CN104357480B - Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia - Google Patents
Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia Download PDFInfo
- Publication number
- CN104357480B CN104357480B CN201410628062.7A CN201410628062A CN104357480B CN 104357480 B CN104357480 B CN 104357480B CN 201410628062 A CN201410628062 A CN 201410628062A CN 104357480 B CN104357480 B CN 104357480B
- Authority
- CN
- China
- Prior art keywords
- rgpal1
- glutinous rehmannia
- acteoside
- content
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia the invention discloses a kind of, belong to biological technical field.It includes the clone gene RgPAL1 from glutinous rehmannia, build the plant expression vector containing RgPAL1, with Agrobacterium tumefaciens mediated, RgPAL1 is transferred to glutinous rehmannia and plant is regenerated, PCR detection external source target gene RgPAL1 integration, the content of acteoside in HPLC PDA quantitative analysis transgenosis glutinous rehmannia, screening obtains the transgenosis glutinous rehmannia plant that acteoside content is improved.The content of acteoside is significantly improved in the transgenosis glutinous rehmannia that the present invention is obtained, the content for turning acteoside in RgPAL1 glutinous rehmannia is 2.57 times of non-transformed glutinous rehmannia content, and this provides a kind of effective method to mass produce acteoside using transgenosis glutinous rehmannia.The present invention provides the correlation technique and technology of innovation and practicality for lifting acteoside content.
Description
Technical field
The invention belongs to biological technical field, turn RgPAL1 genes more specifically to one kind and improve hair stamen in glutinous rehmannia
The method of flower Glycosides Contents.
Background technology
Glutinous rehmannia (Rehmannia glutinosa Libosch.) is Scrophulariaceae (Scrophulariaceae), is belonged to perennial
Herbaceous plant, with clearing heat and cooling blood, menstruation regulating, removing toxic substances the effect of.Glutinous rehmannia is large Chinese medicine of Chinese tradition, according to statistics, it
Frequency of use ranking in prescriptions of traditional Chinese medicine is located at preceding ten.Acteoside is the main pharmacodynamics material of glutinous rehmannia, is benzyl carbinol glycosides
(PeGs, phenylethanoid glycosides) representative compound, with it is antifatigue, anti-oxidant, delay body aging etc.
Effect.《Pharmacopoeia of People's Republic of China》Regulation under 2010 editions glutinous rehmannia (REHMANNIAE RADIX) assays,
The content of acteoside must not be less than 0.020% in glutinous rehmannia.However, due to the content of effective substance in Chinese medicinal material it is main by
The genetic type of medicinal plant itself for producing the Chinese medicinal material is determined, while also influenceed by certain habitat conditions, thus
Main pharmacodynamics material acteoside content is not only unstable in glutinous rehmannia medicinal material, and often the content in non-genunie medicinal materials far beyond
Content in genunie medicinal materials is low.
To obtain the medicinal material rich in acteoside, domestic and international scientist has attempted to use various methods, among these mainly
Precursor feeding including optimum culture condition, the research in isotope marks and biochemical enzyme activity tripartite face.By giving salt raw meat desert
Rong Cistanche salsa suspension cell external source addition phenylalanine, tyrosine, caffeic acid, Fresh Cucumber Juice, can increase feltwort
Accumulation (Jin-Yan Liu, Zhi-Gang Guo et al., the Improved accumulation of of glucosides
phenylethanoid glycosides by precursor feeding to suspension culture of
Cistanche salsa,Biochemical Engineering Journal,2007,33(1):88-93.)；To saline cistanche
Cistanche deserticola external sources addition phenylalanine, coconut milk, casein hydrolysate, proline also can be different degrees of
Improve accumulation (Xi-Yu Cheng, Tao Wei et al., the Cistanche deserticola cell of benzyl carbinol glycosides
suspension cultures:Phenylethanoid glycosides biosynthesis and antioxidant
activity,Process Biochemistry,2005,40(9):3119-3124)；Give the addition of saline cistanche suspension cell external source
Phenylalanine can even obtain effect (Jie Ouyang, the Xiao-dong Wang et that benzyl carbinol glycosides accumulation improves 75%
al.,Enhanced production of phenylethanoid glycosides by precursor feeding to
cell culture of Cistanche deserticola.Process Biochemistry,2005,40(11):3480-
3484)；When give saline cistanche suspension cell external source addition 1.5mmolL-1During phenylalanine, benzyl carbinol glycosides can improve 1.13 times
(Gao-Sheng Hu,Jing-Ming Jia et al.,Effects of feeding tyrosine and
phenylalanine on the accumulation of phenylethanoid glycosides to Cistanche
deserticola cell suspension culture.Chinese Journal of Natural Medicines,
2014,12(5):367-372).By to Ou Dingxiang Syringa vulgaris (Ellis, Production of
hydroxyphenylethanol glycosides in suspension cultures of Syringa
vulgaris.Phytochemistry,1983,22(9):1941-1943) and to olive Olea europaea isotope marks
Research (Saimaru and Orihara, Biosynthesis of acteoside in cultured cells of
Olea europaea.Journal of Natural Medicines,2010,64:After 139-145), two people unanimously think benzene
Alanine can efficiently participate in the biosynthesis of acteoside coffee acyl part.And work as with a kind of competitive inhibitor amino
Indenes phosphoric acid (AIP, 2-aminoindan-2-phosphonic acid) specificity suppresses after saline cistanche suspension cell PAL activity
(Hu,Hur et al.,Effects of 2-aminoindan-2-phosphonic acid treatment on the
accumulation of salidroside and four phenylethanoid glycosides in suspension
cell culture of Cistanche deserticola.Plant Cell Report,2011,30:665-674), find
The PeGs contents such as acteoside, echinacoside are significantly reduced.To sum up illustrate, phenylalanine is acteoside biosynthesis
One metabolic fluxes branch point, accumulation of the PAL to acteoside is most important.
Although having attempted a variety of methods to improve the content of acteoside in Chinese medicinal material, up to the present, pass through
Precursor feeding does not have commercial promise still come the acteoside content improved in cell culture system.In numerous plants, glutinous rehmannia
The content of acteoside enriches the (content of acteoside in side Po Lam, Wang Hongjie, Yang Jian, 5 kinds of different medicinal materials the most in leaf
Compare [J] CHINA JOURNAL OF CHINESE MATERIA MEDICA, 2010,35 (6):739-740), therefore, glutinous rehmannia is further lifting acteoside content
Ideal material, in order to obtain the glutinous rehmannia that acteoside content is high, realizes large-scale production acteoside, it is necessary to study one kind
Production cost is low, the effective ways being produced on a large scale.
The content of the invention
1. the problem of solving
For improving the problems such as acteoside content cost is high, method is immature in Chinese medicinal material in the prior art, this
Invention provides a kind of method for turning acteoside content in RgPAL1 genes raising glutinous rehmannia, using gene engineering method, from ground
Clone gene RgPAL1 in Huang, builds the plant expression vector containing RgPAL1, with Agrobacterium tumefaciens mediated, is transferred to ground by RgPAL1
Huang simultaneously regenerates plant, obtains the transgenosis glutinous rehmannia strain that acteoside content is significantly improved.
2. technical scheme
In order to solve the above problems, the technical solution adopted in the present invention is as follows：
Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, its step is：
(a) it is young from glutinous rehmannia using TaKaRa MiniBEST Plant RNA Extraction Kit (Code No.9769)
Total serum IgE is extracted in leaflet tablet；
(b) using TaKaRa PrimeScriptTM II 1st Strand cDNA Synthesis Kit(Code
No.6210A the glutinous rehmannia total serum IgE reverse transcription obtained in step (a)) is obtained into the first chain cDNA, after the gene order for determining cDNA
Obtain the coded sequence of glutinous rehmannia RgPAL1 genes；
(c) complete encoder block is amplified according to the design of the coded sequence of the glutinous rehmannia RgPAL1 genes determined in step (b)
Primer RgPAL1NSF and RgPAL1NSR, and restriction enzyme position is introduced on primer RgPAL1NSF and RgPAL1NSR respectively
Point Nco I and Spe I, is then expanded to RgPAL1 genes, and connection carrier T obtains pMDTM19-T-RgPAL1 genes；
(d) using pCAMBIA1305.1 as expression vector, with the pMD obtained in Nco I and the double digestion steps (c) of Spe ITM19-
T-RgPAL1 genes and pCAMBIA1305.1, reclaim pMDTMThe RgPAL1 gene pieces that 19-T-RgPAL1 genes are obtained after digestion
Section, the RgPAL1 genetic fragments of recovery are connected with the linear pCAMBIA1305.1 after digestion, are converted, and obtain base containing RgPAL1
The plant expression vector of cause；
(e) plant expression vector of the gene containing RgPAL1 obtained in step (d) is transferred to crown gall agriculture bar by freeze-thaw method
In bacterium EHA105, the Agrobacterium tumefaciems engineering bacteria of the expression vector of gene plant containing RgPAL1 is obtained；
(f) the Agrobacterium tumefaciems engineering bacteria of the expression vector of gene plant containing RgPAL1 obtained in step (e) is mediated
RgPAL1 genetic transformation glutinous rehmannia blade explants, then obtain glutinous rehmannia regeneration plant according to the approach culture of regenerative system；
(g) content of acteoside in the glutinous rehmannia regeneration plant obtained in HPLC-PDA determination steps (f), screening are utilized
Obtain the high transgenosis glutinous rehmannia plant of acteoside content.
Further, using TaKaRa MiniBEST Plant RNA Extraction Kit in described step (a)
(Code No.9769) is the step of extraction total serum IgE from glutinous rehmannia young leaflet tablet：
(1) glutinous rehmannia young leaflet tablet is taken, with liquid nitrogen flash freezer, then with mortar grinder into powder；
(2) powder obtained in 50mg steps (1) is taken to be added to the 1.5mL sterile centrifugations containing 450 μ l Buffer RL
Cracked, blown and beaten repeatedly with pipettor until without obvious sediment in centrifuge tube, obtaining lysate in pipe；
(3) after the lysate obtained in step (2) is centrifuged 5 minutes under the conditions of 4 DEG C, 12000rpm, Aspirate supernatant
Into new 1.5mL sterile centrifugation tubes；
(4) absolute ethyl alcohol is added to be well mixed in the 1.5mL sterile centrifugation tubes for filling supernatant in step (3) and obtained
The volume ratio of alcoholic supernatant, wherein absolute ethyl alcohol and supernatant is 1:2；
(5) alcoholic supernatant obtained in step (4) is all moved in RNA Spin Column, and by 500 μ L's
Buffer RWA are added into RNA Spin Column, are then centrifuged 30 seconds under the conditions of 12000rpm, are abandoned filtrate；
(6) in Buffer RWB plus after absolute ethyl alcohol mixing, the RNA for taking 600 μ L to add after being centrifuged into step (5)
In Spin Column, then centrifuged 30 seconds under the conditions of 12000rpm, abandon filtrate；
(7) the RNA Spin Column films centre after being centrifuged in step (6) adds the 100 μ L water without RNase,
2 minutes eluted rnas are centrifuged after standing 5 minutes in room temperature under the conditions of 12000rpm；
(8) with the RNA mass of elution in denaturing formaldehyde gel electrophoresis authentication step (7), according to OD values, on spectrophotometer
Determine rna content.
Further, primer RgPAL1NSF sequence is TGCCATGGCAATGGAGAATG in described step (c)
GGCACCAC, RgPAL1NSR sequence are GACTAGTCCTAGCAGATAGGGGGAGGTG.
Further, concretely comprising the following steps for glutinous rehmannia regeneration plant is obtained in described step (f)：
The preculture of (I) explant：Glutinous rehmannia blade flowing water with mass concentration is 0.05%-0.1% mercuric chloride after cleaning 2 hours
Immersion 5-10 minutes, it is then clean with sterilized water cleaning down, then soaked 15 seconds with 75% ethanol, then use aseptic water washing 4-
6 times；Blade after flushing is cut into 1cm2Size, surface moisture is blotted with aseptic filter paper, is inoculated in containing 1.5mgL-16- benzyl ammonia
Base adenine (6-BA) and 0.1mgL-1MS (Murashige and Skoog) solid induction of methyl α-naphthyl acetate (NAA) plant hormone
In culture medium (MS inducing cultures), alternately illumination cultivation 16 hours and light culture 8 hours, 1 month under the conditions of 25 DEG C
Afterwards, glutinous rehmannia Multiple Buds are obtained, is forwarded in the pure MS solid mediums without hormone, obtains aseptic seedling, treat seedling length to 5cm
Afterwards, clip tests for sterility explant is used to convert；
(II) Agrobacterium and the co-cultivation of explant：The blade explant obtained in step (I) is gone to containing 100 μm of ol
L-1In the MS culture mediums of acetosyringone (AS, acetosyringone), what is obtained in the step (e) that addition has been activated contains
The MS suspensions of the Agrobacterium tumefaciems engineering bacteria of RgPAL1 gene plant expression vectors, make explant fully be contacted with bacterium solution 5 minutes
Explant is taken out afterwards, the bacterium solution on explant surface is drawn with sterilizing filter paper, then explant is placed in containing 1.5mgL-16- benzyls
Aminoadenine (6-BA) and 0.1mgL-1Co-cultured 48 hours on the MS inducing cultures of methyl α-naphthyl acetate (NAA) plant hormone；
The screening of (III) resistance regeneration plant：The explant after terminating will be co-cultured in step (II) and is transferred to immediately and is contained
In the TRICLOSAN MS solid mediums of 500mg/L Cefotaxime Sodiums, according to the approach culture of regenerative system, to regenerating Multiple Buds
Afterwards, transfer and take root in the pure MS solid mediums containing 4mg/L hygromycin, until regeneration plant obtains transgenosis glutinous rehmannia；
(IV) determines the content of acteoside in transgenosis glutinous rehmannia using HPLC-PDA：It is concretely comprised the following steps：
1. preparing standard solution：50mg acteoside standard items are weighed, with the methanol constant volume that mass concentration is 50% extremely
50mL, is then diluted to 2.5,5,10,20 and 100 μ gmL respectively-1Standard liquid, it is standby；
2. standard curve is drawn：Take the acteoside standard liquid HPLC-PDA of step 1. various concentrations of middle preparation
Detection, draws standard curves of the peak area Y to standard items content X, and linear equation is：Y=34731X-9296.6, R2=
0.9997, the unit of standard items content is μ g, and linear regression analysis acteoside concentration is in 2.5 μ gmL-1To 100 μ g
mL-1Interior, its peak area Y is good to standard items content X linear relationship；
3. the content of acteoside in glutinous rehmannia is determined：The transgenosis glutinous rehmannia plant that culture is obtained in step (III) is taken, in
Grind into powder is dried to constant weight in 40 DEG C of baking ovens, 0.45mm sieves are crossed, the powder 18mL mass concentrations after 1g sievings are weighed
For 50% methanol ultrasonic extraction, after ultrasonic extraction terminates, supernatant is taken out and is settled to 25mL, takes the supernatant after constant volume to use
HPLC-PDA determines the peak area of acteoside, using step 2. in obtained linear equation calculate containing for acteoside
Amount.
Further, the Agrobacterium tumefaciems engineering of the expression vector of gene plant containing RgPAL1 is activated in described step (II)
The method of bacterium is：The Agrobacterium tumefaciems engineering bacteria of the gene plant containing RgPAL1 obtained in step (e) expression vector is trained in MS
Support and plate culture is drawn on base, then picking single bacterium colony is transferred in agrobacterium rhizogenes fluid nutrient medium and cultivated to OD660=0.6.
Further, HPLC-PDA determines the HPLC chromatogram condition of acteoside in glutinous rehmannia in described step (IV)
For：Chromatographic column is Phenomenex C18- ODS posts, mobile phase is made up of A phases and B phases according to the mixing of different volumes ratio, wherein A phases
For 0.1% phosphoric acid solution, B phases are that methanol and acetonitrile mix composition according to volume ratio 3: 2, and type of elution is：In 1-22min,
Eluted with the mobile phase of the phase containing 10%B；In 22-30min, eluted with the mobile phase of the phase containing 30%-60%B；In 30-35min
When, eluted with the mobile phase of the phase containing 60%B；35 DEG C of column temperature；Flow velocity 1.0mLmin-1, Detection wavelength is 190-360nm, sample introduction
Measure 10 μ L.
Further, the condition of described step 3. middle ultrasonic extraction is：40kHz, 200W ultrasonic extraction 30min, therebetween
Stop ultrasound after per ultrasound 10min and stand 10min.
3. beneficial effect
Compared to prior art, beneficial effects of the present invention are：
(1) turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia in the present invention, be to use gene work
Cheng Fangfa, by the inventors discovered that key gene RgPAL1 import glutinous rehmannia plant in, obtain acteoside content show
The transgenosis glutinous rehmannia strain improved is write, acteoside content is 1.27mgg in non-transformed, common glutinous rehmannia-1During DW, turn
The content of acteoside reaches 3.27mgg in RgPAL1 gene glutinous rehmannia-1DW, its content is the 2.57 of non-transformed glutinous rehmannia content
Times, the content of acteoside in glutinous rehmannia can be significantly improved using the method for conversion RgPAL1 genes；
(2) method for turning acteoside content in RgPAL1 genes raising glutinous rehmannia in the present invention can significantly improve glutinous rehmannia
The content of middle acteoside, to be laid a good foundation using transgenosis glutinous rehmannia large-scale production acteoside；
(3) present invention is by turning the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, method maturation, cost
It is low, with very wide commercial promise；
(4) according to 2010 editions Pharmacopoeias of People's Republic of China, acteoside is also China saline cistanche Cistanche
Deserticola Y.C.Ma, purple strain leaf Callicarpa formosana Rolfe, plantain seed Plantago asiatica
Etc. L. the main pharmacodynamics composition and quality control standard of a variety of traditional Chinese medicine medicinal materials, utilize the base containing RgPAL1 built in this method
Because of the Agrobacterium tumefaciems engineering bacteria of plant expression vector, can also it implement transgenosis to above Chinese medicinal material, for lifting medical material quanlity
There is provided the correlation technique and technology of innovation and practicality.
Brief description of the drawings
Fig. 1 is that RNA extracts result electrophoretogram；
Fig. 2 is PCR testing result electrophoretograms；
Fig. 3 is digestion verification result electrophoretogram；
Fig. 4 is PCR the result electrophoretograms；
Fig. 5 is HPLC-PDA collection of illustrative plates.
In figure：1 is glutinous rehmannia blade RNA electrophoretic bands in Fig. 1；M is DL 2000DNA Marker electrophoretic band in Fig. 2,
1 is the electrophoretic band of RgPAL1 amplified productions；M is DL 5000DNA Marker electrophoretic band in Fig. 3, and 1 is
The electrophoretic band of pCAMBIA1305.1 carrier frameworks and RgPAL1 genes；M is DL 2000DNA Marker electrophoresis strip in Fig. 4
Band, 1 is the electrophoretic band of RgPAL1 amplified productions；(A) is acteoside standard items HPLC-PDA collection of illustrative plates in Fig. 5；(B) to be non-
Conversion, common glutinous rehmannia extract solution HPLC-PDA collection of illustrative plates；(C) it is to turn RgPAL1 gene glutinous rehmannia extract solution HPLC-PDA collection of illustrative plates.
Embodiment
Embodiments of the invention are elaborated below：The present embodiment is carried out lower premised on technical solution of the present invention
Implement, give detailed embodiment and specific operating process, but protection scope of the present invention is not limited to following implementations.
The experimental method of unreceipted actual conditions in the following example, generally according to normal condition, such as Sambrook
《Molecular Cloning:A Laboratory guide (the 3rd edition)》Condition described in (Science Press, 2002), or according to proposed by manufacturer
Condition.
The present invention is further described below with reference to specific embodiment.
Embodiment 1
The clone of glutinous rehmannia RgPAL1 genes
1. the extraction of glutinous rehmannia total serum IgE
Glutinous rehmannia children is extracted using TaKaRa MiniBEST Plant RNA Extraction Kit (Code No.9769)
Total serum IgE in leaflet tablet, its step is：A small amount of glutinous rehmannia is taken (to pick up from Henan Province's Huaihua, turn to plant in Ma ' anshan City Pu pools plant
Garden) young leaflet tablet, after liquid nitrogen flash freezer, it is rapid with mortar grinder into powder, take about 50mg powder to be added to containing 450 μ L Buffer
Cracked, blown and beaten repeatedly with pipettor until being cracked in centrifuge tube without obvious sediment in RL 1.5mL sterile centrifugation tubes
Liquid；Lysate is placed in after being centrifuged 5 minutes under the conditions of 12000rpm, 4 DEG C, Aspirate supernatant to new 1.5mL sterile centrifugation tubes
In；Absolute ethyl alcohol is added to be well mixed in the above-mentioned 1.5mL sterile centrifugation tubes for filling supernatant and obtains alcoholic supernatant, nothing
The volume ratio of water-ethanol and supernatant is 1:2；Obtained alcoholic supernatant is all moved in RNA Spin Column, and will
500 μ l Buffer RWA are added into RNA Spin Column, are then centrifuged 30 seconds under the conditions of 12000rpm, are abandoned filter
Liquid；600 μ L Buffer RWB (needing pre-add absolute ethyl alcohol) are added into RNA Spin Column, 12000rpm centrifugations 30
Second, filtrate is abandoned, is then added in RNA Spin Column films centre and 5 points is stood in the 100 μ L water without RNase, room temperature
2 minutes eluted rnas are centrifuged after clock under the conditions of 12000rpm, total serum IgE quality electrophoresis result is identified such as with denaturing formaldehyde gel electrophoresis
Shown in Fig. 1, from figure two clearly band can be seen that the RNA for obtaining high-purity.OD values are determined on spectrophotometer,
The content for calculating gained RNA is 17 μ g.
2. gene cloning
Using TaKaRa PrimeScriptTM II 1st Strand cDNA Synthesis Kit(Code
No.6210A the glutinous rehmannia total serum IgE reverse transcription obtained) is obtained into the first chain cDNA, surveyed by Nanjing Genscript Biotechnology Co., Ltd.
The coded sequence of acquisition glutinous rehmannia RgPAL1 genes after cDNA gene order is determined, according to the volume of resulting glutinous rehmannia RgPAL1 genes
Code sequence, design amplifies the primer (RgPAL1NSF and RgPAL1NSR in table 1) of complete encoder block, and in primer
Restriction endonuclease sites (Nco I and Spe I) are introduced on RgPAL1NSF and RgPAL1NSR respectively, then RgPAL1 genes are entered
Row amplification, connection carrier T obtains pMDTM19-T-RgPAL1 genes.The sequencing result of Nanjing Genscript Biotechnology Co., Ltd.
Show, the coded sequence (GenBank for the glutinous rehmannia RgPAL1 genes reported in the cDNA sequence and GenBank cloned：
AF401636 it is) consistent.
Table 1 primer RgPAL1EF and RgPAL1ER sequence table
Embodiment 2
Build the plant expression vector pCAMBIA1305.1-RgPAL1 of the genes of RgPAL1 containing glutinous rehmannia carrier
Using pCAMBIA1305.1 as expression vector, with the pMD obtained in Nco I and the double digestion embodiments 1 of Spe ITM19-T-
RgPAL1 and pCAMBIA1305.1, reclaims pMDTMThe RgPAL1 genetic fragments that 19-T-RgPAL1 genes are obtained after digestion, will
It is connected with the linear pCAMBIA1305.1 large fragments after digestion, conversion, picking monoclonal, extracts plasmid and does PCR detections and enzyme
Checking, PCR testing results are cut as shown in Fig. 2 caning be found that 4 monoclonals of picking have band at 2.2kb from figure, and
Digestion verification result is as shown in figure 3, it can be found that long 11.6kb pCAMBIA1305.1 carrier frameworks and one from figure
Long 2.2kb RgPAL1 gene bands；To sum up result shows, RgPAL1 genes are successfully building up to plant expression vector
In pCAMBIA1305.1, so as to obtain the plant expression vector of the gene containing RgPAL1.
Acteoside biosynthesis pathway key gene RgPAL1 is operatively connectable to expression by the present embodiment
Regulating and controlling sequence, forms the plant expression vector of the gene containing RgPAL1.
Embodiment 3
Agrobacterium tumefaciens mediated RgPAL1 gene genetics conversion glutinous rehmannia obtains transgenosis glutinous rehmannia plant
1. the acquisition of the expression vector Agrobacterium tumefaciems engineering bacteria of gene plant containing RgPAL1
By the plant binary expression vector of the gene containing RgPAL1 in embodiment 2, by freeze-thaw method, Agrobacterium tumefaciems is transferred to
EHA105 (biomaterial of market public offering), performing PCR of going forward side by side checking, PCR the results are as shown in figure 4, can be with from figure
It was found that there is an obvious band at 2.2kb；As a result show, the expression vector of gene plant containing RgPAL1 has successfully been building up to crown gall agriculture bar
In bacteria strain.
2. Agrobacterium tumefaciens mediated RgPAL1 genetic transformation glutinous rehmannia
The preculture of 2.1 explants
Glutinous rehmannia blade flowing water is cleaned 2 hours, is soaked 5 minutes, is then done with sterilized water cleaning down with 0.1% mercuric chloride mercuric chloride
Only, then with 75% ethanol soak 15 seconds, then with aseptic water washing 5 times；Blade after flushing is cut into 1cm2Size, with sterile
Filter paper blots surface moisture, is inoculated in containing 1.5mgL-16- benzyls aminoadenine (6-BA) and 0.1mgL-1Methyl α-naphthyl acetate (NAA)
In the MS inducing cultures of plant hormone, alternately illumination cultivation 16 hours and light culture 8 hours, 1 under the conditions of 25 DEG C
After months, glutinous rehmannia Multiple Buds are directly obtained, is forwarded in the pure MS solid mediums without any hormone, aseptic seedling can be obtained,
After after seedling length to 5cm or so, clip tests for sterility explant is used to convert.
2.2 Agrobacteriums and the co-cultivation of explant
The blade explant obtained in 2.1 is gone to containing 100 μm of olL-1In AS MS culture mediums, what addition had been activated contains
The MS suspensions of the Agrobacterium tumefaciems engineering bacteria of RgPAL1 gene plant expression vectors, make explant fully be contacted with bacterium solution 5 minutes
The bacterium solution on explant surface is drawn with sterilizing filter paper afterwards, then explant is placed on MS inducing cultures and co-cultured 48 hours.
The screening of 2.3 resistance regeneration plants
Explant after co-cultivation in 2.2 is terminated is transferred to the TRICLOSAN MS solids of the Cefotaxime Sodium containing 500mg/L immediately
In culture medium, according to the approach culture of regenerative system, until regeneration plant.To regenerating after Multiple Buds, transfer into containing
Taken root in the pure MS solid mediums of 4mg/L hygromycin, until regeneration plant obtains transgenosis glutinous rehmannia.
2.4 the PCR detections of transgenosis glutinous rehmannia plant
Using conventional CTAB (CTAB, Cetyltrimethyl Ammonium bromide) method
Transgenosis glutinous rehmannia plant DNA is extracted, the expression cassette pCAMBIA1305.1-RgPAL1-GUS according to where target gene is separately designed
Forward and reverse primer pair is detected across RgPAL1 and GUS.As a result show, using designed PCR special primers, can expand
Go out 1.8kb specific DNA fragment, and during using non-transformed glutinous rehmannia genomic DNA as template, do not amplify any fragment, explanation
RgPAL1 genes are successfully transferred to glutinous rehmannia plant.
Embodiment 4
1. the content of acteoside in transgenosis glutinous rehmannia is determined using HPLC-PDA
The compound method of 1.1 standard liquids, need testing solution
Accurately weighed 50mg acteosides standard items (are purchased from National Institute for Food and Drugs Control, lot number 111530-
201007), 2.5,5,10,20 and 100 μ g are then diluted to respectively to 50mL with the methanol constant volume that mass concentration is 50%
mL-1, standard liquid, it is standby.
Negated transgenosis glutinous rehmannia and transgenosis glutinous rehmannia plant, dry to constant weight in 40 DEG C of baking ovens respectively, after pulverize, mistake
0.45mm is sieved, and accurately weighed 1g powder is in conical flask, plus the methanol that 18mL mass concentrations are 50%, and 40kHz, 200W ultrasounds are carried
30min is taken, therebetween per ultrasound 10min, 10min is spaced.Ultrasound is finished, and supernatant is gone into 25mL volumetric flasks, scale is settled to.
1.2 draw standard curve
Take the acteoside standard liquid for the various concentrations prepared in 1.1 to be detected with HPLC-PDA, draw Y pairs of peak area
Standard items content X standard curve, obtained standard curve linear equation is：Y=34731X-9296.6, R2=0.9997, mark
The unit of quasi- product content is μ g, and linear regression analysis acteoside concentration is in 2.5 μ gmL-1To 100 μ gmL-1It is interior, its peak
Area Y is good to standard items content X linear relationship.
The chromatographic condition of acteoside content is in HPLC-PDA measure glutinous rehmannia：Chromatographic column is Phenomenex C18-
ODS posts, mobile phase is by A phases (0.10% phosphoric acid solution) and B phases (methanol: acetonitrile, 3:2, v:V) according to different volumes than mixing group
Into type of elution is：In 1-22min, eluted with the mobile phase of the phase containing 10%B；In 22-30min, with containing 30%-60%B
The mobile phase elution of phase；In 30-35min, eluted with the mobile phase of the phase containing 60%B；35 DEG C of column temperature；Flow velocity 1.0mLmin-1,
Detection wavelength is 190-360nm, the μ L of sample size 10.
1.3 determine the content of acteoside in glutinous rehmannia
Obtained transgenosis glutinous rehmannia plant is cultivated in Example 3, dries and is pulverized to constant weight in 40 DEG C of baking ovens
End, crosses 0.45mm sieves, weighs the powder methanol ultrasonic extraction that 18mL mass concentrations are 50% after 1g sievings, ultrasonic extraction
Condition is：40kHz, 200W ultrasonic extraction 30min, stop ultrasound after every ultrasound 10min therebetween and stand 10min；Ultrasonic extraction knot
Shu Hou, supernatant is taken out and is settled to 25mL, takes the supernatant after constant volume to determine the peak area of acteoside with HPLC-PDA,
The content of acteoside is calculated using the linear equation obtained in 1.2, turns containing for acteoside in RgPAL1 gene glutinous rehmannia
Amount reaches 3.27mgg-1Acteoside content is 1.27mgg in DW, the non-transformed common glutinous rehmannia determined with HPLC-PDA-1During DW, as a result as shown in figure 5, by the integrating peak areas in figure and calculating discovery；Turn feltwort in RgPAL1 gene glutinous rehmannia
The content of glucosides is 2.57 times of non-transformed glutinous rehmannia content, illustrates to significantly improve ground using the method for conversion RgPAL1 genes
The content of acteoside in Huang.
Claims (7)
1. the method that turn RgPAL1 genes improve acteoside content in glutinous rehmannia, its step is：
(a) total serum IgE is extracted from glutinous rehmannia young leaflet tablet；
(b) the glutinous rehmannia total serum IgE reverse transcription obtained in step (a) is obtained into the first chain cDNA, obtained after the gene order for determining cDNA
Obtain the coded sequence of glutinous rehmannia RgPAL1 genes；
(c) primer of complete encoder block is amplified according to the design of the coded sequence of the glutinous rehmannia RgPAL1 genes determined in step (b)
RgPAL1NSF and RgPAL1NSR, and restriction endonuclease sites are introduced respectively on primer RgPAL1NSF and RgPAL1NSR
Nco I and Spe I, is then expanded to RgPAL1 genes, and connection carrier T obtains pMDTM19-T-RgPAL1 genes, it is described
RgPAL1NSF sequences are TGCCATGGCAATGGAGAATGGGCACCAC, and described RgPAL1NSR sequences are
GACTAGTCCTAGCAGATAGGGGGAGGTG；
(d) using pCAMBIA1305.1 as expression vector, with the pMD obtained in Nco I and the double digestion steps (c) of Spe ITM19-T-
RgPAL1 genes and pCAMBIA1305.1, reclaim pMDTMThe RgPAL1 gene pieces that 19-T-RgPAL1 genes are obtained after digestion
Section, the RgPAL1 genetic fragments of recovery are connected with the linear pCAMBIA1305.1 after digestion, are converted, and obtain base containing RgPAL1
The plant expression vector of cause；
(e) plant expression vector of the gene containing RgPAL1 obtained in step (d) is transferred in Agrobacterium tumefaciems EHA105, obtained
The Agrobacterium tumefaciems engineering bacteria of the expression vector of gene plant containing RgPAL1；
(f) the Agrobacterium tumefaciems engineering bacteria of the expression vector of gene plant containing RgPAL1 obtained in step (e) is mediated into RgPAL1
Genetic transformation glutinous rehmannia blade explant, then obtains glutinous rehmannia regeneration plant according to the approach culture of regenerative system；
(g) using the content of acteoside in the glutinous rehmannia regeneration plant obtained in HPLC-PDA determination steps (f), screening is obtained
The high transgenosis glutinous rehmannia plant of acteoside content.
2. according to claim 1 turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, its feature exists
In：It is to use TaKaRa MiniBEST Plant RNA to extract total serum IgE from glutinous rehmannia young leaflet tablet in described step (a)
Extraction Kit, its step is：
(1) glutinous rehmannia young leaflet tablet is taken, with liquid nitrogen flash freezer, then with mortar grinder into powder；
(2) powder obtained in 50mg steps (1) is taken to be added in the 1.5mL sterile centrifugation tubes containing 450 μ l Buffer RL
Cracked, blown and beaten repeatedly with pipettor until without obvious sediment in centrifuge tube, obtaining lysate；
(3) by the lysate obtained in step (2) under the conditions of 4 DEG C, the 12000rpm after centrifugation 5 minutes, Aspirate supernatant is to new
1.5mL sterile centrifugation tubes in；
(4) absolute ethyl alcohol is added to be well mixed in the 1.5mL sterile centrifugation tubes for filling supernatant in step (3) and obtains ethanol
The volume ratio of supernatant, wherein absolute ethyl alcohol and supernatant is 1:2；
(5) alcoholic supernatant obtained in step (4) is all moved in RNA Spin Column, and by 500 μ L Buffer
RWA is added into RNA Spin Column, is then centrifuged 30 seconds under the conditions of 12000rpm, is abandoned filtrate；
(6) in Buffer RWB plus after the mixing of 70mL absolute ethyl alcohols, the RNA for taking 600 μ L to add after being centrifuged into step (5)
In Spin Column, then centrifuged 30 seconds under the conditions of 12000rpm, abandon filtrate；
(7) the RNA Spin Column films centre after being centrifuged in step (6) adds the 100 μ L water without RNase, stands 5
2 minutes eluted rnas are centrifuged after minute under the conditions of 12000rpm；
(8) the RNA mass eluted in authentication step (7), according to OD values, determines rna content on spectrophotometer.
3. according to claim 1 turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, its feature exists
In：Concretely comprising the following steps for glutinous rehmannia regeneration plant is obtained in described step (f)：
The preculture of (I) explant：Glutinous rehmannia blade flowing water clean 2 hours after with mass concentration be 0.05%-0.1% mercuric chloride soak
It is 5-10 minutes, then clean with sterilized water cleaning down, then with 75% ethanol immersion 15 seconds, then with aseptic water washing 4-6 times；
Blade after flushing is cut into 1cm2Size, surface moisture is blotted with aseptic filter paper, is inoculated in containing 1.5mgL-16- benzyl amino
Adenine and 0.1mgL-1In the MS solid inducing cultures of methyl α-naphthyl acetate plant hormone, the alternately illumination under the conditions of 25 DEG C
Culture 16 hours and light culture obtain glutinous rehmannia Multiple Buds after 8 hours, 1 month, are forwarded to the pure MS solids training without hormone
Support in base, obtain aseptic seedling, after after seedling length to 5cm, clip tests for sterility explant is used to convert；
(II) Agrobacterium and the co-cultivation of explant：The blade explant obtained in step (I) is gone to containing 100 μm of olL-1Second
In the MS culture mediums of acyl syringone, the root of the expression vector of gene plant containing RgPAL1 obtained in the step (e) activated is added
The MS suspensions of cancer Agrobacterium engineering bacteria, make explant take out explant after fully contacting 5 minutes with bacterium solution, are inhaled with sterilizing filter paper
The bacterium solution on explant surface is taken, then explant is placed in containing 1.5mgL-16- benzyls aminoadenine and 0.1mgL-1Naphthalene second
Co-cultured 48 hours on the MS inducing cultures of sour plant hormone；
The screening of (III) resistance regeneration plant：The explant after terminating will be co-cultured in step (II) to be transferred to immediately containing 500mg/L
In the TRICLOSAN MS solid mediums of Cefotaxime Sodium, according to the approach culture of regenerative system, to regenerating after Multiple Buds, transfer
Enter and taken root in the pure MS solid mediums containing 4mg/L hygromycin, until regeneration plant obtains transgenosis glutinous rehmannia；
(IV) determines the content of acteoside in transgenosis glutinous rehmannia using HPLC-PDA：It is concretely comprised the following steps：
1. preparing standard solution：50mg acteoside standard items are weighed, with the methanol constant volume that mass concentration is 50% to 50mL,
Then 2.5,5,10,20 and 100 μ gmL are diluted to respectively-1Standard liquid, it is standby；
2. standard curve is drawn：The acteoside standard liquid of step 1. various concentrations of middle preparation is taken to be examined with HPLC-PDA
Survey, draw standard curves of the peak area Y to standard items content X, linear equation is：Y=34731X-9296.6, R2=0.9997,
The unit of standard items content is μ g, and linear regression analysis acteoside concentration is in 2.5 μ gmL-1To 100 μ gmL-1It is interior, its
Peak area Y is good to standard items content X linear relationship；
3. the content of acteoside in glutinous rehmannia is determined：The transgenosis glutinous rehmannia plant that culture is obtained in step (III) is taken, in 40 DEG C
The grind into powder to constant weight is dried in baking oven, 0.45mm sieves are crossed, weigh the powder after 1g sievings is with 18mL mass concentrations
50% methanol ultrasonic extraction, after ultrasonic extraction terminates, supernatant is taken out and is settled to 25mL, takes the supernatant after constant volume to use
HPLC-PDA determines the peak area of acteoside, using step 2. in obtained linear equation calculate containing for acteoside
Amount.
4. according to claim 3 turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, its feature exists
In：The method of the Agrobacterium tumefaciems engineering bacteria of the activation expression vector of gene plant containing RgPAL1 is in described step (II)：Will
The Agrobacterium tumefaciems engineering bacteria of the expression vector of gene plant containing RgPAL1 obtained in step (e) is cultivated on MS culture mediums, so
Picking single bacterium colony is transferred in agrobacterium rhizogenes fluid nutrient medium and cultivated to OD afterwards660=0.6.
5. according to claim 3 turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, its feature exists
In：The HPLC chromatogram condition of acteoside is in HPLC-PDA measure glutinous rehmannia in described step (IV)：Chromatographic column is
Phenomenex C18- ODS posts, mobile phase is made up of A phases and B phases according to the mixing of different volumes ratio, and wherein A phases are 0.1% phosphoric acid
Solution, B phases are that methanol and acetonitrile mix composition according to volume ratio 3: 2, and type of elution is：In 1-22min, with phase containing 10%B
Mobile phase elution, in 22-30min, eluted with the mobile phase of the phase containing 30%-60%B, in 30-35min, with containing 60%B
The mobile phase elution of phase；35 DEG C of column temperature；Flow velocity 1.0mLmin-1, Detection wavelength is 190-360nm, the μ L of sample size 10.
6. according to claim 3 turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia, its feature exists
In：The condition of described step 3. middle ultrasonic extraction is：40kHz, 200W ultrasonic extraction 30min, stop after every ultrasound 10min therebetween
Only ultrasound and stand 10min.
7. turn the side that RgPAL1 genes improve acteoside content in glutinous rehmannia according to any one in claim 1-6
Method, it is characterised in that：It is to use TaKaRa PrimeScript that described reverse transcription, which obtains the first chain cDNA,TM II 1st
Strand cDNA Synthesis Kit。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410628062.7A CN104357480B (en) | 2014-11-10 | 2014-11-10 | Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410628062.7A CN104357480B (en) | 2014-11-10 | 2014-11-10 | Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104357480A CN104357480A (en) | 2015-02-18 |
| CN104357480B true CN104357480B (en) | 2017-09-19 |
Family
ID=52524788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410628062.7A Active CN104357480B (en) | 2014-11-10 | 2014-11-10 | Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357480B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108330165B (en) * | 2017-09-06 | 2021-10-01 | 中央民族大学 | LAMP primer composition, kit, method and application for detecting traditional Chinese medicine cistanche |
| CN109679991B (en) * | 2019-01-18 | 2020-11-03 | 马鞍山师范高等专科学校 | Transgenic plant with increased phenylethanoid glycoside content and production method thereof |
| CN113215191B (en) * | 2021-04-26 | 2022-12-23 | 华南农业大学 | Agrobacterium-mediated genetic transformation method for toona sinensis |
| CN116162644B (en) * | 2022-07-07 | 2024-04-05 | 昆明理工大学 | New application of phenylalanine ammonia lyase gene pal |
-
2014
- 2014-11-10 CN CN201410628062.7A patent/CN104357480B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| Genbank accession number:AF401636.1;Yun, S.J., et al.;《Genbank》;20100414;1-2 * |
| H. Ling, et al..Progress in Medicinal Plant Rehmannia glutinosa:Metabolite Profiling, Tissue Culture, Growth and Its Regulation, and Functional Genomics.《Russian Journal of Plant Physiology》.2009,第56卷(第5期),654-662. * |
| Induction of Phenylalanine Ammonia-Lyase Gene Expression by Paraquat and Stress-related Hormones in Rehmannia glutinosa;Byoung Kook Lee, et al.;《Mol. Cells》;20031231;第16卷(第1期);34-39 * |
| 臧亚超.地黄扩展蛋白基因RgExpA1的克隆及遗传转化体系的优化.《中国优秀硕士学位论文全文数据库 农业科技辑》.2012,(第8期),D047-84. * |
| 边宝林等.5种不同药材中毛蕊花糖苷的含量比较.《中国中药杂志》.2010,第35卷(第6期),739-740. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104357480A (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104357480B (en) | Turn the method that RgPAL1 genes improve acteoside content in glutinous rehmannia | |
| Bansal et al. | Influence of Agrobacterium rhizogenes strains on hairy root induction and ‘bacoside A’production from Bacopa monnieri (L.) Wettst. | |
| CN109295080A (en) | Panax japonicus majoris β-amyrin synthase gene Pj β-AS purposes | |
| CN111378777A (en) | Primer set for identifying crude drug and crude drug identification method using the same | |
| CN108291210A (en) | The method of production and purifying containing nucleic acid compositions | |
| CN103834728B (en) | Expand method and the primer of endogenetic fungus ITS gene in plant tissue | |
| CN104928260B (en) | A kind of infectious bovine rhinotrachetis virus IBRV-JN03 separation strains and its application | |
| CN101445827B (en) | Nucleotide sequence and method for identifying radix cyathulae genunie medicinal materials | |
| CN103109740A (en) | New strain breeding method of high-quality purple perilla | |
| CN102876713B (en) | Method for improving content of rosmarinic acid and salvianolic acid B in salvia miltiorrhiza bunge while transforming genes | |
| CN106148453B (en) | A method of utilizing hairy production acteoside of glutinous rehmannia | |
| CN102061297B (en) | Transgenic method for improving salvianolic acid B content in root of red-rooted salvia | |
| CN103834685A (en) | Carrier capable of simultaneously improving rosmarinic acid and salvianolic acid B content of red sage root and use thereof | |
| CN103045747B (en) | Molecular detection primer for sweet potato black rot germs and application of molecular detection primer | |
| CN108265065A (en) | A kind of recombination 1 allergoid albumen of artemisia annua and its application | |
| CN101899435A (en) | High-throughput extraction method for sugarcane leaf genome by using ball mill | |
| CN102094003A (en) | Method for extracting DNA (deoxyribonucleic acid) of activated carbon biomembrane | |
| CN113170792A (en) | Preparation of nano prodigiosin preparation and application of nano prodigiosin preparation in prevention and treatment of vegetable economic crop virus diseases | |
| CN105018612A (en) | Quantitative detection method of garlic virus | |
| CN109679991B (en) | Transgenic plant with increased phenylethanoid glycoside content and production method thereof | |
| CN109457023B (en) | Gene combination for identifying sex of gleditsia sinensis, SSR primer combination, identification method and application | |
| CN105200057A (en) | Method for increasing contents of phenol compounds in plants by virtue of miR397a | |
| CN105219848A (en) | For differentiating primer and the application thereof of tapiscia sinensis sex | |
| CN111979352A (en) | System for detecting pinellia ternata infecting virus by mRT-PCR and application thereof | |
| CN105368831B (en) | Mutually chain molecular labeling and its preparation method with the resistance to bolting gene of cabbage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180208 Address after: 243100 Anhui city of Ma'anshan province Dangtu County Industrial Park Patentee after: Maanshan Tianfukang Pharmaceutical Co., Ltd. Address before: 243002 Anhui province Ma'anshan Huashan Lake District Road No. 59 Patentee before: Anhui University of Technology |
|
| TR01 | Transfer of patent right | ||
| CP03 | Change of name, title or address |
Address after: 243000 Dangtu Industrial Park, Ma'anshan City, Anhui Province Patentee after: Anhui taienkang Pharmaceutical Co., Ltd Address before: 243100 Anhui city of Ma'anshan province Dangtu County Industrial Park Patentee before: MAANSHAN TIANFUKANG PHARMACEUTICAL Co.,Ltd. |
|
| CP03 | Change of name, title or address |