CN103882050A - Expression method and purification of mouse epidermal growth factor in pichia pastoris - Google Patents
Expression method and purification of mouse epidermal growth factor in pichia pastoris Download PDFInfo
- Publication number
- CN103882050A CN103882050A CN201410000614.XA CN201410000614A CN103882050A CN 103882050 A CN103882050 A CN 103882050A CN 201410000614 A CN201410000614 A CN 201410000614A CN 103882050 A CN103882050 A CN 103882050A
- Authority
- CN
- China
- Prior art keywords
- pichia pastoris
- recombinant
- expression
- purifying
- expression method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an expression method and purification of a mouse epidermal growth factor in pichia pastoris. The expression method comprises the following steps: (1) constructing recombinant plasmid pBSAZ2.1; (2) carrying out electrotransformation and expression of recombinant pichia pastoris of pBSAZ2.1 protein; (3) screening positive recombinant strains; (4) inducing recombinant bacteria to express the mouse epidermal growth factor; (5) purifying the mouse epidermal growth factor. According to the invention, a genetic engineering method is adopted, mEGF genes are connected to an expression vector, and secretory expression is completed in pichia pastoris cells so as to construct genetic engineering bacteria containing mEGF target genes. The expression method and purification can guide correct folding of protein, and provide various complex post-translational processing functions such as glycosylation, so that the an expression product is the most close to a natural biological protein molecule in terms of molecular structure, physical and chemical properties and biological functions. The expression method and purification can avoid the formation of an inclusion body caused by protein aggregation in the cells so as to enable the downstream purification of interest protein to be easier, and be beneficial to large-scale treatment.
Description
Technical field
The present invention relates to genetically engineered field, be specifically related to expression method and the purifying of M-EGF in pichia pastoris phaff GS115.
Background technology
M-EGF (Mouse Epidermal Growth Factor is called for short mEGF) is that one contains 53 amino acid whose single chain polypeptides, and molecular weight is 6054 dalton.M-EGF can be combined with special transmembrane receptor, causes a series of biochemical variations in cell, makes static cell enter mitotic cycle, promotes cell proliferation, reaches life balance through after a period of time, and cell is infinite multiplication no longer.Therefore, M-EGF is a kind of strong cell fission promotor, and the external source M-EGF of trace can stimulate cellular proliferation, thereby accelerates the Regeneration and Repair of damaged skin and interior epithelium, reduces the deformity of skin.So M-EGF all plays an important role to the treatment of burn trauma treatment, cornea or dermatoplasty, traumatic ulcer, gastrointestinal ulceration and irritability gastric mucosa injury.
The submaxillary gland of mouse is the main synthesising part of EGF, after EGF is synthetic, is discharged in the body fluid such as saliva, duodenum, milk, urine and blood.But its content is extremely low, the sterling protein content that adopts the method separation and purification of freeze-drying mouse submandibular gland to obtain is fewer, and biological activity is low, does not often reach a large amount of preparations for research and clinical standard.
Summary of the invention
For the deficiencies in the prior art, the object of the invention is the problem in order to solve restructuring M-EGF secreting, expressing in pichia pastoris phaff GS115, a kind of structure and screening of efficient, stable expression mEGF engineering bacteria are provided, and the method for separation and purification target protein mEGF.
Object of the present invention can realize by following technical proposal: expression method and the purifying of a kind of M-EGF in pichia pastoris phaff GS115, comprises the following steps: (1) construction recombination plasmid pBSAZ 2.1; (2) electricity transforms the Recombinant Pichia pastoris of expressing pBSAZ 2.1 albumen; (3) screening of positive recombinant bacterial strain; (4) induction recombinant bacterium is expressed M-EGF; (5) purifying of M-EGF.
Described in the expression method of M-EGF of the present invention in pichia pastoris phaff GS115 and purifying, step (1) comprises the following steps successively: (a) pcr amplification mEGF-TEV-malE-HIS6 gene; (b) mEGF-TEV-malE-HIS6 gene fragment step (a) being obtained is spent the night and is connected processing with the plasmid pPIC 9k of the same digestion with restriction enzyme of warp, to connect product purification, transform in e. coli jm109 competence, receive mycin resistance screening through card, picking positive colony, extracts plasmid and carries out restriction enzyme
ecor I and
notthe qualification of I double digestion, obtains recombinant plasmid pBSAZ 2.1 further.
Described in the expression method of M-EGF of the present invention in pichia pastoris phaff GS115 and purifying, step (2) comprises the following steps successively: (a), the linearizing of recombinant plasmid pBSAZ 2.1; The preparation of b, competent cell; C, electricity transform pichia pastoris phaff.
Described in the expression method of M-EGF of the present invention in pichia pastoris phaff GS115 and purifying, step (3) in turn includes the following steps: (a) utilize the screening of pichia pastoris phaff GS115 histidine auxotroph to integrate recombinant bacterium; (b) the high copy of G418 resistance screening bacterial strain.
The present invention adopts engineered method, and mEGF gene is connected on expression vector, in saccharomyces pastorianus cell, completes secreting, expressing, thereby constructs the genetic engineering bacterium containing mEGF goal gene.Saccharomyces pastorianus expression system can instruct the correct folding of protein, provide the multiple translation post-treatment functions such as complicated glycosylation, thereby expression product is approaching natural bioprotein molecule most aspect molecular structure, physico-chemical property and biological function.It is at present state-of-the-art and be suitable for industrialized phraseology that exocytosis type is expressed, and extracellular is expressed and can be avoided albumen in protecting, to assemble formation inclusion body, makes the downstream purification of target protein simpler, is beneficial to extensive processing.
Brief description of the drawings
Fig. 1 is that recombinant plasmid pBSAZ 2.1 builds schematic diagram
Fig. 2 is pBSAZ 2.1 warps
bglП enzyme is cut rear agarose gel electrophoresis figure;
MEGF protein SDS-PAGE electrophorogram after Fig. 3 purifying.
Specific embodiment
embodiment 1: the structure of recombinant plasmid pBSAZ 2.1
One) test materials
(1) plasmid and bacterial strain
Plasmid pPIC 9k, pMAL-p5X and e. coli jm109 are purchased from Takara bio tech ltd.
(2) reagent
Restriction enzyme
ecor I and
noti, card is received penicillin and kantlex purchased from NEB company.
Gene fragment mEGF and primer are synthesized by Hua Da gene.
m-F：CGGAATTCAATAGTTATCCAGGAT
m-R:TAATGCTCCTGCTGCGAACTCCTCTAGTAACTGGAAATATAGGTTCTC
M-F：GAGAACCTATATTTCCAGTTACTAGAGGAGTTCGCAGCAGGAGCATTAAAAATAAAAACAGGT
M-R：
ATAAGAATGCGGCCGCCGCTGCTGTGATGATGATGATAGTCTGCGCGTC
Two) embodiment
1. the enzyme of plasmid pPIC 9k is cut
A large amount of reconstruct plasmid pPIC 9k that extract, add restriction enzyme after purifying
ecor I and
noti, is placed in 37 DEG C of constant incubator 2-3h and does double digestion processing, and enzyme is cut after product purification, adds dephosphorylation enzyme and does dephosphorylation processing, by stand-by rearmounted dephosphorylation product purification 4 DEG C of Refrigerator stores.
2. the acquisition of mEGF gene fragment
A large amount of plasmid pMD18-T-mEGF that extract containing mEGF gene fragment, as pcr template, add primer m-F and m-R to carry out pcr amplification after purifying, and PCR product is carried out to agarose gel electrophoresis, cut glue and reclaim fragment, and the rearmounted 4 DEG C of Refrigerator stores of purifying are stand-by.
3. the acquisition of malE gene fragment
A large amount of plasmid pMAL-p5X that extract containing malE gene fragment, as pcr template, add primer M-F and M-R to carry out pcr amplification after purifying, and PCR product is carried out to agarose gel electrophoresis, cut glue and reclaim fragment, and the rearmounted 4 DEG C of Refrigerator stores of purifying are stand-by.
4. the acquisition of mEGF-TEV-malE-HIS6 gene
Using the gene fragment mEGF gene of 4 DEG C of Refrigerator stores and malE gene mixture as template, add primer m-F and M-R to carry out Overlapping pcr amplification, PCR product is carried out to agarose gel electrophoresis, cut glue and reclaim fragment, after purifying, add restriction enzyme
ecor I and
noti, is placed in 37 DEG C of constant incubator 2-3h and does double digestion processing, enzyme is cut to the rearmounted 4 DEG C of Refrigerator stores of product purification stand-by.
5. the acquisition of recombinant plasmid pBSAZ 2.1
MEGF-TEV-malE-HIS6 gene fragment is spent the night and is connected processing with the plasmid pPIC 9k of the same digestion with restriction enzyme of warp.
To connect product purification, and transform in e. coli jm109 competence, and receive mycin resistance screening through card, picking positive colony, extracts plasmid and also carries out restriction enzyme
ecor I and
notthe qualification of I double digestion, obtains recombinant plasmid pBSAZ 2.1.
Recombinant plasmid pBSAZ 2.1 builds schematic diagram as shown in Figure 1.
embodiment 2:electricity transforms pichia pastoris phaff
1. the linearizing of recombinant plasmid pBSAZ 2.1
Recombinant plasmid pBSAZ 2.1 adopts restriction enzyme
bglП linearizing, purifying carries out 1% agarose gel electrophoresis after reclaiming, to determine that purifying reclaims the exactness of fragment.
2. the preparation of competent cell
The mono-bacterium colony of picking pichia pastoris phaff GS115, is seeded in the shaking flask that contains 50mL YEPD substratum 30 DEG C, 150rpm overnight incubation.The culture of getting 100 μ L is forwarded in the shaking flask that contains the fresh YEPD substratum of 50mL 30 DEG C, and 150rpm cultivates, and detects OD600 value, and 1.3-1.5 to be reached pours cell culture in the aseptic 50mL centrifuge tube of precooling, in 4 DEG C, and the centrifugal 5min of 4000rpm.Under aseptic condition, the precooling sterilized water of every Guan Zaiyong 50mL is resuspended by bacterial sediment.In 4 DEG C, the centrifugal 5min of 4000rpm, then use the sterilized water of 25mL precooling that bacterial sediment is resuspended.In 4 DEG C, the centrifugal 5min of 4000rpm, the Sorbitol Solution USP of the 1mol/L of use 2mL precooling is resuspended by bacterial sediment.In 4 DEG C, the centrifugal 5min of 4000rpm, with the Sorbitol Solution USP of the 1mol/L of 200 μ L precoolings, bacterial sediment is resuspended.
3. electricity transforms
Electricity is transformed to cup and from dehydrated alcohol, take out, put in super clean bench air-dryly, simultaneously uv irradiating 20 minutes, puts into ice chest precooling transforming cup after only.Get yeast competent cell prepared by 80 μ l, mix with the linearizing recombinant expression plasmid of 5～10 μ g, move into 0.2cm electricity and transform cup, ice bath 5min.Dry steam, put on electroporation and shock by electricity, shock parameters is 1500V, 5ms.After electric shock, add immediately the 1mol/L sorbyl alcohol of 1ml ice bath, proceed in 15ml centrifuge tube, 30 DEG C of standing 1-2h.
embodiment 3: the screening of positive recombinant bacterial strain
1. utilize the screening of pichia pastoris phaff GS115 histidine auxotroph to integrate recombinant bacterium
After leaving standstill the centrifugal 5min of bacterium liquid 1500rpm cultivating, be coated with MD flat board, put 30 DEG C of constant incubators and cultivate 2-3 days to growing single bacterium colony.
2. the high copy of G418 resistance screening bacterial strain
Use respectively toothpick dibbling to the YEPD flat board of 1.5mg/ml-2mg/ml G418 the bacterium colony growing on MD flat board, putting 30 DEG C of constant incubators cultivates about three days, choose the YEPD liquid nutrient medium of long larger colony inoculation containing 1.5mg/ml-2mg/ml G418, put 30 DEG C of shaking table incubated overnight, and-80 DEG C are preserved bacterial strain.
embodiment 4induction recombinant bacterium is expressed M-EGF
1. the single bacterium colony of picking, inoculation 50mL BMDY liquid culture is based on 30 DEG C, and the shaking table of 200r/min is cultivated 16-18h, until OD600 value reaches 2 left and right.Get 1mL culture centrifugal, collecting cell is as not inducing contrast.Get 1mL culture simultaneously and be inoculated in 50mL BMMY liquid culture based on 30 DEG C, the shaking table of 200r/min is cultivated, and inducible gene expression, gets 1mL every 24h, then supplements 1mL5% methyl alcohol and continue to cultivate 3 ~ 5d.
2. by the centrifugal 3min of 1mL culture 12000rpm taking out, isolated cell and supernatant liquor.The centrifugal 1min of 12000r/min after the washing of cell precipitation sterilized water, abandons supernatant liquor, puts ultrasonic disruption instrument smudge cells, and the centrifugal 1min of 12000r/min separates intracellular fluid and cell residue.Whether get 20 μ L supernatant liquors and intracellular fluid 10% polyacrylamide gel carries out SDS-PAGE electrophoretic analysis albumen and secretes to born of the same parents.
embodiment 5: the purifying of M-EGF
The target protein substratum that collection contains secretion, centrifugal removal is the impurity of capacitive not, gets supernatant.
By Amylose Resin affinity chromatographic column, MBP fusion rotein is attached on Amylose Resin, then with the column buffer wash-out that contains 10mmol/L maltose, obtains the MBP fusion rotein of purifying.
Utilize AKTA purifier 100 systems through His TrapTM FF crude affinity chromatography, with Wash buffer(20mmol/L imidazoles, 300mmol/L NaC, 150 mmol/L NaH
2pO
4, pH8.0) and wash away foreign protein, then use Elution buffer(250mmol/L imidazoles, 300mmol/L NaCl, 150 mmol/L NaH
2pO
4, pH8.0) and wash-out, collect unique elution peak and be target protein.The sample that contains target protein slowly adds Ni-NTA post, and albumen is combined with pillar better.Loading is complete, first washes 5 column volumes with broken bacterium damping fluid, is using PBS(pH7.3,140 mM NaCl, 2.7mM NaCl, 50 mM NaH
2pO
4) wash 3 column volumes.
To being combined with the specificity nickase TEV room temperature reaction 1-3 hour that adds 0.1mg in the Ni-NTA post of mEGF-TEV-MBP-HIS6 albumen.The mEGF that enzyme scales off elutes with PBS, collects effluent liquid and carries out SDS-PAGE electrophoresis detection.
embodiment 6mtt assay is measured the activity of mEGF albumen
One) test materials
1. mouse embryo fibroblasts (Balb/c 3t3 cell) is purchased from ATCC.
2. reagent:
(1) RPMI 1640 substratum 1000ml add penicillin 105IU and Streptomycin sulphate 105IU, then add NaHCO3 2.1g, after dissolving, mix, and Sterile Filtration, 4 degree are preserved;
(2) maintain liquid bovine serum 4ml adds RPMI1640 1000ml;
(3) complete culture solution bovine serum 100ml adds RPMI1640 1000ml;
(4) PBS NaCl 8g KCl 0.2g Na2HPO3 1.44g KH2PO3 0.24g adds water to 1000ml through the sterilizing in 15 minutes of 121 degree.
(5)tetrazolium bromide (MTT) solution is got MTT powder 0.1g and is added PBS20ml dissolving, and through 0.22 μ m membrane filtration degerming, 4 degree keep in Dark Place.
Two) embodiment
1. get after the redissolution of restructuring M-EGF standard substance by specification, be diluted to every 1ml with maintain liquid and contain 50IU.In 96 porocyte culture plates, do 4 times of serial dilutions, totally 8 extent of dilution, each concentration is done 2 controls.Aseptic technique;
2. after sample thief redissolves, with the dilution of maintain liquid.In 96 porocyte culture plates, do 4 times of serial dilutions, totally 8 extent of dilution, each concentration is done 2 controls.Aseptic technique;
3. Balb/c 3t3 cell strain uses complete culture solution in 37 degree, 5%CO
2cultivate, controlling cell concn is that every 1ml is containing 1.0 × 10
5～5.0 × 10
5individual cell, after going down to posterity, 24～36h is for biological activity determination.Discard the nutrient solution in culturing bottle, digestion and collecting cell, be made into every 1ml with complete culture solution and contain 5.0 × 10
4～8.0 × 10
4the cell suspension of individual cell, is inoculated in 96 porocyte culture plates, every hole 100 μ l.At 37 degree, 5%CO
2cultivate 24h.The Tissue Culture Plate of preparation discards maintenance medium, adds standard solution and sample solution, every hole 100 μ l.In 37 degree, 5% CO
2cultivate 64～72h.Every hole adds MTT solution 20 μ l, in 37 degree, and 5% CO
2cultivate 5h.More than operate under aseptic condition and carry out.Discard after the liquid in nutrient solution, in every hole, add dimethyl sulfoxide (DMSO) (DMSO) 100 μ l, after mixing, in microplate reader, taking 630nm as reference wavelength, measure absorbancy in wavelength 570nm place, record measurement result.
Result is as follows in sum:
1. successful construction recombination plasmid pBSAZ 2.1
Recombinant plasmid pBSAZ 2.1 is through restriction enzyme
bglП enzyme is cut checking electrophorogram as shown in Figure 2.
2. mEGF protein purification SDS-PAGE protein electrophoresis
Enzyme is cut to rear employing PBS buffer solution elution, and the mEGF albumen of crossing column purification carries out SDS-PAGE electrophoresis, and finally imaging on gel imaging instrument, obtains result as shown in Figure 3
3. the determination of activity of mEGF albumen
The determination of activity experiment of Balb/c 3t3 cell shows that mEGF sample has higher biological activity compared with standard substance, and the activity that mEGF sample detected is 1.3*10
5u/mg.
Claims (4)
1. expression method and the purifying of M-EGF in pichia pastoris phaff, is characterized in that, comprises the following steps:
(1) construction recombination plasmid pBSAZ 2.1;
(2) electricity transforms the Recombinant Pichia pastoris of expressing pBSAZ 2.1 albumen;
(3) screening of positive recombinant bacterial strain;
(4) induction recombinant bacterium is expressed M-EGF;
(5) purifying of M-EGF.
2. expression method and the purifying of a kind of M-EGF according to claim 1 in pichia pastoris phaff, is characterized in that, described step (1) comprises the following steps successively: (a) pcr amplification mEGF-TEV-malE-HIS6 gene; (b) mEGF-TEV-malE-HIS6 gene fragment step (a) being obtained is spent the night and is connected processing with the plasmid pPIC 9k of the same digestion with restriction enzyme of warp, to connect product purification, transform in e. coli jm109 competence, receive mycin resistance screening through card, picking positive colony, extracts plasmid and carries out restriction enzyme
ecor I and
notthe qualification of I double digestion, obtains recombinant plasmid pBSAZ 2.1.
3. expression method and the purifying of a kind of M-EGF according to claim 1 in pichia pastoris phaff, is characterized in that, described step (2) comprises the following steps successively: (a), the linearizing of recombinant plasmid pBSAZ 2.1; The preparation of b, competent cell; C, electricity transform pichia pastoris phaff.
4. expression method and the purifying of a kind of M-EGF according to claim 1 in pichia pastoris phaff, it is characterized in that, described step (3) in turn includes the following steps: (a) utilize the screening of pichia pastoris phaff GS115 histidine auxotroph to integrate recombinant bacterium; (b) the high copy of G418 resistance screening bacterial strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410000614.XA CN103882050A (en) | 2014-01-02 | 2014-01-02 | Expression method and purification of mouse epidermal growth factor in pichia pastoris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410000614.XA CN103882050A (en) | 2014-01-02 | 2014-01-02 | Expression method and purification of mouse epidermal growth factor in pichia pastoris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103882050A true CN103882050A (en) | 2014-06-25 |
Family
ID=50951173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410000614.XA Pending CN103882050A (en) | 2014-01-02 | 2014-01-02 | Expression method and purification of mouse epidermal growth factor in pichia pastoris |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103882050A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424045A (en) * | 2020-04-02 | 2020-07-17 | 湖南科诺康美生命科技有限公司 | Optimized gene of salmonella typhimurium flagellin and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0438200A1 (en) * | 1990-01-16 | 1991-07-24 | Centro De Ingenieria Genetica Y Biotecnologia | Method for the expression of heterologous genes in the yeast Pichia pastoris, expression vectors and transformed microorganisms |
| US5102789A (en) * | 1989-03-15 | 1992-04-07 | The Salk Institute Biotechnology/Industrial Associates, Inc. | Production of epideramal growth factor in pichia pastoris yeast cells |
-
2014
- 2014-01-02 CN CN201410000614.XA patent/CN103882050A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5102789A (en) * | 1989-03-15 | 1992-04-07 | The Salk Institute Biotechnology/Industrial Associates, Inc. | Production of epideramal growth factor in pichia pastoris yeast cells |
| EP0438200A1 (en) * | 1990-01-16 | 1991-07-24 | Centro De Ingenieria Genetica Y Biotecnologia | Method for the expression of heterologous genes in the yeast Pichia pastoris, expression vectors and transformed microorganisms |
Non-Patent Citations (1)
| Title |
|---|
| JEFFREY J. CLARE ET AL: "Production of mouse epidermal growth factor in yeast:high-level secretion using Pichia pastoris strains containing multiple gene copies", 《GENE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424045A (en) * | 2020-04-02 | 2020-07-17 | 湖南科诺康美生命科技有限公司 | Optimized gene of salmonella typhimurium flagellin and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103122027B (en) | Recombinant human collagen and production method thereof | |
| CN102863539B (en) | Fusion tandem antibacterial peptide and preparation method thereof | |
| CN101736062B (en) | Method for preparing recombinant porcine alpha interferon standard substance | |
| CN102675473B (en) | Gene recombinant human active basic fibroblast growth factor fusion protein, preparation method thereof and application thereof | |
| CN108822209A (en) | Polypeptide, its production method and purposes | |
| CN102747097B (en) | I type human collagen and epidermal growth factor dual expression vector, and expression purification method thereof | |
| CN108503712A (en) | With the difunctional mussel attachment proteins/amphoteric ion polypeptide amalgamation protein of adherency-anti-pollution and synthetic method | |
| CN102925403B (en) | Recombinant strain capable of expressing fungal immunomodulatory protein from Flammulina velutipes (FIP-fve), construction method, protein expression and purification method, and protein application | |
| CN104402975B (en) | Anti-aging small peptide and preparation method thereof | |
| CN103014047A (en) | Recombined human cystatin-C protein with natural activity and preparation method thereof | |
| CN112500495A (en) | Purification method and application of ELP-III type collagen | |
| CN115960209A (en) | Recombinant humanized collagen and application thereof | |
| CN107884578A (en) | For echinococcosis antibody test card in Quantitative detection serum | |
| CN102260698B (en) | PTA-linker-thanatin fusion protein expressed in escherichia coli, and anticancer research thereof | |
| CN103882050A (en) | Expression method and purification of mouse epidermal growth factor in pichia pastoris | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN105463006A (en) | Novel preparation method for recombinant human epidermal growth factor | |
| CN111378030A (en) | Method for separating and purifying nano antibody | |
| CN104387459A (en) | Industrial separation and purification method of bacterial source antibacterial peptide | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN103509100B (en) | A kind of IL-1 R antagonist mutant | |
| CN107022549A (en) | Pelteobagrus fulvidraco beta-defensin gene and its beta-defensin antibacterial peptide and its application | |
| CN104293823B (en) | The preparation method and application of soluble Type I DHV 3D albumen | |
| CN106754981A (en) | A kind of method that utilization E. coli system prepares Goose Parvovirus sample particle | |
| CN105936896A (en) | Preparation and applications of polyclonal antibody of bactericidal enoyl reductase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140625 |
|
| RJ01 | Rejection of invention patent application after publication |