratum, picking hypha,hyphae, removes agar as far as possible; Add 200ul plant lysis buffer, be ground to powdery; Add 600ul plant lysis buf, 0.8ul β mercaptoethanol, fully mixes; 65 DEG C of water-bath 40min, 12000rpm, 10 min are centrifugal; Remove supernatant, add equal-volume chloroform, 12000rpm, 5min are centrifugal; Add 700ul plant Binding buf, upper prop leaves standstill 5min; 12000rpm, 2min are centrifugal; Add 500ul 80% ethanol and wash 2 times, 12000rpm, 1min are centrifugal; Room temperature leaves standstill 10min volatilization and dries, and adds 40ul H2O, leaves standstill 5-10min; Renew pipe, 13000rpm, 2min are centrifugal, are genome at the bottom of pipe.
2. ITS sequence amplification and order-checking
Increase with fungi ITS universal primer:
Forward primer ITS1:TCCGTAGGTGAACCTGCGG
Reverse primer ITS4:TCCTCCGCTTATTGATATGC
PCR amplification reaction system is 50 μ L, and reaction conditions is: 94 ° of C, 5 min; 94 ° of C, 30 S, 54 ° of C, 30 S, 72 ° of C, 50S, 35Cycles; 72 ° of C, 10min.Amplified production (about 442bp), pcr amplification product detects with 1% agarose gel electrophoresis, is checked order by amplified production, bacterial strain F54 is carried out ITS rDNA sequencing, after measured, radiation hardness Fusariumsp (
fusarium sp.) the ITS rDNA sequence length of CGMCC No.8359 is 442bp, see the attached gene order table provided.
3. ITS rDNA sequence alignment and Phylogenetic Analysis
The present invention is by the extraction of STb gene, the pcr amplification of ITS rDNA gene and order-checking.According to sequencing result, from the databases such as GenBank, EMBL, the ITS rDNA gene order of the higher relevant Fusarium bacterial strain of similarity is recalled with Blast search software, carry out Multiple Sequence Alignment with Clustal X, and adopt the adjacent method of Saitou and Nei (Neighbor Joining) to carry out the structure of systematic evolution tree with MEGA 5.0 software.Result see shown in accompanying drawing 2, as can be seen from dendrogram, this bacterial strain with
fusarium oxysporum strainaTCC MYA-3931, in same branch, shows that the sibship of the two is nearest, according to microorganism classification method, Fusariumsp that to be F54 identification of strains by bacterium numbering be (
fusarium sp.).
embodiment three: Fusariumsp (
fusarium sp.) capability of resistance to radiation of F54 CGMCC No.8359
Microbial treatment environmental radiation contact scar need meet two conditions, namely can survive in radiation environment and have higher adsorption selectivity to pollution nucleic.Fungi Fusariumsp (
fusarium sp.) F54 extracts in Soil Contaminated with Radionuclides, after slant culture, warp
60 co radioactive source gamma-ray irradiation, irradiation dose is accumulated as 10 kGy.Cultivate comparison by irradiation sample and non-irradiation sample, find the not irradiated impact of its growth, namely Fusarium F54 has very strong capability of resistance to radiation.
Show Fusariumsp provided by the invention (
fusarium sp.) F54 CGMCC No.8359 isolates, and accumulate through the irradiation dose of 10 kGy from radioactivity soil, has stronger radiation resistance.
embodiment four: Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 adsorbs the experimental technique of caesium and effect
1. Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 growth absorption Cs
+ adsorption experiment method is determined
Pipette 100 mL PDA culture medium solutions in 500 mL Erlenmeyer flasks, quantitatively add cesium chloride solution (20mg/L), by HCl and NaOH solution adjust ph, moist heat sterilization.Add 0.3 mL Fusarium F54 bacterial classification suspension liquid (the bacterial classification Homogeneous phase mixing on 20 mL sterilized waters and inclined-plane), with cyclotron oscillation (160 rpm in an oscillator after air-permeable envelope sealing, 30 DEG C), get a bacteria suspension every 12h after entering logarithmic phase.Solution centrifugal after absorption, supernatant liquor ICP-MS measures cesium ion concentration, and gained thalline dries to constant weight under 60 DEG C of conditions, for calculating biomass.
The method of calculation of unit adsorptive capacity and adsorption rate:
With unit adsorptive capacity (q
e) and adsorption rate (R) characterize the absorption situation of microorganism to caesium, method of calculation are shown in formula (1), (2).
q
e=（C
0-C
t）×V÷m （1）
R=（C
0-C
t）÷C
0×100% （2）
Wherein, C
0for the starting point concentration of caesium in solution, unit: mg/L; C
tfor the concentration of caesium in solution after the absorption t time, unit: mg/L; V is adsorbent solution volume, unit: L; M is the dry mycoplasma amount of Fusarium F54, unit: g.
2, radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 growth absorption Cs
+ characteristic and effect
Adsorption temp be 28 DEG C, pH nature (6.0-7.0), cesium ion concentration is that under the condition of 20 mg/L, adsorption rate is rapid growth along with the time, adsorption equilibrium is reached at about 60h, adsorption rate is about 80%, and after this adsorption rate changes not quite in time, see accompanying drawing 3.This is mainly owing to increasing cesium ion absorption along with microorganism, the absorption of cell surface to cesium ion reaches capacity gradually, cell walls strengthens its repulsion produced, and the resistance causing metal ion to enter into cell surface further increases, and then reaches the relative equilibrium stage.Along with the prolongation of incubation time, the adsorption rate of microorganism to caesium slightly reduces, and shows that thalline starts death along with nutritive substance approach exhaustion, even occurs autolysis, breaks sloid-liq-uid adsorption balance, causes thalline adsorption rate to decline.
embodiment five: affect radiation hardness Fusariumsp (
fusarium sp.) research of F54 CGMCC No.8359 adsorpting factor
Make Cs
+ final concentration is 20mg/L PDA substratum respectively, and leaves and takes the initial medium that a part do not connect bacterial classification and oppose in the same old way, to record Cs in substratum
+ the actual value of concentration.Respectively with pH, metallic cation, biomass, adsorption time and temperature for factor of influence is tested.
1. pH is on the impact of absorption: select pH4.0-pH8.0 as the initial pH of substratum respectively, inoculation radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No.8359,180rpm, 28 DEG C of shaking tables are cultivated.Be cultured to optimum time, sample when ICP-MS detects discovery at pH5.0-8.0, adsorption rate is higher, and result is see accompanying drawing 4.
2. metallic cation to Fusariumsp (
fusarium sp.) F54 adsorbs the impact of cesium ion: choose common metal ion K
+, Na
+, Ca
2+, Mg
2+, Al
3+, Fe
2+add containing 20 mg/L Cs
+ the PDA substratum of ion, metal ion final concentration is respectively 1mg/L, 5mg/L, 20mg/L, and inoculation bacterial classification F54, is arranged containing 20mg/L Cs
+ion and containing other cationic inoculation F54 substratum in contrast.180rpm, 28 DEG C of shaking tables are cultivated, and after being cultured to logarithmic phase, sample is measured by ICP-MS, to observe the impact of Common Cations on bacterial strain absorption cesium ion.Data analysis shows K
+, Na
+, Ca
2+, Mg
2+, Al
3+all restraining effect is had, K to bacterial strain absorption cesium ion
+, Na
+, Ca
2+, Al
3+the more close impact of concentration is larger, and Mg
2+restraining effect alleviate to some extent, lower than 10mg/L Fe along with the increase of concentration
2+to being adsorbed with promoter action.Result is see accompanying drawing 5.
3. biomass is for the impact of absorption: in order to determine that the absorption of F54 bacterial strain to the absorption of caesium is the absorption of growth limit, limit or the absorption of the thalline after growing, done thalline adsorption experiment.
Thalline is collected by PDA substratum mass propgation.Take the thalline (0.1g of different mass respectively, 0.2g, 0.5g, 0.8g, 1g, 1.2g, 1.5g) be placed in solution system that 15ml cesium ion concentration is 20mg/l respectively, attach overnight, sampling measures through ICP-MS, result shows: the adsorption rate of thalline, is all less than growth adsorption rate, determines the suction type of bacterial strain to the absorption of caesium filtered out and mainly grows absorption.Along with biomass increases, adsorption rate also slowly increases, and when reaching a certain amount of, adsorption rate no longer includes change, namely reaches balance.Along with the increase of biomass, under fixing metal ions CONCENTRATION STATE, the adsorptive capacity of unit thalline reduces, see accompanying drawing 6.
The impact that 4 adsorption times adsorb for thalline: take 0.5g thalline, concussion is suspended in the 10ml solution system that cesium ion concentration is 20mg/l respectively, and interval 1h samples.Sample measures through ICP-MS, and result shows that thalline adsorption rate is well below growth absorption, along with the increase adsorption rate of time does not significantly increase, just fluctuates in certain value scope up and down, and thalline absorption is likely a transients, see accompanying drawing 7.
The impact that 5 adsorption temps adsorb for thalline: take 0.5g thalline, concussion is suspended in the 10ml solution system that cesium ion concentration is 20mg/l respectively, is placed in the water-bath of differing temps, samples after absorption 1h.Sample measures through ICP-MS, and result shows within the scope of 10 DEG C-70 DEG C, and thalline adsorption rate is well below growth absorption, and along with the increase adsorption rate of temperature increases, the increase of temperature facilitates the carrying out of absorption, see accompanying drawing 8.
example six: radiation hardness Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 is to the growth adsorption test of radiocesium
Whether variant for the absorption of radiocesium and stability caesium in order to measure bacterial strain F54, devise following experimental program, in the PDA substratum of the stable cesium ion containing 10mg/L, add 0ml, 1ml(1806.5 Bake/ml respectively respectively), 2ml radiocesium mother liquor, inoculation F54, be cultured to the suitableeest growth time, collect sample.Respectively by the absorption to stability caesium and radiocesium in process of growth of ICP-MS and liquid flashing determining bacterial strain.
Table 2:F54 bacterial strain is to radiocesium-growth adsorption test design
| F54 | F54 | F54 | F54 | |
| Stability caesium | 0 | 0 | 10mg/L | 10mg/L |
| Radiocesium | 1ml | 2ml | 1ml | 2ml |
Shown in accompanying drawing 9, the adsorption rate of existence to stable caesium of radiocesium slightly suppresses, and bacterial strain F54 is obviously greater than stable caesium for the adsorption rate of radiocesium, and F54 can as the candidate strain of radiocesium in-situ immobilization.
In sum, verified by above-mentioned serial experiment, by the present invention utilize radiation hardness Fusariumsp (
fusarium sp.) the adsorbable cesium ion of growth of F54 thalline and radiocesium.
embodiment seven: Fusariumsp (
fusarium sp.) the resistance to heavy metal characteristic of F54 CGMCC No.8359
By bacterial strain Fusariumsp of the present invention (
fusarium sp.) F54 CGMCC No.8359 is inoculated in the seed test tube that 5ml PDA liquid nutrient medium is housed, and in 30 DEG C of cultivations, after 200rpm shaking culture 36h, is inoculated in the Ni respectively containing different concns by 2% inoculum size
+, Cr
2+, Zn
2+, Co
2+, Pb
2+, Hg
2+in six kinds of ionic liquid fermentation flasks, the amount of adding is 80ml/500ml triangular flask.30 DEG C, 220rpm shaking culture 72h, observes the growing state of bacterial classification; Discovery bacterial strain Fusariumsp (
fusarium sp.) F54 CGMCC No.8359 has tolerance to various metals, wherein to Pb
2+, Zn
2+, Ni
+tolerable concentration maximum, 1000 mg/L, 500 mg/L and 500 mg/L can be reached respectively; To Co
2+, Cr
2+, Hg
2+tolerance take second place, all can reach 200 mg/; PDA substratum adopts potato 200g, glucose 20g, distilled water 1000ml, pH nature.
SEQUENCE LISTING
<110> Microorgan Application Inst., Xinjiang Agricultural Academy
<120> radiation hardness Fusarium and the application in the biological treatment of absorption caesium
<130> radiation hardness Fusarium and the application in the biological treatment of absorption caesium
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 442
<212> DNA
<213> Fusarium sp.F54 CMGCC No. 8359
<400> 1
agggacggcc cgcccgagga cccctaaact ctgtttttag tggaacttct gagtaaaaca 60
aacaaataaa tcaaaacttt caacaacgga tctcttggtt ctggcatcga tgaagaacgc 120
agcaaaatgc gataagtaat gtgaattgca gaattcagtg aatcatcgaa tctttgaacg 180
cacattgcgc ccgccagtat tctggcgggc atgcctgttc gagcgtcatt tcaaccctca 240
agctcagctt ggtgttggga ctcgcggtaa cccgcgttcc ccaaatcgat tggcggtcac 300
gtcgagcttc catagcgtag taatcataca cctcgttact ggtaatcgtc gcggccacgc 360
cgtaaaaccc caacttctga atgttgacct cggatcaggt aggaataccc gctgaactta 420
agcatatcaa aaggcggagg aa 442
Claims (2)
1. a radiation hardness Fusariumsp (
fusarium sp.) F54, it is characterized in that, described radiation hardness Fusariumsp (
fusarium sp.) deposit number of F54 is CGMCC No.8359.
2. radiation hardness Fusariumsp as claimed in claim 1 (
fusarium sp.) application of F54 in the biological treatment of absorption caesium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410688785.6A CN104403951B (en) | 2014-11-26 | 2014-11-26 | Radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410688785.6A CN104403951B (en) | 2014-11-26 | 2014-11-26 | Radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104403951A true CN104403951A (en) | 2015-03-11 |
| CN104403951B CN104403951B (en) | 2017-04-19 |
Family
ID=52641621
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410688785.6A Expired - Fee Related CN104403951B (en) | 2014-11-26 | 2014-11-26 | Radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104403951B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105733966A (en) * | 2016-04-29 | 2016-07-06 | 新疆农业科学院微生物应用研究所 | Radiation-resistant filamentous fungi M30 and application thereof in biological treatment of adsorbing cadmium |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845396A (en) * | 2010-04-30 | 2010-09-29 | 新疆农业科学院微生物应用研究所 | Radiation-resistant fungus and crude red pigment preparation prepared from same |
-
2014
- 2014-11-26 CN CN201410688785.6A patent/CN104403951B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845396A (en) * | 2010-04-30 | 2010-09-29 | 新疆农业科学院微生物应用研究所 | Radiation-resistant fungus and crude red pigment preparation prepared from same |
Non-Patent Citations (4)
| Title |
|---|
| 朱静等: "辐射污染区土壤中细菌对重金属的耐受和吸附研究", 《新疆农业科学》 * |
| 潘蓉等: "青霉菌和镰刀菌对重金属Cd2+ 、Cu2+ 、Zn2+ 和Pb2+的吸附特性", 《环境科学学报》 * |
| 王卫宪: "真菌曲霉F77对水中铯的吸附行为研究", 《中国优秀硕士学位论文全文数据库》 * |
| 阳海斌: "南海红树林内源真菌Fusarium sp.#ZZF51生物吸附铜(II)、铀(VI)研究", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105733966A (en) * | 2016-04-29 | 2016-07-06 | 新疆农业科学院微生物应用研究所 | Radiation-resistant filamentous fungi M30 and application thereof in biological treatment of adsorbing cadmium |
| CN105733966B (en) * | 2016-04-29 | 2020-05-08 | 新疆农业科学院微生物应用研究所（中国新疆-亚美尼亚生物工程研究开发中心） | Radiation-resistant filamentous fungus M30 and application thereof in biological treatment for adsorbing cadmium |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104403951B (en) | 2017-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106493167B (en) | Bacillus licheniformis and microbial inoculum and their application and heavy metal-passivated method | |
| US20160185638A1 (en) | Fungi-bacteria composite microecologics and methods for preparing and using the same | |
| CN105670980B (en) | A kind of application of the microbial strains of restoration of soil polluted by heavy metal | |
| CN109161497B (en) | Microbial preparation for degrading aflatoxin and application | |
| CN104531537B (en) | A kind of aspergillus flavus strain and its application | |
| CN102154173A (en) | Separation and application of phthalate ester high-efficiency degrading bacteria | |
| CN104531585A (en) | Delftia tsuruhatensis and application thereof | |
| CN104805033B (en) | The microbacterium of one plant of degradable a variety of phthalic acid ester（Microbacterium sp.）J-1 | |
| CN104087519B (en) | A kind of radiation hardness aspergillosis and the application in absorption Ce 137 biological treatment thereof | |
| CN104403965B (en) | A kind of roost rose of Sharon pseudomonad of water body tetracycline pollutant of degrading and its application | |
| He et al. | An artificially constructed Syngonium podophyllum-Aspergillus niger combinate system for removal of uranium from wastewater | |
| CN103451105B (en) | A kind of filamentous fungus Penicllium chrysogenum J-5 of high absorption cadmium and preparation method and application | |
| CN100580078C (en) | Bacillus circulans WZ-12 and its application in microorganism resolving treatment of dichloromethane | |
| CN104152358B (en) | A kind of radiation hardness mould and the application in the biological treatment of Adsorption of Radioactive strontium 90 | |
| CN101597577A (en) | Novel heavy metal lead-resistant actinomycete strain and application thereof | |
| CN102876586A (en) | Method for screening trichoderma asperellum and application thereof | |
| CN105483038B (en) | The aerobic arsenic of one plant of thermophilic fiber Cordycepps methylates bacterium SM-1 and its application | |
| CN104403951A (en) | Radiation-proof Fusarium sp. and application thereof to cesium adsorption biotreatment | |
| CN105733966A (en) | Radiation-resistant filamentous fungi M30 and application thereof in biological treatment of adsorbing cadmium | |
| CN106801025A (en) | One plant of oil-base mud well drilling detritus degradation function bacterium and its application | |
| CN104805018B (en) | Earth mould (Agromyces sp.) MT E of one plant of a variety of phthalic acid ester that can degrade simultaneously | |
| CN104845890B (en) | Applications of earth mould (Agromyces sp.) the MT E in a variety of phthalic acid esters of degrading | |
| CN108130281B (en) | Aspergillus terreus DDT98801 and its screening technique and the application in degradation of dichloro-diphenyl-trichloroethane | |
| CN105886407B (en) | Radiation hardness filamentous fungi F35 and its application in Adsorption of Lead biological treatment | |
| Khamesy et al. | Identification of the fungi absorbing heavy metals isolated from waste deposits of zinc factories |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170419 Termination date: 20211126 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |