CN103571871B - Method for improving aphid resistance of plants - Google Patents
Method for improving aphid resistance of plants Download PDFInfo
- Publication number
- CN103571871B CN103571871B CN201310470965.2A CN201310470965A CN103571871B CN 103571871 B CN103571871 B CN 103571871B CN 201310470965 A CN201310470965 A CN 201310470965A CN 103571871 B CN103571871 B CN 103571871B
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- aphid
- sequence
- dsrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a method for improving aphid resistance of plants in the field of biotechnology. The method comprises the following steps: transferring a structure for expressing aphid gene dsRNA (double-stranded ribonucleic acid) into plants, wherein the structure for expressing the aphid gene dsRNA is double strands, a positive-sense strand and a negative-sense strand comprise an Ap forward-X-Ap reverse structure, the Ap forward part is a forward sequence or fragment of an aphid gene, the Ap reverse part is a reverse complementary sequence or fragment of the same aphid gene, and the X part is a spacer sequence between the AP forward part and the Ap reverse part; in the plants, transcribing constructed carriers and forming dsRNA in the description, in the formula, || represents hydrogen bonds formed between the Ap forward part and the Ap reverse part.
Description
The application is application number is 201110107921.4, and the applying date is 2011.4.28, and denomination of invention is the divisional application of " method strengthening aphid resistance of plant ".
Technical field
What the present invention relates to is a kind of method of enhancing Genes For Plant Tolerance insect pest of biological technical field.Specifically, what relate to is a kind of method strengthening aphid resistance of plant.
Background technology
Insect pest is one of key factor affecting crop yield always.Agricultural chemicals plays an important role in opposing insect pest, but insect develops immunity to drugs gradually to agricultural chemicals, and in addition, agricultural chemicals is easy contaminate environment also.Transgenic technology has made major contribution in the insect helping farm crop opposing chewing mouthparts.Such as, the cotton turning Bt toxalbumin has high resistance effect for bollworm.By RNAi interference of transgene technology, the growth of bollworm also can be suppressed.But, for the insect of piercing-sucking mouthparts, as aphid, effectively help this class pest of plant resistant in the urgent need to finding new method.
Summary of the invention
The object of the invention is to overcome deficiency of the prior art, a kind of method strengthening aphid resistance of plant is provided.RNA perturbation technique is applied on transgenic anti-insect plants by the present invention, and exploitation transgenic anti-insect plants, can be subject to the restriction of aphid subspecies, the subspecies that can break through aphid are restricted, significant.
The present invention is achieved by the following technical solutions:
The construction of expressing aphides gene dsRNA proceeds in plant by the present invention, the construction of described expression aphides gene dsRNA is double-strand, and its positive-sense strand and antisense strand contain structure :-X-Ap is reverse for Ap forward, wherein: Ap forward is forward sequence or the fragment of aphides gene, Ap is reversed reverse complementary sequence or the fragment of same aphides gene, X be Ap forward and Ap oppositely between intervening sequence; In plant, the carrier of structure, after transcribing, forms the dsRNA of following form:
wherein: || represent Ap forward and Ap oppositely between the hydrogen bond that formed.
Described construction is positioned on expression vector, and described expression vector also comprises can in the promotor of plant transcription.
Described aphides gene is that aphid grows necessary gene or the metabolic detoxification gene of aphid.
Described plant is selected from: dicotyledons, monocotyledons or gymnosperm.
The present invention has no particular limits for being applicable to plant of the present invention, as long as it is applicable to the conversion operation of carrying out gene, as various farm crop, flower plant or forestry plant etc.
Described plant can be (being not limited to): dicotyledons, monocotyledons or gymnosperm.
More specifically, described plant includes, but is not limited to: Arabidopis thaliana, paddy rice, wheat, corn, cotton, soybean, rape, Chinese sorghum, tobacco, chrysanthemum etc.
The length of described intervening sequence is 100-1000bp.
Described dsRNA is processed to siRNA in plant materials.
Find that the siRNA expressing aphides gene in plant is after being taken by aphid after deliberation, can reach the object significantly suppressing aphides gene, the impact by barriers such as the digested systems of aphid body is less or unaffected.Therefore, can utilize the siRNA of the aphides gene produced in transgenic plants, nationality is taken food by aphid and enters in aphid body, exercises the interference to target RNA, suppresses the expression of target gene.
The present invention utilizes RNA interference mechanism, using plant as medium to the method suppressing aphid to grow.That is: the construction comprising forward and reverse aphides gene (or fragment) sequence is imported in plant, this construction can express the dsRNA of aphides gene in plant materials, described dsRNA is processed to siRNA, insect is after having taken described plant, take in this siRNA, in aphid body, suppress the table of described aphides gene, thus reach the object suppressing aphid growth.
The present invention also utilizes to have two genes play an important role in the growing of aphid in aphid, and from black peach aphid (Myzus persicae), cloned the total length of these two genes, called after DDB1 and CYP6-1. respectively, inhibit the expression of DDB1 or CYP6-1 gene, the growth significantly suppressing aphid can be obtained.
" RNA disturbs (RNA interference; RNAi) " of the present invention refers to that some little double-stranded RNAs can block the expression of particular target gene in body efficiently, specifically, impel ripe mRNA to degrade, make biont show the phenotype of specific gene disappearance.RNA interference is the gene silencing suppression in the mRNA level in-site of high special.
" siRNA (small interfering RNA; siRNA) " of the present invention refers to a kind of short-movie section double stranded rna molecule, can with the mRNA of homologous complementary sequence for target, degrade specific mRNA, and this process is exactly RNA interference channel (RNA interference pathway).
The length of the fragment of aphides gene of the present invention is at least 40bp, can be such as 50bp, 100bp, 200bp, 1000bp.Full-length gene can certainly be adopted.
The construction of described expression aphides gene dsRNA imports in plant by the present invention, and at plant interior expression aphides gene dsRNA, described dsRNA is processed to siRNA, and its length is about 21-25nt.
Usually, described construction is positioned on expression vector.Described expression vector is usually also containing promotor, replication orgin and/or marker gene etc.Method well-known to those having ordinary skill in the art can be used for building expression vector required for the present invention.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as kantlex, gentamicin, Totomycin, amicillin resistance.
Comprise the carrier of above-mentioned suitable gene order and suitable promotor or control sequence, may be used for transforming suitable host.In the method for the invention, described host carries the host that described expression vector also can be passed to vegetable cell by described expression vector any being suitable for.As: as described in host be agrobacterium tumefaciens.
The ultimate principle of RNA of the present invention interference is: be medium with plant, the siRNA (siRNA) aphid being taken its gene (as DDB1 gene) can be disturbed to express, thus suppresses the growth of aphid.More specifically, described principle is: by the double-stranded RNA (dsRNA) of transgenic method by plant interior expression aphides gene (total length or part), abundant siRNA is processed to form in plant materials, also a large amount of siRNA is taken in while aphid takes food this transgenic plant, described siRNA is entering after in aphid body and can match with said target mrna, and the silencing complex guiding RNA to induce (RISC) cuts off said target mrna sequence, block the expression of target gene.In the process, also can produce a large amount of secondary siRNAs (secondary siRNA), by the transfer of siRNA, cause systematic gene silencing (systematic gene silencing), block the expression of the target gene of all cells in organism, growing of aphid of interference even causes the death of aphid, thus effectively controls aphid to the harm of plant.As shown in Figure 1, wherein Dicer is the nuclease of RNA enzyme III sample; RISC is the silencing complex of RNA induction, and " interval " represents intervening sequence.Utilize described principle, effectively can improve the insect-resistance of plant for aphid.
The present invention utilizes a GUS sequence, two ends connect upper complementary gene order, after transfered cell, can produce " neck-ring " structure, and " neck " part can by the tiny RNA of plant processing into about about 21-25nt, and this tiny RNA especially effectively can suppress the expression of goal gene.RNA perturbation technique is applied on transgenic anti-insect plants, utilize the target gene that DDB1 and CYP6-1 disturbs as RNA, the resistance of plant to aphid is strengthened by suppressing its expression, the transgenic anti-insect plants of development of new, the restriction of aphid subspecies can be subject to, the subspecies that can break through aphid are restricted, significant.
The agrobacterium tumefaciens that the present invention relates to is a kind of open biomaterial for many years, as: Chinese patent literature number: CN101665804, title: the method for cultivating Agrobacterium tumefaciens mediated catharanthus roseus transgenic plants; Chinese patent literature number: CN1778913, title: Agrobacterium tumefaciens mediated plasmid is to the method for transformation of cephalosporium acremonium; Etc..
Accompanying drawing explanation
Fig. 1 RNA disturbs aphides gene schematic diagram
In figure, display utilizes the dsRNA of expression of plants aphides gene, suppresses the schematic diagram of related gene expression in aphid body by aphid after taking food this plant, wherein: left figure is the transgenic plant of expressing aphides gene dsRNA; Right figure causes the expression of native gene to be suppressed after aphid takes food described plant.
The structure schematic diagram of Fig. 2 rna interference vector
The qualification schematic diagram of Fig. 3 transgenic positive plant
The transgenic arabidopsis detected containing DDB1 or CYP6-1 sequence dsRNA is shown in figure.
What Fig. 4 transgenic arabidopsis grew aphid affects schematic diagram
The dsRNA transgenic arabidopsis of expressing containing DDB1 sequence or CYP6-1 sequence is shown on the impact of growth of aphid taking food these Arabidopis thalianas in figure.
Embodiment
Below in conjunction with accompanying drawing, embodiments of the invention are elaborated: following examples under premised on technical solution of the present invention, provide embodiment and the process of two groups of embodiments, but protection scope of the present invention are not limited to following embodiment.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, as Molecular Cloning: A Laboratory handbook (Molecular cloning:A laboratory manual, 3rd ed., Sambrook etc., Cold Spring Harbor Laboratory, 2001) and Plant Molecular Biology handbook (Plant Molecular Biology-A Laboratory Mannual, Clark etc., Springer-Verlag, 1997) condition described in, or according to the condition that manufacturer advises.
First group for building gene isolation, the structure of expression vector and conversion, the screening of transgenic progeny, molecular biology identification and detection transgenic plant to the impact of aphid
Embodiment 1 for building dsDDB1, the separation of dsCYP6 gene
From two age aphids, extracting RNA, and be inverted to strand cDNA, with cDNA strand for template, make PCR with following single-minded primer pair:
For obtaining the primer pair of DDB1 gene fragment:
DDB1F：CACC CCTGAAGACCAAGATCCCAAATT
DDB1R：ATCTCATCAAATCACCGCAAACA
For obtaining the primer pair of CYP6-1 gene fragment:
CYP6-1F：CACC AAGTACCCCATAGCTTATAGCATAA
CYP6-1R：CATTTGGTCTTTGAGATTTCTGTTC
After utilizing KOD enzyme to carry out pcr amplification, specific fragment is reclaimed.
The structure of embodiment 2 expression vector and conversion
The structure of 1.35S::dsDDB1,35S::dsCYP6 expression vector
Specific fragment is cloned on ENTR carrier by pENTR-D-TOPO Cloning Kit by the present inventor, form pENTR-D/SD-TOPO-DDB1 and pENTR-D/SD-TOPO-CYP6-1 two ENTR intermediate carriers, reacted by LR afterwards, DDB1 and CYP6-1 two gene fragments are replaced respectively the ccdB lethal gene sequence on pANDA carrier, be built into such as formula the construction described in 1.Wherein intervening sequence is one section of GUS sequence.The carrier built is called 35S::dsDDB1,35S::dsCYP6-1 expression vector.It builds flow process as shown in Figure 2.
2. the conversion of agrobacterium tumefaciens
The conversion of agrobacterium tumefaciens adopts freeze-thaw method.A single bacterium colony GV3101 (purchased from Invitrogen company), 3mL LB substratum (containing 25 μ g/mi Rifampins and 50 μ g/mL gentamicins), 28 DEG C, 220rpm, incubated overnight.2mL bacterium liquid joins 50mL LB substratum (containing 25ug/mL Rifampin and 50ug/ml gentamicin), 28 DEG C, 220rpm, cultivates OD600=0.5 (about 6 hours).30 minutes are placed, 4 DEG C, centrifugal 5 minutes of 5000g on ice.Be resuspended in 20mL0.1MCaCL2,4 DEG C, centrifugal 5 minutes of 5000g.Be resuspended in 1ml0.1M CaCL2,50 μ l/ pipe packing, liquid nitrogen flash freezer, preserve competent cell for-70 DEG C.Mixing, containing goal gene binary vector and 50 μ l/ pipe receptor cells, places 30 minutes, liquid nitrogen flash freezer 1 minute on ice.Bacterium liquid was melted in 5 minutes in 37 DEG C of water-baths, add 1mL LB substratum, 28 DEG C, 220rpm, cultivate 2-4 hour.Get 100 μ L and be coated with LB culture medium flat plate (containing 25 μ g/mLl Rifampins, 50 μ g/mL gentamicins and 50 μ g/mL kantlex).
The screening of embodiment 3 Plant Transformation and transgenic progeny
In the present embodiment, for the transgenosis of Arabidopis thaliana.
The conversion of arabidopsis thaliana adopts flower infusion method (floral dip).Single bacterium colony GV3101, a 3mLLB substratum (containing 25 μ g/mL Rifampins, 50 μ g/mL gentamicins and 50ug/ml kantlex) containing binary vector, 28 DEG C, 220rpm, 24 hours.3ml bacterium liquid, 300ml LB substratum (containing 25ug/ml Rifampin, 50ug/ml gentamicin and 50ug/ml kantlex), 28 DEG C, 220rpm, 16-20 hour.5000rpm10min。Thalline is resuspended in 300ml containing in 5% sucrose solution of 0.02%SilwetL-77.Plant bud part soaked for 10 seconds in bacterium liquid, and preservative film lies against in plastic tub, moisturizing, lucifuge after covering, 24 hours, then upright, grows to and blossom and have seeds in greenhouse.T0 for seed at 4 vernalization 3d, 5 minutes are processed with 10% hypochlorite disinfectant, sterile water wash 3 times, be laid on after resuspended (containing 50 μ g/mL Hyg and 250 μ g/mL Cef) in the MS substratum of 0.6% agar, 22 DEG C, continuous illumination, after about one week, grows in green resistance transplantation of seedlings to Nutrition Soil.
The molecular biology identification of embodiment 4 transgenic plant
In the present embodiment, choose T3 that embodiment 3 obtains for homozygous lines transgenic plant, adopt antibiotic-screening, PCR method verifies transfer-gen plant.
The resistant panel that transfer-gen plant seed is layered on as embodiment 3 carries out screening verification.The blade of separate transgenic plant extracts the DNA of plant by simple and easy CTAB method.And carry out PCR checking with following primer pair,
For verifying the primer pair of DDB1 gene fragment:
DDB1F：CACC CCTGAAGACCAAGATCCCAAATT
DDB1R：ATCTCATCAAATCACCGCAAACA
For verifying the primer pair of CYP6-1 gene fragment:
CYP6-1F：CACC AAGTACCCCATAGCTTATAGCATAA
CYP6-1R：CATTTGGTCTTTGAGATTTCTGTTC
Result is as Fig. 3 A, and shown in B, Fig. 3 A is the positive identification of DDB1 transfer-gen plant, the positive identification of Fig. 3 B then CYP6-1 transfer-gen plant, utilizes above-mentioned primer all can amplify object band from the Arabidopsis plant DNA extracted.
Embodiment 5 detects the dsRNA transgenic plant of expression DDB1 gene or CYP6-1 gene to the impact of aphid
Get growth consistent two age aphid, feed with contrast respectively, dsDDB1 transgenic arabidopsis, dsCYP6-1 transgenic arabidopsis, after 14 days, records the aphid number of every plant.As shown in Figure 4 A, compared with the control, dsDDB1 transgenic arabidopsis, dsCYP6-1 transgenic Arabidopsis plants obtains the aphid resistance significantly improved to result.
Extract the RNA of aphid, with the DDB1 gene of fluorescence quantitative PCR detection aphid or the expression of CYP6-1 gene.
The extraction of aphid RNA:
100mg aphid is after liquid nitrogen freezing also grinding, add 1mL Trizol, mixing placement is after 5 minutes, add 200 μ L chloroform, the centrifugal 5min of 13000rpm, get supernatant to new 1.5mL centrifuge tube, add the dehydrated alcohol of half volume, joining day root RNA after mixing extracts on the RNA column CR3 of test kit, leaves standstill the centrifugal 1min of 2min, room temperature 12000rpm.In adsorption column CR3, add 350 μ L protein liquid removal RW1, the centrifugal 1min of 12000rpm, outwells the waste liquid in collection tube, and is put back in collection tube by adsorption column CR3.Add 80 μ L DNase I working fluids (working fluid composition: 10 μ L DNase I storage liquid+70 μ L RDD solution) to adsorption column CR3 central authorities, room temperature places 15min.Add 350 μ L protein liquid removal RW1, the centrifugal 1min of 12000rpm.500 μ L rinsing liquid RW are added in adsorption column CR3.Room temperature leaves standstill 2min.The centrifugal 30-60s of 12000rpm.Use rinsing liquid RW rinsing more once.The centrifugal 2min of 12000rpm void column.Adsorption column CR3 is placed in stink cupboard and places 15min, thoroughly to dry rinsing liquid remaining in sorbing material.Adsorption column CR3 is put into a new RNase-free centrifuge tube, to unsettled the droppings 30-100 μ L RNase-free ddH20 of adsorption film central authorities, room temperature placement 2min.The centrifugal 2min of 12000rpm.Electrophoresis detection RNA quality, after spectrophotometer quantitative concentrations ,-80 DEG C store for future use.Rna content (μ g)=OD260 × 40 × TotalRNA liquor capacity (μ L).
The expression of quantitative PCR detection aphides gene
According to Reverse Transcription box PrimeScriptTM RT reagent kit explanation, using Random6mers and Oligo dT Primer as reverse transcription primer, utilize ThermoScript II PrimeScriptTM RTase that Total RNA reverse transcription is become cDNA, then SYBR Green I chimeric fluorescent detection method is adopted, with L27 gene in aphid for reference gene, carry out Real-time pcr amplification reaction with gene specific primer.Result as shown in Figure 4 B, takes food the aphid of dsDDB1 transgenic arabidopsis, the expression of its endogenous DDB1 gene with take food compared with adjoining tree, have dropped and be about 30%.And take food the aphid of the transgenosis south mustard of dsCYP6-1, the expression of its endogenous CYP6-1 gene with take food compared with adjoining tree, have dropped and be about 20%.Gene expression analysis shows that transgenosis is effective for the expression of interference aphid native gene.
Should be appreciated that above-described embodiment has no particular limits adopted aphides gene.In order to aphid can be made to be suppressed after taking described plant, the low expression of described gene or do not express the process such as growth, growth, metabolism, breeding that will cause aphid and produce abnormal, even causes the death of aphid.The gene that the growth of described aphid is required is full-length gene or gene fragment.After aphid takes the siRNA described in absorption by piercing-sucking mouthparts, the mode by systemic gene silence causes the silence of the gene of other tissue except enteron aisle or organ, produces the effect that systematicness is reticent.Therefore, the selection of gene is including but not limited to the gene of enteron aisle high expression.
The length of the intervening sequence that above-described embodiment adopts has no particular limits, as long as itself and aphides gene forward sequence and reverse sequence form construction and be directed to after in body, can form the dsRNA shown in formula II.The length of the preferred intervening sequence of above-described embodiment is 100-1000bp;
Above-described embodiment constructs dsRNA expression vector, and by it importing plant, prepares transgenic plant and feeding aphid.Found that, after aphid takes described plant, growth is significantly inhibited.
Claims (5)
1. one kind strengthens the method for Genes For Plant Tolerance black peach aphid property, it is characterized in that, the construction of expressing aphides gene dsRNA is proceeded in plant, the construction of described expression aphides gene dsRNA is double-strand, and its positive-sense strand and antisense strand contain structure :-X-Ap is reverse for Ap forward, wherein: Ap forward is forward sequence or the fragment of aphides gene, and Ap is reversed reverse complementary sequence or the fragment of same aphides gene, X be Ap forward and Ap oppositely between intervening sequence; In plant, the carrier of structure, after transcribing, forms the dsRNA of following form:
wherein: || represent Ap forward and Ap oppositely between the hydrogen bond that formed;
Described aphides gene is CYP6-1 gene, and its sequence is as shown in SEQ ID NO.2;
Described X sequence is GUS sequence, two ends connect upper complementary gene order, after transfered cell, can produce " neck-ring " structure, and " neck " part can be processed into the tiny RNA of 21-25nt by plant, this tiny RNA can suppress the expression of goal gene especially effectively.
2. the method for enhancing Genes For Plant Tolerance black peach aphid property according to claim 1, it is characterized in that, described construction is positioned on expression vector, and described expression vector also comprises can in the promotor of plant transcription.
3. the method for enhancing Genes For Plant Tolerance black peach aphid property according to claim 1, it is characterized in that, described plant is farm crop, flower plant or forestry plant.
4. the method for enhancing Genes For Plant Tolerance black peach aphid property according to claim 3, it is characterized in that, described plant is selected from: dicotyledons, monocotyledons or gymnosperm.
5. the method for enhancing Genes For Plant Tolerance black peach aphid property according to claim 1, is characterized in that, the length of described intervening sequence is 100-1000bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310470965.2A CN103571871B (en) | 2011-04-28 | 2011-04-28 | Method for improving aphid resistance of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310470965.2A CN103571871B (en) | 2011-04-28 | 2011-04-28 | Method for improving aphid resistance of plants |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110107921.4A Division CN102206668B (en) | 2011-04-28 | 2011-04-28 | Method for enhancing aphid resistance of plant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103571871A CN103571871A (en) | 2014-02-12 |
| CN103571871B true CN103571871B (en) | 2015-05-20 |
Family
ID=50044582
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310470965.2A Active CN103571871B (en) | 2011-04-28 | 2011-04-28 | Method for improving aphid resistance of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103571871B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937424A (en) * | 2017-11-07 | 2018-04-20 | 上海交通大学 | The method of dual-gene fusion enhancing aphid resistance of plant |
| CN110004155B (en) * | 2019-04-03 | 2020-09-11 | 中国农业科学院郑州果树研究所 | Disease-resistant gene and protein for controlling plant aversion and aphid resistance characters and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6326193B1 (en) * | 1999-11-05 | 2001-12-04 | Cambria Biosciences, Llc | Insect control agent |
| CN101195821A (en) * | 2006-12-04 | 2008-06-11 | 中国科学院上海生命科学研究院 | Method for improving insect resistance of plant by using RNAi technique |
| CN101497885A (en) * | 2009-02-24 | 2009-08-05 | 河北省农林科学院经济作物研究所 | Anti-aphides gene PPA, preparation thereof and protein encoded thereby |
| CN101851622A (en) * | 2010-01-15 | 2010-10-06 | 中国科学院微生物研究所 | Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof |
-
2011
- 2011-04-28 CN CN201310470965.2A patent/CN103571871B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6326193B1 (en) * | 1999-11-05 | 2001-12-04 | Cambria Biosciences, Llc | Insect control agent |
| CN101195821A (en) * | 2006-12-04 | 2008-06-11 | 中国科学院上海生命科学研究院 | Method for improving insect resistance of plant by using RNAi technique |
| CN101497885A (en) * | 2009-02-24 | 2009-08-05 | 河北省农林科学院经济作物研究所 | Anti-aphides gene PPA, preparation thereof and protein encoded thereby |
| CN101851622A (en) * | 2010-01-15 | 2010-10-06 | 中国科学院微生物研究所 | Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof |
Non-Patent Citations (2)
| Title |
|---|
| Control of coleopteran insect pests through RNA interference;James A等;《Nature Biotechnology》;20071231;第25卷;1322-1326 * |
| Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol;Ying-Bo Mao等;《Nature Biotechnology》;20071130;第25卷(第11期);1307-1313 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103571871A (en) | 2014-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101548017B (en) | Method for modifying insect resistance of plants by utilizing rnai technique | |
| EP2633048B1 (en) | Down-regulating gene expression in insect pests | |
| CN102732554B (en) | A kind of method improving plant anti-insect ability | |
| CN101979548A (en) | Method for improving rice resistance to bacterial leaf blight by using leaf specific expression artificial microRNA | |
| CN102206668B (en) | Method for enhancing aphid resistance of plant | |
| López‐Arredondo et al. | A novel dominant selectable system for the selection of transgenic plants under in vitro and greenhouse conditions based on phosphite metabolism | |
| CN104086637B (en) | Tobacco strigolactones transport protein NtPDR6 and interference expression vector and application thereof | |
| CN103525828B (en) | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof | |
| CN103571871B (en) | Method for improving aphid resistance of plants | |
| CN108795944B (en) | Cotton long-chain non-coding RNA-lnc973 and application thereof in plant salt tolerance | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN105400814A (en) | Method for cultivating insect-resistant transgenic maize | |
| Li et al. | Development of a Simple and Efficient Method for Agrobacterium-Mediated Transformation in Sorghum. | |
| CN110511958B (en) | RNAi vector for simultaneously silencing plutella xylostella arginine kinase gene PxAK and integrin beta 1 subunit gene Px beta | |
| CN110438151B (en) | RNAi vector for plant-mediated silencing of plutella xylostella arginine kinase gene PxAK and application thereof | |
| CN104988175B (en) | Application of the tomato HsfA1a genes in plant autophagosome activity and drought resistance is improved | |
| Chen et al. | A novel T-DNA vector design for selection of transgenic lines with simple transgene integration and stable transgene expression | |
| CN106191075A (en) | A kind of Populus deltoides Bartr.cv. extensin gene and encoding proteins thereof and application | |
| CN110982921B (en) | Application of cymbidium miR159a in accelerating plant life cycle | |
| CN110964724B (en) | Application of cymbidium goeringii miR390c in enhancing cold resistance of plants | |
| CN105420241B (en) | Promoter of watermelon ClCP2 genes and its preparation method and application | |
| CN111500624B (en) | Use of CrSMT genes to increase resistance of plants to biotic and abiotic stress | |
| CN111500627B (en) | Application of miRNA (micro ribonucleic acid) from Malus sieversii in drought resistance | |
| CN115807010B (en) | Honeysuckle leaf glandular hair-growing gene and application thereof | |
| Tuteja | A method to confer salinity stress tolerance to plants by helicase overexpression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20171204 Address after: 223001 science and Technology Industrial Park, Jiangsu, Huaian science and technology road, No. 18 Patentee after: North Jiangsu Institute of Shanghai Jiao Tong University Address before: 200240 Dongchuan Road, Shanghai, No. 800, No. Patentee before: Shanghai Jiao Tong University |
|
| TR01 | Transfer of patent right |