CN104313164A - A method for identifying the complete set of chromosomes of cotton D genome and D sub-genome - Google Patents

Abstract

The invention belongs to the field of molecular cytogenetics, in particular to a method for identifying a complete set of chromosomes of cotton D genome or D sub-genome. The method comprises the step of performing fluorescence in situ hybridization on cotton genome DNA by using the sequence shown in SEQ ID No.1 as a probe. Using this sequence as a probe, and using the mitotic metaphase chromosomes of Upland cotton, Asian cotton and Raymond gossypium as target DNA, fluorescence in situ hybridization was performed. There were obvious hybridization signals on the chromosomes of the D genome of D., and the signals were distributed on all chromosomes, but there were no obvious signals in the A subgenome chromosome of upland cotton and the A genome chromosome of Asian cotton. By using the sequence in the present invention and using the FISH method, the complete set of chromosomes of cotton D genome or D subgenome can be quickly identified.

Description

A method for identifying the complete set of chromosomes of cotton D genome and D sub-genome

technical field

The invention belongs to the field of molecular cytogenetics, in particular to a method for identifying a complete set of chromosomes of cotton D genome and D sub-genome.

Background technique

Cotton is divided into 52 cotton species, including A, B, C, D, E, F, G and K8 chromosome groups. Today, the main cultivated species of cotton in the world are tetraploid cotton species upland cotton (AD) and sea island cotton (AD), which account for about 95% and 5% of the cultivated area respectively. At present, the genome sequencing of group A cotton species Cotton chinensis and D group cotton species Raymond has been completed (Wang et al., 2013; Li et al., 2014). The comparative study of cotton A and D genomes will be of great help to the evolution research of tetraploid cotton and cotton breeding. Fluorescence in situ hybridization technology was born in the 1960s, and its appearance opened a new era of cell and molecular biology. Subsequently, the fluorescence in situ hybridization technology has been continuously improved and innovated, and now the technology has made great breakthroughs in sensitivity and accuracy.

In classical cytogenetics, the recognition and identification of cotton chromosomes are mainly carried out by analyzing the relative length of chromosomes, arm ratio and satellite and other characteristics. However, in actual experiments, different types of reagents, different concentrations and differences in treatment time often lead to different degrees of shortening of chromosomes. In addition, the size of cotton chromosomes is small, the difference between chromosomes is not large, and the centromere is not easy. Factors such as discrimination make it difficult to obtain ideal and reliable results by relying on chromosome morphological features to identify chromosomes. The same is true for the identification of chromosomes between different groups of cotton. The size of chromosomes between different groups of cotton is not much different. For example, the chromosomes of cotton group A are generally larger than those of group D, but the longest chromosome of group D is shorter than that of group A. Chromosomes are long, so it is difficult to identify group A and D chromosomes in tetraploid cotton species.

Contents of the invention

The purpose of the present invention is to provide a kind of method of distinguishing cotton D genome and D sub-genome complete set of chromosomes.

The present invention first obtains a sequence of about 2kb (sequence information SEQ ID No.1), which has a high number of repetitions in the cotton D genome, and is diffusely distributed on the entire set of chromosomes in the D genome, while in the cotton A genome The number of repeats in the genome is low.

Using this sequence as a probe, the hybridization test was carried out on the chromosomes of different cotton species in the mitotic metaphase. The results showed that: in the tetraploid cotton species, the complete set of chromosomes in subgroup D of upland cotton and in the D group cotton species of Raymond cotton Signals were shown on all chromosomes, and the signals were distributed on all chromosomes, but there were no signals on the chromosomes of the A subgenome chromosome and the Asian cotton species of group A cotton.

SEQ ID No.1:

TCTTTTTATTCTTATTATCCTTGATAATTTATTCATTTTGAGCTATGCTCTCAAAT

CAATTCTATTTTTATCCATCGTTATGATCTTTTTGCAAGCATGTTGCATTAGAAT

AATGATTAATGGACTAATAAAACTTTTCACAAAGGAAGTTTTGCATATTACTCT

AGAAGTTTCTAAATAATAGGAACCTGAAACAGGACTATTGTTTAGAAAAC

ACCAAGTTTAAAGGTGAAAAAATCTAAGAAGGAAAAGTCTAAATTAAGACTAT

CCTTTCAGATTTTGTTGTCAAAAACATTGATTGAACAAAATGACAAGATGTCGT

GTTGGTGACAAAGCTTCAATGAACAAACAAGCAATGATCACCAAGCAATAAG

AAAAGGTTTTCTTGGAGAAAAAAATTCTTCATTTGTGCATGAGCATTTGGTAT

GACACCCTGGGAATGGTGTAAAGGACCAAAGAGTTTCACATTCTGTATCCTTG

AATTGCGATAGGAGAGGATTGAGAAAAAAGCCAAATTTTTCTACCCTTGGGTTA

CAGTGGGAGAAAGATGGTACAAAATTTTGCGTCCCAGTGGATTAAACTTTGAAG

TTTACAGTGGGGGGCAATCTGATTAAGTGTTTCTTTGGAGATGCCAGCCGAGC

AAGAAGGCGTTGTAACACATCAGTGATAAAACCTTAATAAACTTTGAGTAATA

AAAACACAAAACAAAAAAGTATCATTATAATGACATTCTGCATTCATTCAAATA

TCATTCATACACATCTAGTTAGGAGCATTTGATTCATTCTGATCATGACATCCT

AATCACTAGGCATAATTAGGTTCATAAAATGGATTATACAGGTCATGTTCCCC

AGAGAACAGATCAGTGAAGATACAAATCTTGCCTCCCTGAACTGACAGTGGA

GTAGATTGAAGACACCAAATCTTATCTTCCTGAATTGAAGTGGAGCAGATTGA

AGATAGCAGATCTTATCTTCCTGAATTGGCAGTGGAGTAGATCGAAGATACCA

AATCTTGTCTCCCCTGAATTGGAGTGGAGCAGATTGAAGATAGCAGATCTTATC

TCCCTGAGTTGAAGTGGAGCAGATCGAAGATAGCAGATCTTTATCTTCCTAAAT

TGGCAGTGAAGTAGATCGAAGATAGCAAAATCTTATCTCCCTGAGTTGCAGTGG

AGTAGATTGAAGATAGCAGATCTTTATCTCCCTGAACTGTAGTGGAGTAGATCG

AAGATAACAGATCTTTATCTCCCTGAGTTGTAGTGGAGCAGATTGAAGATAGTA

GATCTTTATCTCCCTGAGTTGACAGGGAAGTAGATTGAAGACACAAATCTTATC

TCCCTAAGCTGTAGTGGAGTAGATCGAAGAAAGCAGATCTTGTCTTCCTGAAC

TGGCAGTGAAGCAGATCGAAGACAGTAAATTTTACCTCCCTGAGTTGCAGTGG

AGTAGATTGAAGACAGCAGTTCTTGTCTCCCCTGAGTAGTAGTGGAGTAGATTG

AAGATACCAGATCTTGTCTCCCCTAAATTGGCGGGGAGCAGATCGAAGATGGC

AAATCTTACCTCCCTGTATTGACAGTGGAGTAGATTGAAGATAAAAAGATCTTG

TCTCCCTAAGCTGTAGTGGAATAGATTGAAGATAGCAGATCTTGTCTCCCCTAA

GCTGTAGTGGAGCAGATCGAAGACAGCAAATCTTACCTCCCTAAGTTTGCAGC

GGAGTAGATTGAAGCAACAAATCCTATCTCCCCTGGGCTGGAGTGGAATAGATT

GAAGATAACAGATCTTGTCTTTCCTAAACTGGAGTGAAGCAGATCGAAGACAA

CAGATCTTATCTCCCTGAAGTGGCAGTGGAGTAGATTGAAGTCTTTTTATTCTTA

TTATCCTTGATAATTTATTCATTTTGAGCTATGCTCTCAAATCAATTCTATTTTA

TCCATCGTTATGATCTTTTTGCAAGCATGTTGCATTAGAATAATGATTAATGGA

CTAATAAAACTTTCACAAAGGAAGTTTTGCATATTACTCTAGAAGTTTCTAAA

TAATATAGGAACCTGAAACAGGACTATTGTTTAGAAAAACACCAAGTTTAAAG

GTGAAAAAATCTAAGAAGGAAAAGTCTAAATTAAGACTATCCTTTTCAGATTTTG

TTGTCAAAAACATTGATTGAACAAAATGACAAGATGTCGTGTTGGTGACAAAGC

TTCAATGAACAAACAAGCAATGATCACCAAGCAATAAGAAAAGGTTTTCTTG

GAGAAAAAAATTCTTCATTTGTGCATGAGCATTTGGTATGACACCCTGGGAAT

GGTGTAAAGGACCAAAGAGTTTCACATTCTGTATCCTTGAATTGCGATAGGAG

AGGATTGAGAAAAAAGCCAAATTTTTCTACCCTTGGGTTACAGTGGGAGAAAG

ATGGTACAAATTTTGCGTCCCAGTGGATTAAACTTTGAAGTTTACAGTGGGGG

GCAATCTGATTAAGTGTTTCTTTGGAGATGCCAGCCGAGCAAGAAGGCGTTGT

AACACATCAGTGATAAAACCTTAATAAACTTTGAGTAATAAAAACACAAACA

AAAAAGTATCATTATAATGACATTCTGCATTCATTCAAATATCATTCATACAC

ATCTAGTTAGGAGCATTTGATTCATTCTGATCATGACATCCTAATCACTAGGC

ATAATTAGGTTCATAAAATGGATTATACAGGTCATGTTCCCCAGAGAACAGAT

CAGTGAAGATACAAATCTTGCCTCCCTGAACTGACAGTGGAGTAGATTGAAG

ACACCAAATCTTATCTTCCTGAATTGAAGTGGAGCAGATTGAAGATAGCAGAT

CTTATCTTCCTGAATTGGCAGTGGAGTAGATCGAAGATACCAAATCTTGTCTC

CCTGAATTGGAGTGGAGCAGATTGAAGATAGCAGATCTTTATCTCCCTGAGTTG

AAGTGGAGCAGATCGAAGATAGCAGATCTTTATCTTCCTAAATTGGCAGTGAA

GTAGATCGAAGATAGCAAAATCTTATCTCCCTGAGTTGCAGTGGAGTAGATTGA

AGATAGCAGATCTTATCTCCCTGAACTGTAGTGGAGTAGATCGAAGATAACAG

ATCTTTATCTCCCTGAGTTGTAGTGGAGCAGATTGAAGATAGTAGATCTTATCT

CCCTGAGTTGACAGGGAAGTAGATTGAAGACACAAATCTTATCTCCCTAAGCT

GTAGTGGAGTAGATCGAAGAAAGCAGATCTTGTCTTCCTGAACTGGCAGTGA

AGCAGATCGAAGACAGTAAATTTTACCTCCCTGAGTTGCAGTGGAGTAGATTG

AAGACAGCAGTTCTTGTCTCCCCTGAGTAGTAGTGGAGTAGATTGAAGATACCA

GATCTTGTCTCCCCTAAATTGGCGGGGAGCAGATCGAAGATGGCAAATCTTACC

TCCCTGTATTGACAGTGGAGTAGATTGAAGATAAAAAGATCTTGTCTCCCTAAG

CTGTAGTGGAATAGATTGAAGATAGCAGATCTTGTCTCCCTAAGCTGTAGTGG

AGCAGATCGAAGACAGCAAATCTTACCTCCCTAAGTTTGCAGCGGAGTAGATT

GAAGCAACAAATCCTATCTCCTGGGCTGGAGTGGAATAGATTGAAGATAAC

AGATCTTGTCTTTCCTAAACTGGAGTGAAGCAGATCGAAGACAACAGATCTTAT

CTCCCTGAAGTGGCAGTGGAGTAGATTGAAG

According to a specific embodiment of the present invention, the FISH method comprises the following steps:

1) Material collection and pretreatment: Soak the seeds in warm water for about 12 hours, and then culture them in a light incubator. When the roots grow to 1-2 cm, intercept the root tips and treat them with (25ppm) cycloheximide at 25°C for 2 hours. Then rinse with distilled water once, and fix with 95% ethanol: glacial acetic acid (3:1) fixative solution for 2h to 24h;

2) Enzymatic hydrolysis: take out the fixed root tip, wash it once with distilled water, and treat the root tip with a mixture of 2% cellulase and 1% pectinase at 37°C for 45 minutes;

3) Tablet production: use 60% acetic acid for tabletting, keep the good prepared tablets and store them at -80°C for more than 4 hours, then remove the cover sheet at -80°C, quickly dry them at 80°C, and store them at 60°C Dry in an oven for 10 hours, and finally store at 4°C for later use;

4) Labeled probes: the probes are labeled with the Dig-Nick Translation Mix system, primers are designed according to the sequence information of the 2kb special sequence, and the genomic DNA of Raymond cotton is amplified by PCR technology to obtain the target fragment, and then refer to the Roche company According to the instructions, first take 1 μL of the corresponding concentration of PCR products and dissolve them in ddH ₂ O to make 16 μL, then add 4 μL of Dig-Nick Translation Mix to mix, centrifuge briefly, then keep warm at 15°C for 90min, and finally incubate at 65°C for 10min to inactivate The enzyme activity in the system was finally stored at -20°C for future use.

5) Fluorescence in situ hybridization was carried out, and the specific procedure was referred to the method of Wang Chunying et al. (2001).

6) Fluorescence microscope observation, using a Zeiss fluorescence microscope to observe fluorescence signals, and using Zeiss-Isis imaging system software to acquire, collect and process fluorescence in situ hybridization images. The pictures were processed with Photoshop drawing software.

FISH technology is a good method to study the structure of chromosomes and the evolutionary relationship between chromosomes. At present, this technology is widely used in the research fields of karyotype analysis, gene localization, construction of physical map, comparative mapping and evolution. The method for discriminating cotton D genome and D sub-genome full set of chromosomes provided by the present invention can be used as a genetic marker at the genome level between species, which plays an important role in the study of the differentiation of cotton within or between species and the evolution of the cotton genome. Cotton genetic evolution research and cotton breeding are also of great significance.

Description of drawings

Figure 1 Using the 2kb specific sequence as a probe (red), the fluorescence in situ hybridization of the mitotic metaphase chromosomes of upland cotton ((AD) ₁ ), Asian cotton (A ₂ ), and Raymond cotton (D ₅ ) hybrid image. A: Photos of Asian cotton metaphase chromosome hybridization. B, C: Photos of metaphase chromosome hybridization of upland cotton. D: Photos of hybridization of metaphase chromosomes in Raymond cotton. Chromosomes are shown in blue. Bar=5μm

It can be clearly seen from the photos that there is no red signal on the 26 chromosomes of Asian cotton (group A cotton species), red signals can be detected on the 26 chromosomes of Raymond cotton (group D cotton species), and tetraploid Among the 52 chromosomes of upland cotton in cotton, 26 large chromosomes have no red signal, and the remaining 26 chromosomes have red signal.

Detailed ways

Example 1 Using the 2kb sequence as a probe, respectively hybridize upland cotton (AD) ₁ , Asian cotton A ₂ , and Raymond cotton D ₅ metaphase division chromosomes

1 Materials and methods

1.1 Experimental materials

The experimental materials were tetraploid upland cotton Zhongmiansuo No. 12, Hongxing grass cotton and Raymond's cotton (wild cotton) D5-2, all from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

1.2 Experimental method

1) Obtained a sequence of about 2kb through bioinformatics, which has a high number of repetitions in the D genome, and is diffusely distributed on the entire set of chromosomes in the D genome, but has a very low number of repetitions in the A genome . According to the primers involved in the 2kb special sequence, the genome DNA of Raymond cotton is amplified by PCR technology to obtain the target fragment. The primer information is:

Upstream primer: TTCTATTTTTATCCATCGTTATG

Downstream primer: GGAGATAGGATTTGTTGCT

2) Material collection and pretreatment: soak the seeds of three cotton species in warm water for about 12 hours, and then cultivate them in a light incubator. When the roots grow to 1-2 cm, intercept the root tips and use (25ppm) cycloheximide 25 Treat at ℃ for 2 hours, then wash once with distilled water, fix with 95% ethanol: glacial acetic acid (3:1) fixative solution for 2 hours to 24 hours;

3) Enzymatic hydrolysis: take out the fixed root tip, wash it once with distilled water, and treat the root tip with a mixture of 2% cellulase and 1% pectinase at 37°C for 45 minutes;

4) Tablet preparation: use 60% acetic acid to press the enzymatically hydrolyzed root tip, and keep the good preparation at -80°C for more than 4 hours, then remove the cover at -80°C, and quickly place it at 80°C Dry it in an oven at 60°C for 10 hours, and finally store it at 4°C for later use;

5) Labeling of probes: The probes are labeled with the Dig-Nick Translation Mix system. Referring to Roche’s instructions, first dissolve 1 μL of the corresponding concentration of PCR product in ddH2O to make 16 μL, then add 4 μL of Dig-Nick Translation Mix to mix, centrifuge briefly, then incubate at 15°C for 90 minutes, and finally incubate at 65°C for 10 minutes to extinguish The enzyme activity in the living system was finally stored at -20°C for future use.

6) Fluorescence in situ hybridization process, refer to the method introduced by Wang Chunying et al. (2001). Biotin-labeled probes were observed under a fluorescence microscope to appear yellow-green. Chromosomes stained with DAPI under a fluorescent microscope showed blue.

7) Fluorescence microscope observation, using a Zeiss fluorescence microscope to observe fluorescence signals, and using Zeiss-Isis imaging system software to acquire, collect and process fluorescence in situ hybridization images. The pictures were processed with Photoshop drawing software. 2 Experimental results

The experimental results show that it can be clearly seen from the photos that there is no red signal on the 26 chromosomes of Asian cotton (group A cotton species), and red signals can be detected on the 26 chromosomes of Raymond cotton (group D cotton species). Among the 52 chromosomes in tetraploid cotton upland cotton, 26 large chromosomes (subgroup A chromosomes) have no red signal, and the remaining 26 chromosomes (subgroup D chromosome) have red signal.

Claims (1)

1. a method for discriminating cotton D genome and D sub-genome complete set of chromosomes, it is characterized in that, described method comprises the step that fluorescent in situ hybridization is carried out to cotton genome DNA as probe with the sequence shown in SEQ ID No.1.