CN104232554A

CN104232554A - Xylosidase-based engineering bacterium and realization method thereof

Info

Publication number: CN104232554A
Application number: CN201410462373.0A
Authority: CN
Inventors: 周培; 冯海玮; 孙玉静; 支月娥; 罗艳青
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2014-09-12
Filing date: 2014-09-12
Publication date: 2014-12-24

Abstract

The invention relates to a xylosidase-based engineering bacterium. The realization method of the xylosidase-based engineering bacterium comprises the following steps: by taking streptomyces griseorubens genome DNA as a template, performing PCR amplification together with a primer containing restriction enzyme cutting sites and a poly-histidine tag to obtain a nucleotide sequence for coding xylosidase; then connecting the gene sequence obtained by amplification to an expressive carrier, and transforming the obtained connection product into an escherichia coli expression strain to obtain a xylosidase-overexpressed recombinant strain. Aiming at deficiencies that the majority of xylosidase is endoenzyme in a biological body, and low expression quantity causes seriously limited application range and effect in the prior art, a great amount of expression synthesis of the xylosidase in vitro can be realized by applying gene engineering means; in addition, by adopting a method of adding the poly-histidine tag on the C end of the expressive recombinant protein, the purity of the purified xylosidase can be guaranteed while the protein activity is improved; in addition, expression of periplasmic space of a target protein can be realized by a carrier signal peptide, and the activity of the xylosidase can be enhanced.

Description

Based on engineering bacteria and its implementation of xylosidase

Technical field

What the present invention relates to is a kind of gene and engineering strain thereof of technical field of biological genetic engineering, specifically a kind of ash slightly engineering bacteria based on xylosidase of red streptomyces and its implementation.

Background technology

Lignocellulose is natural high moleculer eompound the abundantest in vegitabilia, is the main dry-matter that plant is produced by photosynthesis, mainly comprises Mierocrystalline cellulose, hemicellulose and xylogen.The biological degradation of lignocellulose and unzipping are the processes of a high complexity, and it relates to the participation of many multienzyme system.

Hemi-cellulose components in lignocellulose is the heteromultimer be made up of several dissimilar monose, and these sugar are five-carbon sugar and hexose, comprises wood sugar, Ah 's sugar, seminose and semi-lactosi etc.Hemicellulose is mainly divided three classes: polyxylose class, poly-gluco-manno carbohydrate and poly-Galactose Glucose sweet dew carbohydrate, and wherein polyxylose class is with 1, and 4 ?β ?D ?pyranose form wood sugars form main chain, the polysaccharide being side chain with 4 ?oxygen first base ?glucopyranose aldehydic acid; Poly-gluco-manno carbohydrate be by D ?glucopyranosyl and pyranose form mannose group with 1,4 ?β type connect into main chain; Another Galactose Glucose sweet dew carbohydrate of birdsing of the same feather flock together then also has the form of D ?galactopyranose base side chain with 1, and 6 ?α types are connected in some D ?pyranose form mannose groups on this main chain and D ?glucopyranosyl.The primary degrading enzyme of hemicellulose have Nei Qie ?β ?1,4 ?zytase (Endo ?β ?1,4 ?xylanases) He β ?1,4 ?xylosidase (β ?1,4 ?xylosidase), wherein xylosidase major catalytic hydrolysis xyloside and in addition butt formula be hydrolyzed the xylo-oligosaccharide of more than xylo-bioses and xylo-bioses from non reducing end, hydrolysate is wood sugar.Therefore, xylosidase plays a key role in the thorough hydrolytic process of hemicellulose.

Xylosidase in distributed in nature widely, has now been separated and has obtained from the microorganisms such as bacterium, fungi (comprising yeast) and higher plant.Compared with eukaryote xylosidase gene, bacterial xylose glycoside enzyme gene has not containing advantages such as intron, easily clone, easy expression and kind are many.Wherein ash omits red streptomyces (Streptomyces griseorubens) is a kind of common soil bacteria.But streptomycete research emphasis concentrates on how to transform its pathways metabolism to improve antibiotic fermentation yield before, to the development and utilization also relative deficiency of other functional genes in its genome.

With most of pre biooxidation ratio, streptomycete has comparatively complicated Growth and Differentiation mechanism, the decomposition Utilization ability as very strong in hemicellulose has to macromolecular polysaccharide material.Therefore, research streptomycete half-and-half cellulosic decomposition using mechanism, excavates brand-new hemicellulase genes sequence and realizes goal gene by genetic engineering means and carry out heterogenous expression, is significant to the exploitation of novel hemicellulase preparations and even production.

Through finding the retrieval of prior art: open (bulletin) the day 2009.05.13 of Chinese patent literature CN101429518, disclose a kind of high temperature resistant xylosidase XynB2 and the coding gene of this enzyme and application, this technology by thermophilic denitrifying bacillocin (Geobacillus thermodenitrificans) NG80 ?the xylosidase XynB2 construction of expression vector that obtains by pcr amplification of 2 genomic dnas to go out the Scrimber Glycosylase of this genes encoding at expression in escherichia coli.The optimal reactive temperature of this enzyme is 65 DEG C, and optimal reaction pH is 6.0, Heat stability is good in slant acidity environment.Be applicable to decomposing oligomerization xylan and produce wood sugar.But the environment proper capacity of the Scrimber Glycosylase that this technology obtains still is difficult to meet existing industrial needs.

Summary of the invention

What the present invention is directed to that prior art exists mostly is intracellular enzyme and the deficiency such as the lower range of application that causes of expression amount and effect critical constraints in vivo due to xylosidase, a kind of engineering bacteria based on xylosidase and its implementation are proposed, using gene engineering means can realize the synthesis of its external great expression, in addition the present invention is by adding the method for polyhistidyl tags at recombinant protein, facilitate the purifying of late protein, the xylosidase obtained is except having except strong tolerance to high temperature (optimal reactive temperature is 50 DEG C), also can maintain stable the enzyme activity under alkaline environment (pH 8.0 ?12.0), there is industrial use widely.。

The present invention is achieved by the following technical solutions:

The present invention relates to a kind of engineering bacteria of xylosidase, this project bacterium is the intestinal bacteria of heterogenous expression xylosidase.

In described born of the same parents xylosidase be specially ash slightly red streptomyces (Streptomyces griseorubens) JSD ?1 xylosidase encoding gene, namely xylosidase SG ?the nucleotide sequence of XO as shown in SEQ ID No.1, this nucleotides sequence is classified as 1518bp, coding 505 amino acid altogether, its aminoacid sequence is as shown in SEQ ID No.2.

Described xylosidase encoding gene clones acquisition by the mode of genome sequencing and pcr amplification.

Described ash slightly red streptomyces (Streptomyces griseorubens) JSD ?1, now be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), deposit number is CGMCC No.5706, preservation date is on January 9th, 2012, preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica's postcode 100101.

The present invention relates to the implementation method of above-mentioned engineering bacteria, with ash slightly red streptomyces genomic dna for template, and containing restriction enzyme site and polyhistidyl (HIS ₆tag) primer of label carry out pcr amplification obtain encodes xylose glycosides enzyme nucleotide sequence SG ?XO; Then the gene order that obtains of increasing is connected to expression vector pET ?22b (+), then the connection product of acquisition is proceeded in E. coli expression strains, obtains xylosidase process LAN recombinant bacterial strain.

The described primer containing restriction enzyme site and polyhistidyl tags, namely specifically comprises containing Msc I and EcoR I restriction enzyme site primer:

XO‐Msc?I‐F:GATGGCCATGGTGATCCACGTGCCCGCGGAGCC

XO‐EcoR?I‐R:GGAATTCTCA ATGATGATGATGATGATGTGCCGTGTCCCGGCCGAGCA

The condition of described pcr amplification is: 98 DEG C of denaturation 3min; 98 DEG C of sex change 10s, 68 DEG C extend 45s; 30 circulations extend 3min rear 68 DEG C of ends.

Described E. coli expression strains is Transetta (DE3) intestinal bacteria.

The present invention relates to a kind of application of engineering bacteria of xylosidase, use it for the external high expression of xylosidase, and industrial fermentation xylosidase being used for wood sugar is produced.

Technique effect

Existing xylosidase is intracellular enzyme in ash slightly red streptomyces and expression amount is very low, therefore seriously limits its use range and effect; Compared with prior art, the invention provides a kind of brand-new xylosidase gene sequence; By building heterogenous expression carrier, achieve the external source high expression of xylosidase, and by adding polyhistidyl tags (HIS at expression recombinant protein c end ₆tag) method, improves the purity that to also ensure that xylosidase after purifying while protein-active; In addition, the periplasmic space that the present invention achieves target protein by carrier signal peptide is expressed, and improves the activity of xylosidase; Described xylosidase has more stable enzymatic property under the special conditions of such as high temperature and alkalescence.

Accompanying drawing explanation

Fig. 1 is ash slightly red streptomyces xylosidase signal peptide prediction figure.

Fig. 2 is ash slightly red streptomyces xylosidase expression amount schematic diagram under different carbon source induction.

Fig. 3 is restructuring xylosidase (HIS6Tag) vivoexpression SDS ?PAGE proof diagram.

Fig. 4 is restructuring xylosidase (HIS6Tag) relative activity schematic diagram under different pH.

Fig. 5 is restructuring xylosidase (HIS6Tag) relative activity schematic diagram at different temperatures.

Embodiment

Elaborate to embodiments of the invention below, the present embodiment is implemented under premised on technical solution of the present invention, give detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.

Embodiment 1

The present embodiment comprises the following steps:

Step 1) grey separation and cultivation of omiting red streptomyces

Ash slightly red streptomyces (Streptomyces griseorubens) is separated the rotten stalk collected from Pujiang town, Shanghai City, and deposit number is CGMCC No.5706.By this strain inoculation in LB liquid nutrient medium, cultivate 48h for 32 DEG C.

Above-mentioned LB liquid nutrient medium component is: peptone 10.0g/L, yeast extract 5.0g/L, NaCl 10.0g/L, pH6.8 ?7.2.Add in liquid medium within 15.0 ?20.0g/L agar namely obtain LB solid medium.

Step 2) ash slightly red streptomyces extracting genome DNA

Collect 2.0mL bacterium liquid, the centrifugal 2min of 12000rpm.Abandon supernatant, collect bacterial sediment, add 180 μ L N,O-Diacetylmuramidases (20mg/mL) and 20 μ L EDTA solution (0.5M, pH 8.0), 37 DEG C of process 45min, add 4 μ L RNase A (100mg/mL), concussion mixing 15s, room temperature places 5min, extracts test kit (TIANGEN) operation instructions subsequently and completes remaining operation, obtain high purity genomic dna according to DNA of bacteria.By 0.8% agarose gel electrophoresis determination genomic dna quality, guarantee without obvious RNA band, genome band cleaning, complete, without degraded, pollution-free.

Step 3) ash slightly red streptomyces gene order-checking

Determine whole-genome shotgun sequencing (WGS) strategy, adopt s-generation sequencing technologies, build the library of different Insert Fragment length, adopt Miseq (2 × 250bp) platform to check order.Collect the raw data of order-checking, belt lacing, low-quality data are filtered, Newbler version 2.8 is adopted from the beginning to splice the sequencing data removing joint subsequently, build contigs and scaffolds, finally use GapCloser program to carry out gap fill and obtain streptomyces gene group sketch.

Step 4) protein coding gene function prediction

Glimmer 3.0 software is adopted to carry out predictive genes to whole genome sequence.Self training predictive genes model chosen by predictive genes model, namely extracts sequence the longest in assembled sequence, the sequence using this sequence as predictive genes model training.Then with the predictive genes model of this sequence construct, carry out predictive genes to all sequences, the length of setting open reading frame is 110bp, and all the other parameters are the default setting of Glimmer 3.0.

Step 5) xyloside enzyme membrane location prediction

SignalP 4.1 is adopted to carry out signal peptide simulation and forecast to xylosidase aminoacid sequence respectively, as shown in Figure 1.Result shows that xylosidase does not exist obvious signal peptide sequence, infers that this enzyme is intracellular enzyme.

Step 6) grey extraction of omiting red streptomyces total serum IgE

By streptomycete JSD ?1 minimal medium that to be inoculated in rice straw (Mierocrystalline cellulose, xylan, pectin, xylogen or glucose) be sole carbon source, 32 DEG C, cultivate 72h under 150rpm condition.Collected by centrifugation bacterial sediment, and extract highly purified streptomycete total serum IgE by bacterium total RNA extraction reagent box requirement (TIANGEN).

Above-mentioned minimal medium component is: KNO ₃2.0g/L, KH ₂pO ₄1.0g/L, NaCl 0.5g/L, MgSO ₄7H ₂o 0.5g/L, CaCl ₂2H ₂o0.1g/L, FeSO ₄7H ₂o 0.01g/L, rice straw (Mierocrystalline cellulose, xylan, pectin, xylogen or glucose) 10.0g/L.

Step 7) ash slightly red streptomyces xylosidase expression level mensuration

According to xylosidase gene sequence, by DNAMAN 6.0 software design Specific PCR primers, primer sequence is as follows:

XO‐F:CCACGCCGACTCCTTCTCCT

XO‐R:GGTGGTAGGTGGGTTTGCGG

Same, according to the specific sequence design primer of 16S rRNA, and as reference gene, primer sequence is as follows:

16S?rRNA‐F:CGTATTCACCGCAGCAATGC

16S?rRNA‐R:GCGAGGTGGAGCGAATCTCA

Carry out reverse transcription with streptomycete total serum IgE template and obtain cDNA library, and require to carry out relating operation according to PCR kit for fluorescence quantitative (TaKaRa).Three repetitions are set, treat that experiment completes collection and treatment data, analyze under different carbon source inducing action, the expression amount (as Fig. 2) of xylosidase.Result shows, when inducing for carbon source with rice straw and xylan, the expression amount of this xylosidase significantly raises, and proves that this enzyme participates in the metabolic process of hemicellulose.

The reaction conditions of above-mentioned quantitative fluorescent PCR is: 95 DEG C of denaturation 30s; 95 DEG C of sex change 10s, 60 DEG C of annealing 30s, 72 DEG C extend 15s, totally 40 circulations.

Step 8) xylosidase expression vector establishment

According to xylosidase gene sequence, design is containing restriction enzyme site and polyhistidyl (HIS ₆tag) primer of label is as follows:

XO‐Msc?I‐F:GATGGCCATGGTGATCCACGTGCCCGCGGAGCC

XO‐EcoR?I‐R:GGAATTCTCA ATGATGATGATGATGATGTGCCGTGTCCCGGCCGAGCA

Red streptomyces (Streptomyces griseorubens) genomic dna is omited for template with ash, xylosidase gene sequence is obtained with carrying out pcr amplification containing Msc I and EcoR I restriction enzyme site primer, use DNA A ?Tailing Kit add A after be connected to T ?Vector PMDTM 19 ?T (TaKaRa), and connection product to be proceeded in DH5 α intestinal bacteria.Select positive colony, shake bacterium and extract plasmid order-checking.Msc I and EcoR I carries out double digestion (37 DEG C), reclaims xylosidase DNA fragmentation XO.With identical endonuclease digestion expression vector pET ?22b (+) reclaim vector DNA fragment.XO is mixed with carrier segments, T4DNA Ligase (TaKaRa) spends the night connection (16 DEG C), connection product is proceeded in DH5 α competent escherichia coli cell, screened the positive colony of the expression vector containing goal gene by resistant panel and bacterium colony PCR.Picking positive colony is inoculated in the LB liquid nutrient medium containing penbritin (100 μ g/mL), and 180rpm, 37 DEG C of cultivations extracted plasmid after 16 hours.

Above-mentioned pcr amplification condition is: 98 DEG C of denaturation 3min; 98 DEG C of sex change 10s, 68 DEG C extend 45s; 30 circulations extend 3min rear 68 DEG C of ends.

Step 9) structure of xylosidase process LAN transgenic strain

Above-mentioned expression vector is proceeded to Transetta (DE3) intestinal bacteria, the LB solid medium containing penbritin (100 μ g/mL) and paraxin (34 μ g/mL) screens, obtain xylosidase process LAN bacterial strain.

Above-mentioned Transetta (DE3) has following characteristics: this bacterial strain has paraxin (Camr), and contain the tRNA of 6 kinds of rare codons (AGA, AGG, AGA, CUA, CCC, GGA) correspondences that intestinal bacteria lack, effectively can improve foreign gene, especially the expression level of the high GC content such as eukaryote and streptomycete biological gene in prokaryotic system.

Step 10) the external source high expression of Scrimber Glycosylase

Picking positive colony, in the LB liquid nutrient medium containing penbritin (100 μ g/mL) and paraxin (34 μ g/mL), is cultivated 32 DEG C of concussions, is worked as OD ₆₀₀reach 0.6 ?0.8 time, add IPTG solution and make nutrient solution IPTG concentration reach 50 μMs, 25 DEG C continue cultivations within 16 hours, carry out abduction delivering.Abduction delivering cultured fermented liquid collected by centrifugation thalline, utilize broken born of the same parents' buffer solution thalline once, under condition of ice bath, utilize ultrasonic wave to break born of the same parents after recycling the resuspended thalline of phosphate buffered saline buffer of 1/10 fermentating liquid volume clarify to bacterium liquid, the centrifugal 15min of 13000rpm/min collects supernatant, and supernatant liquor is the crude enzyme liquid of xylosidase.

The SDS of Scrimber Glycosylase ?PAGE checking

Preparation 12%SDS ?PAGE glue, mixes crude enzyme liquid with 5 × SDS ?PAGE Loading Buffer ratio, and with boiling water bath 5min, each loading wells loading 20 μ L, electrophoresis 60 ?70min under 160V voltage, until tetrabromophenol sulfonphthalein instruction band runs out of glue completely.Stop electrophoresis, with Xylene Brilliant Cyanine G R ?250 solution-dyed 20min, then wash with destainer, until background colour is sloughed completely, band high-visible (as Fig. 3).

Described 12%SDS ?PAGE be made up of concentrated glue and separation gel, its component is respectively:

Separation gel: distilled water 1.6mL, 30% acrylamide soln 2.0mL, 1.5M Tris ?HCl (pH 8.8) 1.3mL, 10% ammonium persulphate (APS) 0.05mL, 10%SDS solution 0.05mL, TEMED 0.002mL;

Concentrated glue: distilled water 0.68mL, 30% acrylamide soln 0.17mL, 1.0M Tris ?HCl (pH 6.8) 0.13mL, 10% ammonium persulphate (APS) 0.01mL, 10%SDS solution 0.01mL, TEMED 0.001mL;

5 described × SDS ?PAGE Loading Buffer component be: 1M Tris ?HCl (pH 6.8) 1.25mL, SDS 0.5g, tetrabromophenol sulfonphthalein 25mg, glycerine 2.5mL, deionized water is settled to 5mL.Aliquot packing (500 μ L) afterwards and room temperature preservation, before using every aliquot add β ?mercaptoethanol 25 μ L.

Described Xylene Brilliant Cyanine G R ?250 solution components be: Xylene Brilliant Cyanine G R ?2501g, Virahol 250mL, Glacial acetic acid 100mL, deionized water 650mL.

Described destainer component is: Glacial acetic acid 100mL, dehydrated alcohol 50mL, deionized water 850mL.

Under different condition, the enzymatic property of xylan measures

Xylosidase activity refer to by from substrate Dui Xiao base Ben Fen ?β ?D ?xyloside discharge that the amount of p-NP determines.Mensuration system cumulative volume is 800 μ L, reaction system is 200 μ L, include 10 μ L 20mM substrate nitro benzene phenol ?β ?D ?xylosides, the O-phthalic potassium hydrogen phthalate ?miaow damping fluid of 185 μ L 100mM pH 6.0,5 μ L dilute crude enzyme liquid in right amount, in 65 DEG C of reaction 5min, then add the Na of 600 μ L 1M ₂cO ₃solution termination reaction also develops the color, and measures the increasing amount of absorbance value at 405nm place.An enzyme unit definition alive is: under the reaction conditions, in 1min, catalysis produces the enzyme amount required for the p-NP of 1 μM.

Under adopting aforesaid method to be determined at differing temps (20 DEG C ?80 DEG C) and pH (3.0 ?12.0), the activity of xylosidase crude enzyme liquid.Measurement result shows (Fig. 4 and Fig. 5), and zytase, at pH 8.0 and 50 DEG C, has maximum enzyme activity, illustrates that this xylosidase still can maintain comparatively stable biologic activity under high temperature and alkaline condition.

Claims

1. an engineering bacteria for xylosidase, is characterized in that, this project bacterium is the intestinal bacteria of heterogenous expression xylosidase;

2. engineering bacteria according to claim 1, it is characterized in that, described ash slightly red streptomyces (Streptomyces griseorubens) JSD ?1, now be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), deposit number is CGMCC No.5706, and preservation date is on January 9th, 2012.

3. the implementation method according to the engineering bacteria described in claim 1 or 2, it is characterized in that, with ash slightly red streptomyces genomic dna for template, with the primer containing restriction enzyme site and polyhistidyl tags carry out pcr amplification obtain encodes xylose glycosides enzyme nucleotide sequence SG ?XO; Then the gene order that obtains of increasing is connected to expression vector pET ?22b (+), then the connection product of acquisition is proceeded in E. coli expression strains, obtains xylosidase process LAN recombinant bacterial strain.

4. method according to claim 3, is characterized in that, the described primer containing restriction enzyme site and polyhistidyl tags, namely specifically comprises containing Msc I and EcoR I restriction enzyme site primer:

XO‐Msc?I‐F:GATGGCCATGGTGATCCACGTGCCCGCGGAGCC

XO‐EcoR?I‐R:GGAATTCTCA ATGATGATGATGATGATGTGCCGTGTCCCGGCCGAGCA。

5. method according to claim 3, is characterized in that, the condition of described pcr amplification is: 98 DEG C of denaturation 3min; 98 DEG C of sex change 10s, 68 DEG C extend 45s; 30 circulations extend 3min rear 68 DEG C of ends.

6. method according to claim 3, is characterized in that, described E. coli expression strains is Transetta (DE3) intestinal bacteria.

7. an application for the engineering bacteria of the xylosidase according to above-mentioned arbitrary claim, is characterized in that, uses it for the external high expression of xylosidase, and industrial fermentation xylosidase being used for wood sugar is produced.