CN104232753A - 17beta-hydroxylase deficiency related gene mutation detecting kit - Google Patents
17beta-hydroxylase deficiency related gene mutation detecting kit Download PDFInfo
- Publication number
- CN104232753A CN104232753A CN201410347940.8A CN201410347940A CN104232753A CN 104232753 A CN104232753 A CN 104232753A CN 201410347940 A CN201410347940 A CN 201410347940A CN 104232753 A CN104232753 A CN 104232753A
- Authority
- CN
- China
- Prior art keywords
- probe
- hydroxylase deficiency
- gene mutation
- test kit
- associated gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention relates to a 17beta-hydroxylase deficiency related gene mutation detection and sample preparation kit and particularly relates to a 17beta-hydroxylase deficiency related gene detecting product applied to a massively parallel sequencing platform technology. A method for capturing and re-sequencing a novel target by using the kit comprises the following steps of A, uniquely designing and preparing a capturing probe for all exon fragments of a gene CYP17A1; B, designing a unique adapter with a tagged sequence; C, carrying out PCR (polymerase chain reaction) amplification on the sequence of the probe by using a universal primer; and D, capturing a uniquely-designed mixed target fragment. Massively parallel sequencing platform samples prepared by using the method and the kit are high in flux, the efficiency is high, the method is simple and convenient to operate, and the sequencing and detecting costs are greatly reduced.
Description
Technical field
The invention belongs to biology field, relate to medical diagnosis and biotechnology, relating to a kind of external diagnosis reagent case detecting 17α-hydroxylase deficiency associated gene mutation, is a kind of a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation being applied to new-generation sequencing platform technology.Gene test: CYP17A1 gene.
Technical background
17α-hydroxylase deficiency is a kind of autosomal recessive hereditary diseases, in the adrenal,congenital hyperplasia of China Report, is not the most rare a kind of type.Clinical main manifestations is low renin hypertension, hypokalemia, Female sexual naivety, primary amenorrhea and androgynism.
Pathogenesis:
17 α-hydroxylase is the key enzyme in suprarenal gland and sexual gland in steroid hormone building-up process, expresses in suprarenal gland and sexual gland
[1], this enzyme belongs to mixed-function oxidase, has 17 α-hydroxylase and 17,20-lyase, two kinds of activity concurrently.Suprarenal gland 17 alpha-Hydroxylase deficiency can cause cortisol secretion to be obstructed, the negative feedback inhibition of hypophysis is weakened, ACTH hypersecretion, stimulate 11-Desoxycortone and Kendall compound to produce and increase, and deoxidation hydrocortisone plays mineralocorticoid activity, patient is made to produce low renin hypertension and hypokalemia.Goandal steroid hormone secretion is reduced in 46, XY male patient and causes the manlike deficiency of genitalia, gonadal dysplasia, and then shows as primary amenorrhea in 46, XX women, lacks Development in Puberty.
17α-hydroxylase deficiency is the 17 alpha-Hydroxylase deficiency because CYP17A1 gene unconventionality causes.CYP17A1 gene is positioned at karyomit(e) 10q24.3, and the CYP17A1 transgenation of bibliographical information, more than 50 kinds, can cause 17 α-hydroxylase/17,20-lyase defect or 17,20-independent lyase defects.Wherein, c.1517_1525del c.985_987delinsAA deletion mutantion and 6 exons suddenly change 8 exons is Chinese modal mutation type, it is reported, the patient of about 90% comprises the sudden change of above-mentioned at least one.
Perfect form 17α-hydroxylase deficiency, i.e. 17 α-hydroxylase/17,20-lyase defect, its typical clinical manifestations comprises primary amenorrhea and secondal sexual character dysplasia in pubescence, patient has hypertension in various degree, and the hypertension incidence age comparatively early, and medicine controls not good, and some patients has the family history of disease.Serum estradiol, testosterone, hydrocortisone and blood potassium significantly reduce, and lutropin, follicular stimulating hormone and thyroliberin all raise
[2].
For forme fruste 17α-hydroxylase deficiency patient, it is different that they are subject to sexual hormoue effect, as 46, XX patient can occur breast development, infrequent menstruation or secondary amenorrhea, multiple ovarian cysts etc. in pubescence, serum progesterone or 17 α hydroxyprogesterone levels raise.Hypokalemia and hypertension may not be there is in patient
[2].
The method traditional for the differential diagnosis of 17α-hydroxylase deficiency mainly relies on biochemical analysis and imaging examination.Blood bio-chemistry checking: ACTH level, blood hydrocortisone, progesterone, twenty-four-hour urine free cortisol level, blood potassium, gonad-stimulating hormone, gonadal hormone etc.There is very large shortcoming in these means: as mentioned above. check of a great variety; Operate. sensitivity and specific degree low; Every detection any one is all subject to the impact of the factor such as medicine and mental status above; And harsh to requiring detection time, not can be checked at any time.
The advantage of gene diagnosis is:
1. convenience, safety is quick: only to extract 2-4 milliliter blood;
2. can check any time;
3. not dietary restriction, take medicine, any physical appearance can detect;
4. compare repeatedly, multinomial tradition checks, more economical;
5. premorbid, the sole mode of disease pole early diagnosis;
6. source is made a definite diagnosis, one-time detection, is benefited all the life.
Everything is disclosed gene diagnosis huge application prospect clinically.
In recent years, the parallel order-checking platform of extensive DNA (massively parallel DNA sequencing platform) has developed into the sequencing technologies of main flow, one of percentage before the appearance of this sequencing technologies has not only made DNA sequencing expense drop to, also allows this " privilege " being specific to large-scale order-checking center in the past of gene order-checking can be shared by numerous researchist.
But directly use the cost of the parallel order-checking detection of platform of extensive DNA still to make individual be difficult to bear at present.The present invention can catch the accurate selectivity of 17α-hydroxylase deficiency genes involved of multiple even tens patients simultaneously, then for large scale sequencing platform, greatly can reduce the cost of gene diagnosis, and making it to be widely used in clinically becomes possibility.
Summary of the invention
The object of the invention is, the test kit that a kind of target acquistion detecting 17α-hydroxylase deficiency associated gene mutation is checked order again is provided.This test kit improves the flux of the flux order-checking parallel with gene of gene trap, easy and simple to handle, cost is low.
For achieving the above object, the present invention adopts the probe of the non-coding region of catching the whole exon fragment of object CYP17A1 gene and contiguous 50bp; For the universal primer of the fragment to be measured that increases; Sequence measuring joints sequence; Damping fluid; DNTP; Exo+ polymerase; Strepavidin magnetic beads.The technical solution used in the present invention is: a kind of new target acquistion sequence measurement again, comprises the following steps:
A. design and for the preparation of the probe of catching 17α-hydroxylase deficiency associated gene mutation.And these probes are combined on magnetic bead, film or slide.Probe sequence is shown in sequence table.
B. by testing gene DNA sample, fragmentation is to 200-400bp respectively, and then by end-filling, the ATP added makes fragment two ends introduce sticky end.
C. Illumina company is added respectively
the one end designed in DNA Sample Prep Kit, with the joint sequence fragment of sequence label, adds ligase enzyme, make each fragment with pair of joint be connected, form new fragment.
D. temperature of reaction is regulated to activate archaeal dna polymerase, with a pair Illumina company
index Kit-PCR primers universal primer, fragment sequence step c gained different genes group being completed to connection mixes laggard performing PCR amplified reaction;
E. the capture probe designed by the pcr amplification reaction product of whole for steps d gained sample and step a is hybridized, then through repeatedly eluting reaction, obtain fragment to be measured.
F. fragment to be measured is carried out extensive parallel order-checking by the standard scheme of illumina company Miseq sequenator.
G. the sequencing result obtained is compared with standard database, obtain diagnostic result.
For realizing technique scheme, the capture probe described in steps A is thymus nucleic acid (DNA), or Yeast Nucleic Acid (RNA) composition, but is not limited only to DNA and RNA.Probe is forming with the fragment of target complementation of 120bp.Probe can be combined on magnetic bead, also can be combined on slide glass, but is not limited only to these media.Strepavidin magnetic beads material is Al-Ni-Co series permanent magnet alloy or barium ferrite, Nd-Fe-Bo permanent magnet material, Nd-Fe-Bo permanent magnet material, rubber magnet, but is not limited only to these materials.
Wherein, the capture probe described in steps A, comprises the sequence covered within the scope of the whole encoded exon fragment of following gene SCNN1B and SCNN1G and two ends 50bp.These probes design with stacked tile type, and fragment length is 50bp-180bp, and optimum is 75bp; Fragment length is 60bp-200bp, and optimum is 80bp; Fragment length is 65bp-220bp, and optimum is 85bp; Fragment length is 70bp-240bp, and optimum is 90bp; Between probe, lap is 5-20bp, and optimum is 8bp; The probe coverage of target area base is 1 × to 10 ×, optimum is 3 ×.
Major advantage of the present invention is:
1. the present invention can carry out the detection of the whole 17α-hydroxylase deficiency genes involved of multiple different sources sample in once sequencing reaction simultaneously; Full sequence is directly measured, and accuracy rate can reach 99.99%.
2. test kit of the present invention once can complete the parallel of 1-48 sample and catches, and improves capture rate, significantly reduces the cost of preparation of samples.
3. test kit of the present invention once can complete whole Liddle ' s genes involveds of 1-1152 sample, and the Parallel testing of nearly 4000 sequences, makes full use of the high-throughput characteristic of equipment, greatly reduces the order-checking cost of each sample.
4. test kit of the present invention primary first-order equation can differentiate missense, insertion and deletion mutantion simultaneously.Considerably increase clinical recall rate and accuracy.
5. detection method step of the present invention is simple, reduces the link of repetitive operation, thus avoids in complex operations process the many uncertain primer existed, improve Detection accuracy and stability.
6. detection method required time provided by the present invention is less than the sequencing technologies of sanger method greatly.
Example: complete same detection limit (detection limits of 100 person-portions), sanger method needs 2 manually to work one week simultaneously.Our method only needed a people to complete whole detection limits in one day.
7. the accuracy detected is better than biochip technology greatly, more meets clinical detection requirement.Gene chip can only detect base missense mutation, and insertion and deletion mutantion cannot detect simultaneously.Our method can detect the transgenation of missense, insertion, disappearance and variable sheer simultaneously.
Accompanying drawing explanation
Fig. 1 is target area sequence and probe.A is VITAMIN B4; T is thymus pyrimidine; C is cytosine(Cyt); G is guanine
Fig. 2 is target area sequence.
Fig. 3 is order probe.
embodiment
Be only describe the citing of practical application of the present invention by embodiment below, practical application of the present invention is not limited only to following examples:
Embodiment one,
One, probe design:
By the probe of table synthesis Streptomycin sulphate mark.Probe solution adopts the SureSelect buffering system system of agilent company.
Two, genome extracts:
Qiagen FlexiGene DNA Kit (Code No:51204) is adopted to carry out extracting 96 increments to be measured genome originally, OD
260/280value reaches 1.8-2.0, respectively gets 1-3g as starting template.
Three, sample preparation before order-checking
1. goal gene fragmentation:
Get the 270 parts of genomic dnas quantitatively crossed, be diluted to 20-35ng/L.Get 130L, carry out fragmentation respectively with Ultrasonic Cell Disruptor.
2.AMpure XP fragmentation is selected
1. get 96 orifice plates, after adding 80-100L magnetic bead, then add sample DNA, pipettor blows and beats mixing repeatedly;
2. 5min placed by mixed solution 26 DEG C;
3. 96 orifice plates are rested on 3min on magnetic sheet;
4. carefully pipette whole supernatant in new hole, carefully do not encounter magnet ring;
5. in the supernatant moving to new bore, add 100-150L magnetic bead again, pipettor is blown and beaten repeatedly, fully mixes;
6. 5min placed by mixed solution 26 DEG C;
7. 96 orifice plates are rested on 3min on magnetic sheet, carefully remove supernatant;
8. add 70% ethanol 200L, leave standstill 30s, carefully remove supernatant;
9. repeating step 8 operates once;
10. 96 orifice plates are taken off from magnetic sheet, uncovered placement, ethanol is fully volatilized;
11. add 40L10mMpH=8.0Tris-HC1, and pipettor blows and beats mixing repeatedly;
96 orifice plates are rested on 1min on magnetic sheet by 12., become clear to solution;
13. carefully pipette supernatant in new PCR pipe, obtain the genomic dna after purifying.
3. the concordant and purifying of end
1. get 96 orifice plates, shown according to the form below, ice chest adds all ingredients, keep ice bath state.
| Reagent | Each reaction consumption (L) |
| DNA?sample | 19 |
| 10x?Blunting?Buffer | 2.5 |
| 1mM?dNTP?Mix | 2.5 |
| Blunt?Enzyme?Mix | 0.5 |
| Nuclease-Free?Water | 0.5 |
| Total reaction system | 25 |
2. in PCR instrument (50 DEG C, heat lid), hatch 20min for 12 DEG C, then hatch 15min for 37 DEG C;
3. get 96 orifice plates, first add the magnetic bead 45L of fully mixing, then add sample, pipettor piping and druming mixing;
4. mixed solution 26 DEG C, leaves standstill 5min;
5. 96 orifice plates are placed on magnetic sheet, leave standstill 3min, abandon supernatant;
6. add 70% ethanol 200L, leave standstill 30s, abandon supernatant;
7. repeating step 6, then wash one time;
8. 96 orifice plates are taken off from magnetic sheet, uncovered placement, ethanol is fully volatilized;
9. add 40L10mM pH=8.0Tris-HCl, pipettor blows and beats 10 mixings;
10. 96 orifice plates are placed on magnetic sheet, leave standstill 1min; Carefully pipette in supernatant to clean PCR pipe for subsequent use.
4. joint connects and purifying
1.Oligo uses pH=7.560mM Tris-HCl (containing 150mM NaCl) respectively, is diluted to 400M; Shown according to the form below, preparation joint working fluid:
2. two oligo of mole each joint of mixing such as grade, after mixing, open PCR instrument, the program of setting is 95 DEG C and hatches 2min, is cooled to 20 DEG C, cooling per second 0.1 degree, and after program completes, place on ice, packing ,-20 DEG C are frozen;
3. get PCR pipe, shown according to the form below, ice chest adds all ingredients, keep ice bath state;
| Reagent | Each reaction consumption (L) |
| DNA?sample | 15 |
| 2x?Quick?ligation?Reaction?Buffer | 25 |
| Adapter?oligo?mix?AP(200uM) | 2 |
| PE-AP(200uM) | 2 |
| Quick?T4?DNA?ligase | 1.2 |
| Nuclease-free?Water | 4.8 |
| Cumulative volume | 50 |
4. to be put in Thermo comfort 25 DEG C and to hatch 15min;
5. get 96 orifice plates, first add the magnetic bead 90L of fully mixing, then add sample, pipettor piping and druming mixing;
6. mixed solution 26 DEG C, leaves standstill 5min;
7. 96 orifice plates are placed on magnetic sheet, leave standstill 3min, abandon supernatant;
8. add 70% ethanol 200L, leave standstill 30s, abandon supernatant;
9. repeating step 8, then wash one time;
10. 96 orifice plates are taken off from magnetic sheet, uncovered placement, ethanol is fully volatilized;
11. add 40L10mM pH=8.0Tris-HCl, and pipettor blows and beats 10 mixings;
96 orifice plates are placed on magnetic sheet by 12., leave standstill 1min, carefully pipette in supernatant to clean PCR pipe for subsequent use.
5. gap repair and purifying
1. get PCR pipe, shown according to the form below, ice chest adds all ingredients, keep ice bath state.
| Component | Volume (L) |
| GDNA after jointing | 40 |
| 10x?ThermoPol?Reaction?Buffer | 5 |
| 10mM?dNTP?mix | 1 |
| Bst?DNA?Polymerase，Large?Fragment | 2.5 |
| Nuclease-free?Water | 1.5 |
| Cumulative volume | 50 |
On 2.PCR instrument, (50 DEG C, heat lid) 37 DEG C hatches 15min;
3. get 96 orifice plates, first add the magnetic bead 90L of fully mixing, then add sample, pipettor blows and beats 10 mixings;
4. mixed solution 26 DEG C, leaves standstill 5min;
5. 96 orifice plates are placed on magnetic sheet, leave standstill 3min, abandon supernatant;
6. add 70% ethanol 200L, leave standstill 30s, abandon supernatant;
7. repeating step 6 washes one time again;
8. 96 orifice plates are taken off from magnetic sheet, uncovered placement, ethanol is fully volatilized;
9. add 40L10mM pH=8.0Tris-HCl, pipettor blows and beats 10 mixings;
10. 96 orifice plates are placed on magnetic sheet, leave standstill 1min, carefully pipette in supernatant to clean PCR pipe for subsequent use;
11. get 2L Qubit2.0 carries out quantitatively.
6. amplified library (Herculase II Fusion DNA Polymerases)
1. in super clean bench, prepare PCR reaction system, get PCR pipe, shown according to the form below, ice chest adds all ingredients, keep ice bath state, after preparing system, mix gently with pipettor;
2.PCR amplification condition
7. magnetic beads for purifying PCR primer
1. get 96 orifice plates, first add the magnetic bead 90L of fully mixing, then add sample, pipettor blows and beats 10 mixings;
2. mixed solution 26 DEG C, leaves standstill 5min;
3. 96 orifice plates are placed on magnetic sheet, leave standstill 3min, abandon supernatant;
4. add 70% ethanol 200L, leave standstill 30s, abandon supernatant;
5. repeating step 4, then wash one time;
6. 96 orifice plates are taken off from magnetic sheet, uncovered placement, ethanol is fully volatilized;
7. add 40L10mM pH=8.0Tris-HCl, pipettor blows and beats 10 mixings;
8. 96 orifice plates are placed on magnetic sheet, leave standstill 1min; Carefully pipette in supernatant to clean PCR pipe for subsequent use;
9. get 2L Qubit2.0 quantitative, get 1L Agilent2200 and detect.
Four, designing probe is adopted to catch object fragment
(1) Library hybridization
1, the damping fluid of the Sureselect system of agilent company is adopted, preparing hybrid damping fluid:
| Reagent | Volume?for1capture(L) |
| Sureselect?hyb#1 | 25 |
| Sureselect?hyb#2 | 1 |
| Sureselect?hyb#3 | 10 |
| Sureselect?hyb#4 | 13 |
| Total | 49 |
2, mixed solution is caught in preparation:
1. PCR plate (PCR plate 1) is placed on ice, precooling;
2., according to the RNase Block diluent that the proportions of SureSelect RNase Block:Nuclease-free Water=1: 9 needs, place on ice, stand-by;
3., by reaction quantity, every sample well adds the SureSelect RNase Block (this part step 2 is prepared) of 5L dilution;
4., in each sample aperture of step 3, add the SureSelect Capture Library of 2L, and mix with liquid-transfering gun;
5. place on ice, for subsequent use.
3, with the Sureselect system preparation Sureselect Block Mix of agilent company:
| Reagent | Volume?for1reaction(L) |
| Sureselect?Indexing?Block#1 | 2.5 |
| Sureselect?Block#2 | 2.5 |
| Blocker?for?PE/SE | 0.6 |
| Total | 5.6 |
4, the sample library of target enrichment is prepared:
1. the B row in PCR plate 2, adds the ready sample library of 3.4L (concentration is 147ng/L);
2. arrange at the B of PCR plate 2, add the SureSelect Block Mix mixed solution of 5.6L, and mix up and down with liquid-transfering gun;
3. seal the B row of PCR plate 2, and place it in PCR instrument;
4. according to the form below carries out heating (105 DEG C of heat lids)
| Step | Temperature | Time |
| Step1 | 95℃ | 5min |
| Step2 | 65℃ | hold |
5. keep PCR plate 2 at 65 DEG C, add the Hybridization Buffer of 40L A row, sealing, after hatching at least 5min, carry out next step experiment again;
6. the SureSelect Capture Library Mix of PCR plate 1 is joined in PCR plate 2:
(1) arrange at the C of PCR plate 2, add the Capture Library Mix (PCR plate need keep 65 DEG C) of 7L;
(2) sealing lid;
Hatch 2min for (3) 65 DEG C;
7. get the Hybridization Buffer of 13L from A row, join in the SureSelect Capture Library Mix of C row (PCR plate need keep 65 DEG C);
8. the sample library mixed solution prepared in being arranged by B all joins in the hybridization solution of C row, mixes gently 8-10 time (PCR plate need keep 65 DEG C) with liquid-transfering gun;
9. with new glued membrane, PCR plate is sealed;
10. in PCR instrument (105 DEG C, heat lid), hybrid mixed liquid 65 DEG C is hatched 24h.
(2) magnetic bead is prepared
1., in 1.5ml centrifuge tube, add the Streptavidin T1 magnetic bead of 50L;
2. magnetic bead wash-out:
(1) the SureSelect Binding Buffer of 200L is added
(2) eddy mixer mixes 5s;
(3) centrifuge tube is placed on magnetic frame;
(4) supernatant is removed;
(5) again repeating step (1) to (4) twice, co-elute 3 times;
3. the SureSelect Binding Buffer adding 200L hangs magnetic bead again.
(3) carry out selective cross by SureSelecte system to catch
1., after incubation 24h, determine and record hybridization volume;
2. keep PCR plate in PCR instrument 65 DEG C, hybrid mixed liquid is directly joined in magnetic bead solution, put upside down mixing 3-5 time;
3. place hybridizing-catching on the mixer with the mixed solution of magnetic bead, incubation at room temperature 30min;
4. of short duration centrifugal;
5. be placed on magnetic frame, leave standstill 5min, remove supernatant;
6. add the SureSelect Wash Buffer#1 of 500L, whirlpool mixing 5s;
7. incubation at room temperature, altogether 15min, but need every 5min whirlpool mixing 5s;
8. of short duration centrifugal;
9. be placed on magnetic frame, leave standstill 5min, remove supernatant;
10. wash magnetic bead:
(1) the SureSelect Wash Buffer#2 of 500L 65 DEG C of preheatings is added, whirlpool mixing 5s;
(2) at 65 DEG C of incubation 10min, mix every 3min;
(3) of short duration centrifugal;
(4) be placed on magnetic frame, leave standstill 5min, remove supernatant;
(5) again repeating step (1) to (4) twice, co-elute 3 times;
The 11. SureSelect Elution Buffer adding 50L, whirlpool mixing 5s;
12. incubation at room temperature 10min, mix every 3min;
13. is of short duration centrifugal;
14. put on magnetic frame, leave standstill 5min;
Supernatant is transferred to new 1.5ml centrifuge tube (obtaining the DNA library of catching) by 15.;
16. add the SureSelect Neutralization Buffer of 50L in the DNA library of catching, and the mixing of of short duration whirlpool.
(4) with AMPure magnetic beads for purifying sample
1. add 180L magnetic bead to 1.5ml centrifuge tube, then add the DNA library that 100L catches, whirlpool mixes;
2. mixed solution 26 DEG C, incubation 5min;
3. centrifuge tube is placed on magnetic frame, leaves standstill 10min, abandon supernatant;
4. add 70% ethanol 500L, leave standstill 1min, abandon supernatant;
5. repeating step 4, then wash one time;
6. centrifuge tube is placed on 37 DEG C, incubation 5min, ethanol is fully volatilized;
7. add the Nuclease-free Water of 30L, whirlpool mixes, incubated at room 2min;
8. centrifuge tube is placed on magnetic frame, leaves standstill 3min;
9. carefully pipette in supernatant to new 1.5ml centrifuge tube for subsequent use.
(5) sample amplification is caught
In Bechtop, get PCR pipe, shown according to the form below, ice chest adds all ingredients, keep ice bath state;
| Reagent | Each reaction consumption (L) |
| Captured?DNA | 14 |
| Nuclease-free?water | 22.5 |
| 5X?Herculase?II?Run?Buffer(clear?cap) | 10 |
| 100mM?dNTP?Mix(green?cap) | 0.5 |
| Herculase?II?Fusion?DNA?Polymerase(red?cap) | 1 |
| PosHyb-PEF | 1 |
| PosHyb-PER | 1 |
| Total reaction system | 50 |
After preparing system, mix gently with liquid-transfering gun;
◆ pcr amplification condition
(6) AMPure magnetic beads for purifying PCR primer
1. add 90L magnetic bead to 1.5ml centrifuge tube, then add the PCR primer of 50L amplification, whirlpool mixes;
2. mixed solution 26 DEG C, incubation 5min;
3. centrifuge tube is placed on magnetic frame, leaves standstill 10min, abandon supernatant;
4. add 70% ethanol 500L, leave standstill 1min, abandon supernatant;
5. repeating step 4, then wash one time;
6. centrifuge tube is placed on 37 DEG C, incubation 5min, ethanol is fully volatilized;
7. add the Nuclease-free Water of 30L, whirlpool mixes, incubated at room 2min;
8. centrifuge tube is placed on magnetic frame, leaves standstill 3min;
9. carefully pipette in supernatant to new 1.5ml centrifuge tube for subsequent use;
10. get 1L Agilent2200 to detect;
11. to get 2ul Qubit2.0 quantitative.
Five, upper machine order-checking:
96 sample machine order-checkings on the Miseq of illumina company carries out.
Six, data analysis:
Data results carries out bioinformatic analysis by CLC Genomics Workbench7.0.
Seven, result:
By 1 order-checking, within 2 days, complete the examining order of 270 all 2 goal gene of sample, 170 sequences, order-checking sum reaches 459006.Carry out the parallel control of 2 genes with ABI3730x1, sudden change recall rate is 65%.And the order-checking sudden change recall rate of this programme reaches 88%, inspection accuracy rate 100%.
Sequence table:
| SP01 | GTGAGTTACAGCCTTTAGGTGCTACCCTCAGCCTGGGCTTCCCTCCAGGCCTGGCGCACCTTGATCTTCACTTTGAAAGA |
| SP02 | CCCTCAGCCTGGGCTTCCCTCCAGGCCTGGCGCACCTTGATCTTCACTTTGAAAGAGTCGATCAGAAAGACCACCTTGGG |
| SP03 | GCCTGGCGCACCTTGATCTTCACTTTGAAAGAGTCGATCAGAAAGACCACCTTGGGGATGCCTTCCAGGGAGGGCAGCTG |
| SP04 | TTGAAAGAGTCGATCAGAAAGACCACCTTGGGGATGCCTTCCAGGGAGGGCAGCTGCCCATCATCTGGCACCTCCAGGTC |
| SP05 | ACCTTGGGGATGCCTTCCAGGGAGGGCAGCTGCCCATCATCTGGCACCTCCAGGTCGAACCTCTGCAGCAGCCAGGCCAT |
| SP06 | GGCAGCTGCCCATCATCTGGCACCTCCAGGTCGAACCTCTGCAGCAGCCAGGCCATGATGAGGAAGAGCTCCTGGCGGGC |
| SP07 | TCCAGGTCGAACCTCTGCAGCAGCCAGGCCATGATGAGGAAGAGCTCCTGGCGGGCCAGGATCTCACCTATACAGGAGCG |
| SP08 | CAGGCCATGATGAGGAAGAGCTCCTGGCGGGCCAGGATCTCACCTATACAGGAGCGAGGTCCTGCTCCGAAGGGCAAATA |
| SP09 | TGGCGGGCCAGGATCTCACCTATACAGGAGCGAGGTCCTGCTCCGAAGGGCAAATAGCTTACTGACGGTGAGATGAGCTG |
| SP10 | GTACTGGGGTGGTGGAGCAGAGTCCAGGCTCGCTGTGTGGCCCAGGGCGCAGGACAGGACAGACTCACCAGGCATGAACT |
| SP11 | CAGGCTCGCTGTGTGGCCCAGGGCGCAGGACAGGACAGACTCACCAGGCATGAACTGATCCGGCTGGTGCCACTCCTTCT |
| SP12 | GCAGGACAGGACAGACTCACCAGGCATGAACTGATCCGGCTGGTGCCACTCCTTCTCATTGTGATGCAGCGCCCACAGAT |
| SP13 | CATGAACTGATCCGGCTGGTGCCACTCCTTCTCATTGTGATGCAGCGCCCACAGATTGATGATAACTTCTGTGCCCTTGT |
| SP14 | CTCCTTCTCATTGTGATGCAGCGCCCACAGATTGATGATAACTTCTGTGCCCTTGTCCACAGCAAACTCACCGATGCTGC |
| SP15 | CCACAGATTGATGATAACTTCTGTGCCCTTGTCCACAGCAAACTCACCGATGCTGCTCCAGAGTGGAAGAGGAAAAGTGG |
| SP16 | GCTGGCAAGCAGTGTTGAATGCATCATGGGGCTAGATGTCACTGGGAGGGCAGGCACACCTGGAGTCAACGTTGGCCTTG |
| SP17 | CATGGGGCTAGATGTCACTGGGAGGGCAGGCACACCTGGAGTCAACGTTGGCCTTGTGGGGGATGAGCATAGGGGCCACG |
| SP18 | GGCAGGCACACCTGGAGTCAACGTTGGCCTTGTGGGGGATGAGCATAGGGGCCACGGGCCTGAGGCGAAGCACCTCTCGG |
| SP19 | TGGCCTTGTGGGGGATGAGCATAGGGGCCACGGGCCTGAGGCGAAGCACCTCTCGGATGGTGGCCTCCAGCAGGAGGAGA |
| SP20 | GGGCCACGGGCCTGAGGCGAAGCACCTCTCGGATGGTGGCCTCCAGCAGGAGGAGACGGTTACGGTCACTGATAGTTGGT |
| SP21 | CCTCTCGGATGGTGGCCTCCAGCAGGAGGAGACGGTTACGGTCACTGATAGTTGGTGTGCGGCTGAAACCCACATTCTGG |
| SP22 | GGAGGAGACGGTTACGGTCACTGATAGTTGGTGTGCGGCTGAAACCCACATTCTGGTCAATCTCCTCGTAGAGCTTCTTC |
| SP23 | TAGTTGGTGTGCGGCTGAAACCCACATTCTGGTCAATCTCCTCGTAGAGCTTCTTCTTCACCTGAAGACCAGAGTAGGTT |
| SP24 | GGGGAAGCACACCTGAGGATTGTGCAGCAGGAAGGCCAGGGTCCATTTAACCACAGAGGTGGTGGTCTCCACGCCAGCCC |
| SP25 | CAGCAGGAAGGCCAGGGTCCATTTAACCACAGAGGTGGTGGTCTCCACGCCAGCCCCAAAGATGTCCCCTATGGTGGTGA |
| SP26 | AACCACAGAGGTGGTGGTCTCCACGCCAGCCCCAAAGATGTCCCCTATGGTGGTGAGAATGTGGTTATCTGAAAGCAGCT |
| SP27 | GCCAGCCCCAAAGATGTCCCCTATGGTGGTGAGAATGTGGTTATCTGAAAGCAGCTCTGAGTCTTGATCTGGGCCAGCAT |
| SP28 | GGTGGTGAGAATGTGGTTATCTGAAAGCAGCTCTGAGTCTTGATCTGGGCCAGCATTGCCATTATCTGAGTTCATCTTGG |
| SP29 | AAGCAGCTCTGAGTCTTGATCTGGGCCAGCATTGCCATTATCTGAGTTCATCTTGGCTTGCATCAGTGTGTCCAGCATGT |
| SP30 | GACTCCACCCTGCTCTTGTGATTACTTTTAGCCTAACTCATATTCTCTTCTGCTCTATCACCTACCTTGTAATTTTCAAG |
| SP31 | CTTTTAGCCTAACTCATATTCTCTTCTGCTCTATCACCTACCTTGTAATTTTCAAGTATTTTATTCAGCAGATCATTTCG |
| SP32 | TCTGCTCTATCACCTACCTTGTAATTTTCAAGTATTTTATTCAGCAGATCATTTCGTATTTTAACATGGCTCTTTAATTT |
| SP33 | TTTTCAAGTATTTTATTCAGCAGATCATTTCGTATTTTAACATGGCTCTTTAATTTTTCCAGGGTTTTGTTGGGGAAAAT |
| SP34 | TCATTTCGTATTTTAACATGGCTCTTTAATTTTTCCAGGGTTTTGTTGGGGAAAATCTGGGAAATAAAAAGAAATGTTAA |
| SP35 | GGCTGGCAGCATCTCACCTTCAACCAGGGGACTAGGTCCACCAGGCTGTCTTTGCTCAGGTTGTCTATGATGCCTTCATT |
| SP36 | CAGGGGACTAGGTCCACCAGGCTGTCTTTGCTCAGGTTGTCTATGATGCCTTCATTGTAATTCTGTATGACATTCAACTC |
| SP37 | TCTTTGCTCAGGTTGTCTATGATGCCTTCATTGTAATTCTGTATGACATTCAACTCAGGGTCCCCATTCTTGTAGGAGGT |
| SP38 | CCTTCATTGTAATTCTGTATGACATTCAACTCAGGGTCCCCATTCTTGTAGGAGGTATTGAAGCAGATCAAGGAGATGAC |
| SP39 | TTCAACTCAGGGTCCCCATTCTTGTAGGAGGTATTGAAGCAGATCAAGGAGATGACATTGGTTACCGCCACGAAGACAGG |
| SP40 | TAGGAGGTATTGAAGCAGATCAAGGAGATGACATTGGTTACCGCCACGAAGACAGGAAAGGAGATGTCTATGGACTGTCC |
| SP41 | GAGATGACATTGGTTACCGCCACGAAGACAGGAAAGGAGATGTCTATGGACTGTCCGTTGTGGGTGGCCAGCATATCACA |
| SP42 | CCTCTCCCTCCAGCAGCTCCTGTGGGATCCAGCCCCAGCCCCAGGGGCCAGCCTGGCACTCACTGATCTTCTCCAGCTTC |
| SP43 | GGATCCAGCCCCAGCCCCAGGGGCCAGCCTGGCACTCACTGATCTTCTCCAGCTTCTGATCGCCATCCTTGAACAGGGCA |
| SP44 | CAGCCTGGCACTCACTGATCTTCTCCAGCTTCTGATCGCCATCCTTGAACAGGGCAAAGGTGGCCATCGCCAGCCTTCGA |
| SP45 | CCAGCTTCTGATCGCCATCCTTGAACAGGGCAAAGGTGGCCATCGCCAGCCTTCGATGCAGCTGCCAGTGTGCGCCAGAG |
| SP46 | ACAGGGCAAAGGTGGCCATCGCCAGCCTTCGATGCAGCTGCCAGTGTGCGCCAGAGTCAGCGAAGGCGATACCCTTACGG |
| SP47 | GCCTTCGATGCAGCTGCCAGTGTGCGCCAGAGTCAGCGAAGGCGATACCCTTACGGTTGTTGGACGCGATGTCTAGAGTT |
| SP48 | CGCCAGAGTCAGCGAAGGCGATACCCTTACGGTTGTTGGACGCGATGTCTAGAGTTGCCTTTAGAGAGCAGGCAAGGCTG |
| SP49 | AGGAGATGGGCACCACTTACCATTTGAGGCCGCCCAGAGAAGTCCTTGCCCTTCTTAATAAGCACCTCCTTGGCCAGCTG |
| SP50 | TGAGGCCGCCCAGAGAAGTCCTTGCCCTTCTTAATAAGCACCTCCTTGGCCAGCTGGTGGTGGCCGACAATCACTGTAGT |
| SP51 | CCCTTCTTAATAAGCACCTCCTTGGCCAGCTGGTGGTGGCCGACAATCACTGTAGTCTTGGTGCCCATACGAACCGAATA |
| SP52 | GCCAGCTGGTGGTGGCCGACAATCACTGTAGTCTTGGTGCCCATACGAACCGAATAGATGGGGCCATATTTTTTCTGCAG |
| SP53 | ACTGTAGTCTTGGTGCCCATACGAACCGAATAGATGGGGCCATATTTTTTCTGCAGCTTGAAGAAGTTGTTATGCATATG |
| SP54 | ACCGAATAGATGGGGCCATATTTTTTCTGCAGCTTGAAGAAGTTGTTATGCATATGGCCGTGTCTGGGGAGGAATGGCAG |
| SP55 | TTCTGCAGCTTGAAGAAGTTGTTATGCATATGGCCGTGTCTGGGGAGGAATGGCAGGCTGCCCACCAGGGGCAGGGACAG |
| SP56 | TGCATATGGCCGTGTCTGGGGAGGAATGGCAGGCTGCCCACCAGGGGCAGGGACAGGAGGCTCTTGGGGTACTTGGCACC |
| SP57 | AATGGCAGGCTGCCCACCAGGGGCAGGGACAGGAGGCTCTTGGGGTACTTGGCACCAGGGCACCTTCTCTTGGGCCAAAA |
| SP58 | AGGGACAGGAGGCTCTTGGGGTACTTGGCACCAGGGCACCTTCTCTTGGGCCAAAACAAATAAGCTAGGGTAAGCAGCAA |
Claims (11)
1. detect a test kit for 17α-hydroxylase deficiency associated gene mutation, it comprises: the probe of catching the non-coding region of the whole exon fragment of object CYP17A1 gene and contiguous 50bp; For the universal primer of the fragment to be measured that increases; Sequence measuring joints sequence; Damping fluid; DNTP; Exo+ polymerase; Strepavidin magnetic beads.
2. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation ", whole probe adopts biotin modification 3 '.
3. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " this probe is oligonucleotides (RNA), or DNA oligo (DNA), but be not limited only to RNA and DNA, DNA or RNA after the modifications such as vitamin H, fluorescence or isotropic substance can be comprised.
4. according to claim 1 the probe of " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " is combined on magnetic bead, or is combined on slide glass, but is not limited only to these media.
5. according to claim 1 the probe of " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " is for target area with the design of high-density stacked tile type, and probe sequence and SCNN1B, SCNN1G are complementary sequence.
6. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " probe length is at 50-180bp, and optimum is 75bp.
7. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " probe length is at 60-200bp, and optimum is 80bp.
8. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " probe length is at 65-2200bp, and optimum is 85bp.
9. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " probe length is at 70-240bp, and optimum is 90bp.
10. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " probe lap optimum range is 5bp-20bp, and optimum is 8bp.
11. according to claim 1 " a kind of test kit detecting 17α-hydroxylase deficiency associated gene mutation " strepavidin magnetic beads material be Al-Ni-Co series permanent magnet alloy or barium ferrite, Nd-Fe-Bo permanent magnet material, Nd-Fe-Bo permanent magnet material, rubber magnet, but be not limited only to these materials.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410347940.8A CN104232753A (en) | 2014-07-22 | 2014-07-22 | 17beta-hydroxylase deficiency related gene mutation detecting kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410347940.8A CN104232753A (en) | 2014-07-22 | 2014-07-22 | 17beta-hydroxylase deficiency related gene mutation detecting kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104232753A true CN104232753A (en) | 2014-12-24 |
Family
ID=52221646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410347940.8A Pending CN104232753A (en) | 2014-07-22 | 2014-07-22 | 17beta-hydroxylase deficiency related gene mutation detecting kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232753A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884041A (en) * | 2015-12-16 | 2017-06-23 | 上海交通大学医学院附属第九人民医院 | Suitable for the detection method of 17 α hydroxylase deficiency common gene mutations of Chinese population |
| CN108140848A (en) * | 2015-07-15 | 2018-06-08 | 齐姆特罗尼克斯有限责任公司 | Automatic biological nanocatalyst produces |
| CN109628558A (en) * | 2018-12-21 | 2019-04-16 | 北京优迅医学检验实验室有限公司 | A kind of capture probe and its application for high-flux sequence detection gene mutation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102344961A (en) * | 2011-09-30 | 2012-02-08 | 康旭基因技术（北京）有限公司 | Economical multi-target multi-gene detection method applying large-scale parallel sequencing technology |
| CN103198236A (en) * | 2012-01-06 | 2013-07-10 | 深圳华大基因科技有限公司 | CYP450 gene type database and gene typing and enzymatic activity identification method |
| US20130225433A1 (en) * | 2012-02-29 | 2013-08-29 | The Regents Of The Universitys Of Michagan | Prostate cancer markers and uses thereof |
| US20140107934A1 (en) * | 2012-10-17 | 2014-04-17 | Celmatix, Inc. | Systems and methods for determining the probability of a pregnancy at a selected point in time |
-
2014
- 2014-07-22 CN CN201410347940.8A patent/CN104232753A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102344961A (en) * | 2011-09-30 | 2012-02-08 | 康旭基因技术（北京）有限公司 | Economical multi-target multi-gene detection method applying large-scale parallel sequencing technology |
| CN103198236A (en) * | 2012-01-06 | 2013-07-10 | 深圳华大基因科技有限公司 | CYP450 gene type database and gene typing and enzymatic activity identification method |
| US20130225433A1 (en) * | 2012-02-29 | 2013-08-29 | The Regents Of The Universitys Of Michagan | Prostate cancer markers and uses thereof |
| US20140107934A1 (en) * | 2012-10-17 | 2014-04-17 | Celmatix, Inc. | Systems and methods for determining the probability of a pregnancy at a selected point in time |
Non-Patent Citations (1)
| Title |
|---|
| ILLUMINA: "TruSeqTM Exome Enrichment Kit", 《ILLUMINA，DATA SHEET: SEQUENCING》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108140848A (en) * | 2015-07-15 | 2018-06-08 | 齐姆特罗尼克斯有限责任公司 | Automatic biological nanocatalyst produces |
| CN108140848B (en) * | 2015-07-15 | 2022-02-01 | 齐姆特罗尼克斯公司 | Automated biological nanocatalyst production |
| CN106884041A (en) * | 2015-12-16 | 2017-06-23 | 上海交通大学医学院附属第九人民医院 | Suitable for the detection method of 17 α hydroxylase deficiency common gene mutations of Chinese population |
| CN106884041B (en) * | 2015-12-16 | 2021-03-09 | 上海交通大学医学院附属第九人民医院 | Method for detecting common gene mutation of 17 alpha hydroxylase deficiency disease suitable for Chinese population |
| CN109628558A (en) * | 2018-12-21 | 2019-04-16 | 北京优迅医学检验实验室有限公司 | A kind of capture probe and its application for high-flux sequence detection gene mutation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450885A (en) | Kit for detecting neurofibromatosis 1 (NF1)-related gene mutation | |
| CN107002292B (en) | A kind of construction method and reagent in the twin adapter single stranded circle library of nucleic acid | |
| CN108004301A (en) | Gene target region enrichment method and build storehouse kit | |
| CN107541791A (en) | Construction method, kit and the application in plasma DNA DNA methylation assay library | |
| CN106319065A (en) | Kit and capture probe for human BRCA1/2 gene detection on basis of high-throughput sequencing | |
| CN105830077A (en) | Method for improving the sensitivity of detection in determining copy number variations | |
| CN103361743A (en) | DNA library construction method for prenatal diagnosis | |
| CN103572378A (en) | Establishment method for small fragmental DNA (Deoxyribose Nucleic Acid) library based on Ion ProtonTM sequencing platform and application of establishment method | |
| CN106381334A (en) | Quality control method for detecting human BRCA1/2 genovariation based on high-throughput sequencing and reagent kit | |
| KR102204274B1 (en) | How to build an amplicon library through a one-step process | |
| CN106636404A (en) | Quality control method for detecting human EGFR (Epidermal Growth Factor Receptor) gene variation based on high-throughput sequencing and kit | |
| WO2019006975A1 (en) | In situ whole genome chromatin conformation capture method for infinitesimal cells | |
| CN103571822B (en) | A kind of multipurpose DNA fragmentation enriching method analyzed for new-generation sequencing | |
| CN111690748B (en) | Probe set for detecting microsatellite instability by using high-throughput sequencing, kit and microsatellite instability detection method | |
| CN103898195A (en) | Helicobacter pylori drug resistance nucleic acid detection kit | |
| CN104232753A (en) | 17beta-hydroxylase deficiency related gene mutation detecting kit | |
| CN104388551A (en) | Kit for detecting mutation of Von Hippel-Lindau (VHL) syndrome related gene | |
| CN106520963A (en) | Capturing probe and kit for high-throughput sequencing detection of human circulating tumor DNA KRAS gene | |
| CN104894233A (en) | Multi-sample and multi-segment DNA methylation high-throughput sequencing method | |
| CN106929504A (en) | Detect the kit of acute promyelocytic leukemia correlation fusion gene | |
| CN106498079A (en) | Based on quality control method and kit that high-flux sequence detects people's KRAS genetic mutations | |
| CN106834286B (en) | Primer combination for one-step method rapid construction of amplicon library | |
| CN107881232A (en) | Probe compositions and the application that lung cancer and colorectal cancer gene are detected based on NGS methods | |
| CN104232754A (en) | 11beta-hydroxylase deficiency related gene mutation detecting kit | |
| CN104388552A (en) | Kit for detecting mutation of apparent mineralocorticoid excess related gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20141224 |
|
| WD01 | Invention patent application deemed withdrawn after publication |