CN103555749B - Method for in vitro efficient construction of multi-copy Pichia expression vector - Google Patents

Abstract

The present invention provides a method for in vitro efficient construction of a multi-copy Pichia expression vector. The method comprises: 1) based on a pPIC9K expression vector, constructing a vector pHBM905A; 2) constructing a recombinant vector pHBM905BDM; 3) selecting exogenous gene protein requiring being expressed; 4) constructing exogenous gene protein-containing single-copy recombinant vector pHBM905BDM-gene-1; and 5) based on a Biobrick method, constructing a new multi-copy vector pHBM905BDM-gene-n having an artificial in vitro tandem duplication expression cassette type structure. According to the present invention, based on a series of transformations on the pPIC9K expression vector, the multi-copy recombinant vector pHBM905BDM suitable for in vitro construction is constructed; construction of the exogenous gene-containing single-copy recombinant vector pHBM905BDM-gene-1 and the multi-copy recombinant vector pHBM905BDM-gene-n is achieved; and the high-copy recombinant plasmids are obtained through digestion and enzyme linkage on the basis of the copy 1 with right sequencing, such that re-sequencing is not required so as to save cost, save time, save labor, and substantially increase expression ability of exogenous gene protein.

Description

A kind of method of in vitro structure multi-copy Pichia Expression Vector

Technical field

The present invention relates to the in vitro efficient method building multi-copy Pichia Expression Vector, belong to gene engineering technology field.

Background technology

Pichia pastoris phaff expression system originates from the eighties in 19th century, relatively evening, but Later development is quick.Pichia pastoris phaff has become a kind of exogenous protein expression system of maturation.

Conventional pichia pastoris phaff expression vector contains some common features.A lot of carrier all selects pichia pastoris phaff HIS4 gene as selected marker.Derive from the 3 ' AOX1 held 3 ' flanking sequence of pichia pastoris phaff genome AOX1 gene, be also present in a lot of carrier, and can be used as the site of exogenous origin gene integrator and insertion.Using maximum is from yeast saccharomyces cerevisiae MF α-SS leading peptide encoding sequence.

In pichia pastoris phaff expression system, alcohol oxidase (AOX) promotor is most popular.MF α-SS is most popular signal sequence, upon translation, MF α-SS signal peptide by peptase identification, and excise by kex2 proteolytic enzyme, thus form ripe protein.The content affecting pichia yeast expression system secretory protein mainly contains several factor: (1) promotor, (2) signal peptide, and (3) express the copy number that box structure is integrated in Host Strains.So the optimization of current pichia yeast expression system is mainly set about from these aspects.

It is reported, improve the most effective means that copy number that target gene box structure integrates in Host Strains is the expression amount increasing recombinant protein in individual cells.Screening high copy bacterial strain has 2 kinds of methods usually: 1) depend on restriction enzyme, artificial external structure height copy recombinant plasmid; 2) expression vector containing resistance screening mark is selected." biological brick " technology of use (" Biobrick "), utilizes simple means, sets up, finally can build large-scale complicated multiple copied system from the simplest assembly.

One of current most popular yeast expression vector is pPIC9K carrier (Invitrogen Company), though this carrier at present a lot of foreign protein of successful expression, it also has himself limitation.

1) clonal fashion is complicated.Goal gene is cloned into the clonal fashion depending on digestion with restriction enzyme and ligase enzyme enzyme company that this carrier is all, the multiple clone site place of this carrier only has four restriction enzyme sites, wherein two restriction enzyme sites being of little use, when this makes cloned foreign fragment, alternative insertion point greatly reduces; And if with PCR primer clone goal gene, must consider whether object fragment has this restriction enzyme digestion sites, because the restriction enzyme site on this carrier is limited, so will be restricted in different gene clone to carrier, so a lot of gene internal may will be caused also to include restriction enzyme site needed for clone, cause goal gene to be cloned into this carrier will suddenly change some restriction enzyme sites of its gene internal, thus make cloning process complicated;

2) biological safety is inadequate.After goal gene is cloned on pPIC9K carrier, linearizing recombinant plasmid in the way to insert homologous recombination in pichia pastoris phaff host genome, can get on along with destination gene expression box is incorporated into Yeast genome together due to the expression Cassette-like elements " Amp " of the anti-penbritin on pPIC9K with in intestinal bacteria for the element " Ori " of replication initiation, the genetic engineering bacterium built is made to have certain resistance like this, and copy number is higher, resistance is stronger, if resistant gene is leaked in environment accidentally, just may increase the risk of environmental organism security, and copy number is higher, resistance is stronger, 3) efficiency of linearized fragment conversion is low.After the recombinant plasmid SalI linearizing of traditional pPIC9K vector construction, because " Amp+Ori " element gets on along with destination gene expression box is incorporated into Yeast genome together, linear fragment is too large, and transformation efficiency just reduces greatly; 4) what pPIC9K carrier adopted is AOX1 promotor, although control methods are very rigorous, the transcriptional level of this promoters driven mRNA is not also very high, need the activity strengthening promotor further; 5) signal sequence that pPIC9K carrier uses is the DNA sequence dna from encoding Saccharomyces cerevisiae MF α-SS sequence.Yeast saccharomyces cerevisiae and pichia spp belong to yeast, but still there is a certain distance in codon-bias, make it not reach best effect to the expression and secretion of foreign protein; 6) owing to there is the dosage effect of gene, most of gene, along with the increase of copy number, transcribing of goal gene also greatly improves, thus likely improves the expression amount of goal gene.The frequency occurred due to yeast expression vector multiple copied traditional is at present very low, under state of nature, if the expression vector proceeding to pichia pastoris phaff is single copy, occur after conversion that the probability of multi-copy integration is about 1-10%, and uncontrollable (Cereghino JL, CreggJM.Heterologous protein expression in the methylotrophic yeast Pichia pastoris. [J] the FEMS Microbiol Rev.2000 of copy number; 24 (1): 45-66), there is randomness, in body, method can screen the His+ transformant inserting multiple copied foreign gene, but efficiency is very low, the transformant screening q.s just can obtain the transformant of high copy, substantially increases cost and the workload of screening high copy bacterial strain like this.Because pPIC9K carrier contains that antibiotic expression cassette unit (" kan ") of anti-card of bacterial origin, give pichia spp G418 resistance, so now general is all screen high copy transformant with different G418 resistance levels, but this screening method defectiveness: is to cause false negative, because the new cell transformed needs the meta-bolites of the anti-G418 of temporal expressions q.s, because yeast growth is much slower than bacterium, the meta-bolites that major part recombination yeast is accumulating abundant anti-G418 has just been killed before microbiotic to resist on flat board, two is due to the increase along with copy number, and the copy number of " kan " that Yeast genome is integrated also increases, if " kan " is leaked in environment, brings certain risk may to the biological safety of environment.

Based on some more than existing pPIC9K expression vector defects, the present invention is based on a series of transformation of pPIC9K expression vector, propose a kind of in vitro efficient method building the yeast expression vector of multiple copied, the multiple copied of destination gene expression box can be realized in vitro, pichia yeast expression system marking protein is improved a lot.

Summary of the invention

The object of the invention is to propose a kind of in vitro efficient method building multi-copy Pichia Expression Vector, a series of transformation is carried out to pichia pastoris phaff Expression vector pPIC9K, to optimize clonal fashion and the expression amount improving target protein.

Specific practice following (see Fig. 1):

1. carrier construction pHBM905A.

First on the basis of original yeast expression vector pPIC9K, design following primer to increase respectively different fragments, according to the fragment (the corresponding NO 1,2,3,4,5,6 of sequence table) that the primer amplification of table 1 is corresponding, then overlapping PCR method is utilized, by 1,2,3 fragment covers build up a large fragment and called after A, by 4,5,6 fragment intussusception one large fragments called after B.A, B fragment is all after Dpn I process digestion template, after reclaiming test kit recovery purifying with glue, Segment A and fragment B are mixed according to 1:1, transformation of E. coli DH10 β competent cell, incubated overnight, when growing obvious bacterium colony on flat board, select conversion bacterium colony, extract plasmid in a small amount, carry out order-checking qualification respectively.Check order correct recon with regard to called after carrier pHBM905A.

Table 1

The key distinction of the pHBM905A that such transformation obtains and original pPIC9K carrier is: (1) " Amp+Ori " element is inserted in HIS4 gene order; (2) " Kan " resistant gene box structure is inserted between element " a-MF " and 3 ' AOX1 (TT) as stuffer, and the multiple clone site element " MCS " in original pPIC9K carrier is eliminated; (3) recognition site of restriction enzyme enzyme NotI and CpoI is introduced respectively at " Kan " resistant gene box structure 3 ' and 5 ' end.

2. build recombinant vectors pHBM905BDM

1) conventional gene engineering method synthesis d1+2 × 201 AOX1 promoter mutation body piece section (7), MF4I-SS signal peptide sequence 4I-MF fragment (8), kana+3 ' AOX1 (TT) is adopted " fragment (9) (the corresponding NO 7,8,9 of sequence table);

Concrete process is as follows:

Synthesis d1+2 × 201 AOX1 promoter mutation body piece section

D1+2 × 201 AOX1 promoter mutation body is by the sequence deletion of-777 to-712 of the wild-type AOX1 promoter sequence on pPIC9k, and the sequence of tumor-necrosis factor glycoproteins-203 to-190 obtains (Hartner FS, Ruth C, Langenegger D, Johnson SN, Hyka P, Lin-Cereghino GP, et al.Promoter library designed for fine-tunedgene expression in Pichia pastoris. [J] Nucleic Acids Res.2008; 36 (12): e76.).First with above-mentioned carrier pHBM905A for template, carry out PCR (primer pair sequence is in table 2) with primer pair 2 × 201-F, 2 × 201-R, introduce the recognition site of EcoRI+XbaI at the 5 ' end of d1+2 × 201 AOX1.Reclaim test kit with gel again and gel recovery is carried out to this PCR primer, obtain about 1kb fragment, called after d1+2 × 201 AOX1.

Synthesis MF4I-SS signal peptide sequence 4I-MF fragment

According to the aminoacid sequence of yeast saccharomyces cerevisiae MF α-SS signal peptide, utilize the online software of DNAWorks, according to pichia spp codon-bias, sequence optimisation is carried out to it, then the encoding sequence (MF4I-SS) of this signal peptide of synthetic.Compare to the nucleotide sequence before and after optimizing with software DNAman, result shows 54 Nucleotide and suddenlys change, and homology is 84.87%.The detailed process of transformation is utilize overlapping PCR method, with 14 primers (MF4I-1-MF4I-14) mutually each other template carry out pcr amplification, there will be the goal gene 4I-MF fragment of a small amount of total length in reaction system.Again with this PCR primer for template, carry out second and take turns pcr amplification, obtain more object fragment.PCR primer (408bp) reclaims after test kit recovery purifying for subsequent use through V-gene gel, and called after 4I-MF.

Amplification " kana+3 ' AOX1 (TT) " fragment

With carrier pHBM905A for template, with Kan-F and BS-3AOX1 (TT)-R primer pair amplifies, introduce the recognition site of SpeI+BamHI at the 3 ' end of 3 ' AOX1 (TT).Obtain the fragment of about 1.6kb, then with gel recovery test kit, gel recovery is carried out to this PCR primer, called after " kana+3 ' AOX1 (TT) ".

2) use the method for overlapping by d1+2 × 201 AOX1,4I-MF, " kana+3 ' AOX1 (TT) " cover builds up a large fragment, about about 2.9kb, reclaim test kit with gel and gel recovery is carried out to this PCR primer, and called after fragment 10.

3) with the anti-method amplification vector skeleton expanded

Take pHBM905A as template, obtain the fragment (the corresponding NO 10 of sequence table) of about 6kb with primer pair AMP-F, AMP-R amplification, reclaim test kit with gel and gel recovery is carried out to this PCR primer, and called after 11 fragment.

4) by mode (the Zhu D without enzyme clone, Zhong X, Tan R, Chen L, Huang G, Li J, et al.High-throughput cloning of human liver complete open reading frames using homologousrecombination in Escherichia coli. [J] Anal Biochem.2010; 397 (2): 162-7) 10 fragments and 11 fragment assemblies are obtained carrier pHBM905BDM.

By this 1 fragment and 2 fragments Dpn I digestion process 2 hours, after again solution recovery purifying being carried out to these 2 fragments, by these two fragments with the volume mixture transformation of E. coli DH10 β competent cell of 1:1, incubated overnight, when growing obvious bacterium colony on flat board, select conversion bacterium colony, extract plasmid in a small amount, carry out order-checking qualification respectively.Check order correct person, can obtain destination carrier pHBM905BDM.

The difference of pHBM905BDM (the corresponding NO 11 of sequence table) carrier and pHBM905A (the corresponding NO 12 of sequence table) carrier: 5 ' AOX1 promotor is replaced to d1+2 × 201 AOX1 promotor by (1); (2) a-MF signal peptide is replaced to 4I-MF signal peptide; (3) introduce the recognition site of EcoRI+XbaI at 5 ' end of d1+2 × 201 AOX1 promotor, introduce the recognition site of SpeI+BamHI at the 3 ' end of 3 ' AOX1 (TT).

Primer pair sequence table 2

The synthetic primer of MF4I-SS encoding gene:

MF4I-1 5'ATAATTGCGACTGGTTCCAATTGACAAGTTGTTGATCTTGACTACTT 3'

MF4I-2 5'CTTAGATCTTCTCAAGTTATCGTTAAAAGTAGTCAAGATCAACAACTT 3'

MF4I-3 5'ACGATAACTTGAGAAGATCTAAGAACAACtaaCTGTTTGAAACTATGGCTA 3'

MF4I-4 5'CTATAAAGATAGATGGAAATCTTGGAATAGCCATAGTTTCAAACAGTTAG 3'

MF4I-5 5'CAAGATTTCCATCTATCTTTATAGCTGTCTTGTTTGCTGCATCTTCTG 3'

MF4I-6 5'AGTAGTAGTGTTAACTGGAGCAGCCAAAGCAGAAGATGCAGCAAACAA 3'

MF4I-7 5'GCTCCAGTTAACACTACTACTGAAGATGAAACTGCTCAAATTCCAGCT 3'

MF4I-8 5'TTCCAAATCAGAGTAACCAATAACAGCCTCAGCTGGAATTTGAGCAGT 3'

MF4I-9 5'ATTGGTTACTCTGATTTGGAAGGTGATTTTGATGTTGCTGTTTTGCCA 3'

MF4I-10 5'TAACAAACCGTTGTTAGTAGAGTTAGAAAATGGCAAAACAGCAACATC 3'

MF4I-11 5'CTCTACTAACAACGGTTTGTTAGAGGAAGCCGAGGCTGAAGCTGAACC 3'

MF4I-12 5'AATAGAGGCAATAGTAGTATTAATGAACTTTGGTTCAGCTTCAGCCTC 3'

MF4I-13 5'CATTAATACTACTATTGCCTCTATTGCTGCTAAGGAAGAAGGTGTTTC 3'

MF4I-14 5'GCGCCGGACCGGGATCTTAATTCTACTTCCAAAGAAACACCTTCTTCCTTAGC 3'

Plasmid pHBM905BDM transforms primer

AMP-F:5'ATCGATAAGCTTTAATGCGGTAGTTTA 3'

AMP-R:5'AGATCTTGAGATAAATTTCACGTTTAA 3'

2×201-F:5'ttatctcaagatcGAATTCTCTAGAAGATCTAACATCCAAAGACGAAAGGTT3'

2×201-R:5'tataaagatagatggAAATCTTGGAATAGCCATAGTTTCAA 3'

Kan-F:5'gaaggtgtttctttggaaGTAGAATTAAGATCCCGGTCCG 3'

BS-3AOX1(TT)-R:5'attaaagcttatcgatGGATCCACTAGTAAGCTTGCACAAAC 3'

3, select the exogenous gene albumen that need express and be labeled as gene, the carrier pHBM905BDM that the present invention builds is suitable for can at the gene protein of Pichia anomala expression.Such as chitosanase gene (chi, GenBank:BBZ88800.1), mannase gene (man, GenBank:AF324506.1), inscribe β-N-acetyl-glucosamine glycosidase genes (Endo H, GenBank:P04067.1) etc.

4, the list copy recombinant vectors pHBM905BDM-gene-1 containing exogenous gene albumen is built.

Detailed process following (see accompanying drawing 2):

Pass through design of primers, GTCA is added at 5 ' end of goal gene gene forward primer, 5 ' end of reverse primer adds GGCCA, after using high-fidelity enzymatic amplification goal gene fragment, reclaims, then under dTTP existent condition, with T4 archaeal dna polymerase in 12 DEG C of these fragment 20min of process, generate sticky end, pHBM905BDM plasmid is cut through restriction enzyme Cop I and Not I successively enzyme simultaneously, produce two strand sticky ends with fixing base, agarose gel reclaims object fragment.Finally, by the carrier after double digestion with fragment after the process of T4 archaeal dna polymerase after connection test kit (Solution I) ligase enzyme 16 DEG C of Takara company is connected 2h, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, some transformants of picking extract plasmid in a small amount, cut qualification through the comparison of plasmid size, PCR qualification and Restriction Enzyme enzyme and obtain complete recombinant plasmid, by recon correct for qualification order-checking, check order correct person's called after pHBM905BDM-gene-1.

5, based on Biobrick method, the novel vector pHBM905BDM-gene-n (see accompanying drawing 3) that the outer tandem sequence repeats of prosthesis expresses box structure multiple copied is constructed.

By part recombinant plasmid pHBM905BDM-gene-1 EcoRI+SpeI double digestion, agarose gel reclaims and obtains fragment C, part pHBM905BDM-gene-1 is used XbaI+BamHI double digestion, agarose gel reclaims and obtains fragment D, part pHBM905BDM-gene is used EcoRI+BamHI double digestion, agarose gel reclaims and obtains pHBM905BDM carrier framework.Carrier framework after double digestion, fragment C and fragment D are mixed with 1:2:2, connect after 2h through Solution I ligase enzyme 16 DEG C, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, cuts qualification through the comparison of plasmid size, PCR qualification and enzyme and obtains 2 correct copy recombinant plasmid pHBM905BDM-gene-2.3 copies, just on the basis of 2 copies, just can obtain by similar above-mentioned steps, by that analogy, just can obtain the above recombinant plasmid of 3 copies.And the recombinant plasmid of these high copies is cut enzyme at the enzyme on the 1 correct basis copied that checks order to get continuously, without the need to checking order again, so just can be cost-saving, time saving and energy saving.

The advantage of the improved carrier pHBM905BDM of the present invention

(1) improve the security of genetic engineering bacterium, linearizing clip size reduces, and improves transformation efficiency.First on the basis of original yeast expression vector pPIC9K, element " Amp+Ori " on carrier pPIC9K is inserted in HIS4 gene order, with " Amp " resistant gene screening recon, recombinant plasmid is with after SalI linearizing, " Amp+Ori " element is cut off, only having HIS4 unit and destination gene expression box to insert is incorporated in pichia spp host genome, resistant gene Amp expression cassette does not insert and is incorporated in pichia spp host genome, this reduces resistant gene and be accidentally leaked to the risk and disadvantageous effect that environment brings to the biological safety of environment, recombinant plasmid is with after SalI linearizing, and because element " Amp+Ori " is all cut off, effective fragment reduces, and substantially increases transformation efficiency.

(2) based on the exonuclease activity of T4 archaeal dna polymerase, optimize clonal fashion, cloning process is simplified.Improved carrier pHBM905BDM introduces restriction enzyme NotI and CpoI recognition site respectively in the upstream and downstream of " Kan " tolerant gene expression box.The PCR primer of exogenous sequences, under the protection of dTTP, with the process of T4 archaeal dna polymerase, utilize its 3 '-5 ' exonuclease activity, produce the sticky end identical with the linear carrier skeleton after NotI with CpoI double digestion, then by the carrier framework after double digestion with exogenous sequences after the process of T4 archaeal dna polymerase after connection test kit (Solution I) ligase enzyme 16 DEG C of Takara company is connected 2h, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, through the comparison of plasmid size, PCR qualification and Restriction Enzyme enzyme cut qualification just can obtain complete recombinant plasmid.This approach avoid the complex operations of PCR fragment double digestion; but also the restriction enzyme site of gene internal can be considered; eliminate the complex operations such as the sudden change of gene internal restriction enzyme site; and do not need to add restriction enzyme recognition sequence and extra protection base at PCR fragment 5 ' end; decrease primer length; reduce cost, and have 4 different bases due to outstanding sticky end, just greatly reduce carrier from the probability connected.

(3) based on AOX1 promotor, optimal startup subsequence, improves the transcriptional level of mRNA, thus may improve the expression amount of foreign protein.In pichia pastoris phaff expression system, promotor the most frequently used is at present wild-type AOX1 promotor.Research report, some are derived from the mutant of wild-type AOX1 promotor, can affect the expression level of foreign protein.There is bibliographical information, d1+2 × 201 AOX1 promoter mutation body (Hartner FS, Ruth C, Langenegger D, Johnson SN, Hyka P, Lin-Cereghino GP, et al.Promoter library designed for fine-tuned geneexpression in Pichia pastoris. [J] Nucleic Acids Res.2008, 36 (12): e76.) more transcribing of mRNA can effectively be improved than original AOX1 promotor, thus likely improve the expression amount of foreign protein, so the promoter mutation body d1+2 × 201 AOX1 promotor that the present invention has selected to make exogenous protein expression amount increase rate maximum replaces the AOX1 promotor on carrier pHBM905A, transformation obtains novel vector pHBM905BDM, and select chitosanase gene (chi, etc. GenBank:BBZ88800.1) gene is verified, to determine that d1+2 × 201 AOX1 saltant type promotor is on the impact of foreign protein expression amount.

(4) based on the MF α-SS signal peptide deriving from yeast saccharomyces cerevisiae, optimize signal peptide sequence, improve protein expression amount to a certain extent.Because different systems exists the preferences of codon, the method is the aminoacid sequence according to the MF α-SS signal peptide deriving from yeast saccharomyces cerevisiae, after codon optimized with pichia spp, this signal coding sequence of synthetic, to replace the MF α-SS signal coding sequence in initial carrier pPIC9K, build a novel vector pHBM905BDM, and select chitosanase gene (chi, etc. GenBank:BBZ88800.1) gene pairs its carry out cloning and functional verification, to determine that the signal peptide MF4I-SS after optimizing and wild-type MF α-SS is on the impact of foreign protein expression amount.

(5) novel vector pHBM905BDM is applicable to Biobrick method and builds prosthesis outer tandem sequence repeats expression box structure multiple copied.Can realize building multiple copied in vitro by this carrier, greatly can increase the probability of multiple copied like this, and the copy number of gene is in vitro determined, builds the recombinant plasmid of different copy number as required.

Accompanying drawing illustrates:

Fig. 1 is that the present invention builds the in vitro building process realizing high copy yeast expression vector.First on the basis of original Expression vector pPIC9K, " Kan " tolerant gene expression box in carrier pPIC9K is inserted into multiple clone site, restriction enzyme NotI and CpoI recognition site is added in the upstream and downstream of " Kan " tolerant gene expression box, and element " Ampr+Ori " is inserted in HIS4 gene order, obtains carrier pHBM905A.On the basis of pHBM905A carrier, 5 ' AOX1 promotor is replaced to d1+2 × 201 AOX1 promotor again, signal peptide a-MF replaces to 4I-MF, and introduce the restriction enzyme site of EcoRI+XbaI at the 3 ' end of d1+2 × 201 AOX1, introduce the restriction enzyme site of SpeI+BamHI at the 3 ' end of 3 ' AOX1 (TT).

Fig. 2 is the whole process in the present invention, goal gene (gene) being linked the clonal fashion on carrier pHBM905A.GTCA is added at 5 ' end of forward primer by design of primers, 5 ' end of reverse primer adds GGCCA, after using high-fidelity enzymatic amplification goal gene fragment, reclaim, then under dTTP existent condition, with T4 archaeal dna polymerase in 12 DEG C of these fragment 20min of process, generate sticky end, cut through restriction enzyme Cop I and Not I successively enzyme by pHBM905A plasmid simultaneously, produce two strand sticky ends with fixing base, agarose gel reclaims object fragment.Finally, by the carrier after double digestion with fragment after the process of T4 archaeal dna polymerase after connection test kit (Solution I) ligase enzyme 16 DEG C of Takara company is connected 2h, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, cuts qualification through the comparison of plasmid size, PCR qualification and Restriction Enzyme enzyme and obtains complete recombinant plasmid.By the same with carrier pHBM905A for the clonal fashion that goal gene (gene) links carrier pHBM905BDM.

Fig. 3 is the process from the plasmid pHBM905BDM-gene 1 copy external structure multiple copy expression cassette that goal gene is housed.Plasmid pHBM905BDM-gene EcoRI+SpeI double digestion, agarose gel reclaims and obtains Fragment1, pHBM905BDM-gene XbaI+BamHI double digestion, agarose gel reclaims and obtains Fragment2, pHBM905BDM-gene EcoRI+BamHI double digestion, agarose gel reclaims and obtains pHBM905BDM carrier framework.By the carrier after double digestion, fragment Fragment1 and fragment Fragment2, connect after 2h through Solution I ligase enzyme 16 DEG C, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, cuts qualification through the comparison of plasmid size, PCR qualification and enzyme and obtains 2 correct copies.3 copies are just on the basis of 2 copies, and similar above-mentioned steps just can obtain, and by that analogy, just can obtain the above recombinant plasmid of 3 copies.And the plasmid of these high copies is cut enzyme at the enzyme on the 1 correct basis copied that checks order to get continuously, without the need to checking order again, so just can be cost-saving, time saving and energy saving.

Fig. 4 is with exogenous gene albumen--chitoanase (chi) gene verifies that the multi-copy vector pHBM905BDM of structure is on the impact of protein expression amount.Get the yeast supernatant of induction after 5 days, SDS-PAGE electrophoresis detection.M represents protein Marker, 0 swimming lane represents unloaded contrast (GS905A), 1 swimming lane represents GS905A-chi, 2 swimming lanes represent GS905BDM-chi-1 (1 copy), 3 swimming lanes represent GS905BDM-chi-2 (2 copy), and 4 swimming lanes represent GS905BDM-chi-3 (3 copy).Can see that promotor and signal peptide improve to protein expression amount, along with copy number increase also can increase protein expression amount from figure.

Fig. 5 is with exogenous gene albumen--inscribe β-N-acetyl-glucosamine Glycosylase (EndoH) gene verifies that the multi-copy vector pHBM905BDM of structure is on the impact of protein expression amount.Get the yeast supernatant of induction after 5 days, SDS-PAGE electrophoresis detection.M represents protein Marker, and 0 swimming lane represents unloaded contrast (GS905A), and 1 swimming lane represents GS905A-EndoH, and 2 swimming lanes represent GS905BDM-EndoH-1, and 3 swimming lanes represent GS905BDM-EndoH-2, and 4 swimming lanes represent GS905BDM-EndoH-3.Can see that promotor and signal peptide improve to protein expression amount, along with copy number increase also can increase protein expression amount from figure.

Embodiment

With example, the present invention is further described below

Embodiment 1: carrier construction pHBM905A, pHBM905BDM as stated above.

Embodiment 2: build containing exogenous gene albumen--the multiple copied recombinant vectors pHBM905BDM-chi-n of chitoanase (chi).

Cut through restriction enzyme Cop I and Not I successively enzyme by pHBM905A, pHBM905BDM plasmid, produce the carrier with two fixing base strand sticky ends, agarose gel reclaims this carrier.Secondly, according to known chitosanase gene sequence, adopt GeneTool software design chi pF:chi-F:5' gTCAAtGCTGGCAGTCCCAGCCTCT 3' and chi-R:5' gGCCAtTAAGCAAAACACTCAGCCCAAT 3' two primers, primerstar archaeal dna polymerase is used to carry out pcr amplification, obtain chi (650bb) gene fragment, after this fragment agarose gel is reclaimed, under dTTP existent condition, with T4 archaeal dna polymerase 12 DEG C process 20min, generate and pHBM905A, the sticky end that pHBM905BDM carrier matches, reclaims fragment.Then by carrier with fragment after Solution I enzyme 16 DEG C is connected 2 hours, be converted into intestinal bacteria DH10 β competent cell, ampicillin/LB plates screening transformant, through the comparison of plasmid size, PCR qualification and enzyme cut qualification obtain recombinant plasmid.Random choose recombinant plasmid serves the order-checking of extra large Sani Bioisystech Co., Ltd, by recombinant plasmid correct for sequencing result called after pHBM905A-chi, pHBM905BDM-chi-1 respectively.

Again with the plasmid of the correct pHBM905BDM-chi-1 plasmid construction multiple copied that checks order, concrete operation step is as follows:

1) pHBM905BDM-chi-1 plasmid is divided into three parts.A recombinant plasmid pHBM905BDM-chi-1 EcoRI+SpeI double digestion, agarose gel reclaims and obtains fragment 1; Another part of pHBM905BDM-chi-1 XbaI+BamHI double digestion, agarose gel reclaims and obtains fragment 2; Cut with EcoRI and BamH is two for 3rd part, agarose reclaims and obtains pHBM905BDM carrier framework,

2) by above-mentioned carrier framework, fragment 1 is connected 2 hour with 1:2:2 mixing through Solution I enzyme 16 DEG C with fragment 2.3) transformation of E. coli DH10 β competent cell, ampicillin/LB plates screening transformant, cuts qualification acquisition restructuring 2 through the comparison of plasmid size, PCR qualification and enzyme and copies plasmid, without the need to checking order again, called after pHBM905BDM-chi-2.4) plasmid building 3 copies just repeats above-mentioned steps with the plasmid of 2 copies and the plasmid of 1 copy and just can obtain, called after pHBM905BDM-chi-3.

By the unloaded pHBM905A built, pHBM905A-chi, pHBM905BDM-chi-1, pHBM905BDM-chi-2, pHBM905BDM-chi-3 plasmid Sal I linearization for enzyme restriction, by electroporated to Pichiapastoris GS115 competent yeast cells for the digestion products after reclaiming, is then coated with histidine defect substratum MD dull and stereotyped, cultivate 3 days for 28 DEG C, obtain recombinant conversion.Random extraction transformant genome, with it for template, chi pF and chi pR is that primer carries out PCR qualification, the transformant that amplification obtains 650bp product is positive colony, by recombinant clone called after GS905A-chi correct for checking, GS905BDM-chi-1, GS905BDM-chi-2, GS905BDM-chi-3.Finally, correct recombinant conversion of qualification checking is inoculated in 50mL BMGY substratum, 28 DEG C, 200r/min cultivates 48h, to OD ₆₀₀for 6-9, in room temperature centrifugal 5000r/min, 5min, collect thalline, subsequently, thalline is transferred in 25mL BMMY substratum, 28 DEG C, 200r/min cultivation, a methyl alcohol (dosage is 0.5% of culture volume) is added, GS905A-chi, GS905BDM-chi-1 every 24h, GS905BDM-chi-2, GS905BDM-chi-3 positive transformant, after abduction delivering, is induced after 5 days, the protein expression level of sampling analysis different carriers.(see Fig. 4) M represents protein Marker, 0,1,2,3,4 swimming lanes represent unloaded contrast (GS905A) respectively, GS905A-chi, GS905BDM-chi-1, GS905BDM-chi-2, GS905BDM-chi-3 can see that promotor and signal peptide improve to protein expression amount, along with copy number increase also can increase protein expression amount from figure.

Embodiment 3: build containing exogenous gene albumen--the multiple copied recombinant vectors pHBM905BDM-EndoH-n of inscribe β-N-acetyl-glucosamine Glycosylase (EndoH)

Cut through restriction enzyme Cop I and Not I successively enzyme by pHBM905A, pHBM905BDM plasmid, produce the carrier with two fixing base strand sticky ends, agarose gel reclaims this carrier.Secondly, according to known sequence, adopt GeneTool software design two primers:

EndoH-pF:5’ GTCAATGGCTCCAGTTAAACAAGGTCCAACTTCCGTT3’

EndoH-pR:5’ GGCCATTATGGAGTTCTAACAGCTTCAGATCCGTACA3’

Primerstar archaeal dna polymerase is used to carry out pcr amplification, obtain EndoH (1kb) gene fragment, after this fragment agarose gel is reclaimed, under dTTP existent condition, with T4 archaeal dna polymerase 12 DEG C process 20min, the sticky end that generation and pHBM905A, pHBM905BDM carrier match, reclaims fragment.Then by carrier with fragment after Solution I enzyme 16 DEG C is connected 2 hours, be converted into intestinal bacteria DH10 β competent cell, ampicillin/LB plates screening transformant, through the comparison of plasmid size, PCR qualification and enzyme cut qualification obtain recombinant plasmid.Random choose recombinant plasmid serves the order-checking of extra large Sani Bioisystech Co., Ltd, by recombinant plasmid correct for sequencing result called after pHBM905A-EndoH, pHBM905BDM-EndoH-1 respectively.

Again with the plasmid of the correct pHBM905BDM-EndoH-1 plasmid construction multiple copied that checks order, concrete operation step is as follows:

1) pHBM905BDM-EndoH-1 plasmid is divided into two parts.A recombinant plasmid pHBM905BDM-EndoH-1 EcoRI+SpeI double digestion, agarose gel reclaims and obtains fragment 1; Another part of pHBM905BDM-EndoH-1 XbaI+BamHI double digestion, agarose gel reclaims and obtains fragment 2.

2) the pHBM905BDM carrier framework will cut agarose reclaim with EcoRI and BamHI pair, fragment 1 and fragment 2 mix and are connected 2 hours through Solution I enzyme 16 DEG C.

3) transformation of E. coli DH10 β competent cell, ampicillin/LB plates screening transformant, cuts qualification acquisition restructuring 2 through the comparison of plasmid size, PCR qualification and enzyme and copies plasmid, without the need to checking order again, called after pHBM905BDM-EndoH-2.4) plasmid building 3 copies just repeats above-mentioned steps with the plasmid of 2 copies and the plasmid of 1 copy and just can obtain, called after pHBM905BDM-EndoH-3.

By the unloaded pHBM905A built, pHBM905A-EndoH, pHBM905BDM-EndoH-1, pHBM905BDM-EndoH-2, pHBM905BDM-EndoH-3 plasmid Sal I linearization for enzyme restriction, by electroporated to Pichia pastoris GS115 competent yeast cells for the digestion products after reclaiming, is then coated with histidine defect substratum MD dull and stereotyped, cultivate 3 days for 28 DEG C, obtain recombinant conversion.Random extraction transformant genome, with it for template, EndoH-pF and EndoH-pR is that primer carries out PCR qualification, the transformant that amplification obtains 1kb product is positive colony, by recombinant clone called after GS905A-EndoH correct for checking, GS905BDM-EndoH-1, GS905BDM-EndoH-2, GS905BDM-EndoH-3.Finally, correct recombinant conversion of qualification checking is inoculated in 50mL BMGY substratum, 28 DEG C, 200r/min cultivates 48h, to OD ₆₀₀for 6-9, in room temperature centrifugal 5000r/min, 5min, collect thalline, subsequently, thalline is transferred in 25mLBMMY substratum, 28 DEG C, 200r/min cultivation, a methyl alcohol (dosage is 0.5% of culture volume) is added, GS905A-EndoH, GS905BDM-EndoH-1 every 24h, GS905BDM-EndoH-2, GS905BDM-EndoH-3 positive transformant, after abduction delivering, is induced after 5 days, the protein expression level of sampling analysis different carriers.(see Fig. 5) M represents protein Marker, 0,1,2,3,4 swimming lanes represent unloaded contrast (GS905A) respectively, GS905A-EndoH, GS905BDM-EndoH-1, GS905BDM-EndoH-2, GS905BDM-EndoH-3 can see that promotor and signal peptide improve to protein expression amount, along with copy number increase also can increase protein expression amount from figure.

Claims (3)

1. the in vitro method building multi-copy Pichia Expression Vector, is characterized in that step is:

1). carrier construction pHBM905A

First on the basis of original yeast expression vector pPIC9K, design following primer to increase respectively different fragments, according to the fragment that the primer amplification of table 1 is corresponding, then overlapping PCR method is utilized, by 1,2,3 fragment intussusception one large fragments called after A, by 4,5,6 fragment intussusception one large fragments called after B; Segment A and fragment B, all after Dpn I process digestion template, after reclaiming test kit recovery purifying, mix according to the mole ratio of 1:1, turn with glue by A, B fragment

Table 1

Change intestinal bacteria DH10 β competent cell, incubated overnight, when growing obvious bacterium colony on flat board, selects conversion bacterium colony, extracts plasmid in a small amount, carries out order-checking qualification respectively.Check order correct recon with regard to called after carrier pHBM905A;

2). build recombinant vectors pHBM905BDM

A) conventional gene engineering method synthesis d1+2 × 201 AOX1 promoter mutation body piece section (SEQ ID NO:7), MF4I-SS signal peptide sequence 4I-MF fragment (SEQ ID NO:8), kana+3 ' AOX1 (TT) is adopted " fragment (SEQ ID NO:9);

B) by the method for overlapping by d1+2 × 201 AOX1,4I-MF, " kana+3 ' AOX1 (TT) " cover builds up a large fragment, 2.9kb, reclaims test kit carry out gel recovery to this PCR primer with gel, and called after fragment 10;

C) with the anti-method amplification vector skeleton expanded

Take pHBM905A as template, obtain the fragment of 6kb with primer pair AMP-F, AMP-R amplification, reclaim test kit with gel and gel recovery is carried out to this PCR primer, and called after fragment 11;

D) this fragment 10 and fragment 11 are used Dpn I digestion process 2 hours, after again solution recovery purifying being carried out to these 2 fragments, by these two fragments with 1:1 mole ratio mixing transformation of E. coli DH10 β competent cell, incubated overnight, when growing obvious bacterium colony on flat board, select conversion bacterium colony, extract plasmid in a small amount, carry out order-checking qualification respectively.Check order correct person, can obtain destination carrier pHBM905BDM;

3). select the foreign gene that need express to be labeled as gene;

4). build the list copy recombinant vectors containing foreign gene and called after pHBM905BDM-gene-1

5). based on Biobrick method, construct the outer tandem sequence repeats of prosthesis and express the novel vector of box structure multiple copied and called after pHBM905BDM-gene-n.

2. the method for a kind of in vitro structure multi-copy Pichia Expression Vector according to claim 1, is characterized in that the step of the list copy recombinant vectors pHBM905BDM-gene-1 built containing foreign gene is:

Pass through design of primers, GTCA is added at 5 ' end of goal gene gene forward primer, 5 ' end of reverse primer adds GGCCA, after using high-fidelity enzymatic amplification goal gene fragment, reclaims, then under dTTP existent condition, with T4 archaeal dna polymerase in 12 DEG C of these fragment 20min of process, generate sticky end, pHBM905BDM plasmid is cut through restriction enzyme Cop I and Not I successively enzyme simultaneously, produce two strand sticky ends with fixing base, agarose gel reclaims object fragment; Finally, carrier after double digestion is connected after test kit ligase enzyme 16 DEG C connection 2h with fragment after the process of T4 archaeal dna polymerase through the Solution I of Takara company, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, some transformants of picking extract plasmid in a small amount, cut qualification through the comparison of plasmid size, PCR qualification and Restriction Enzyme enzyme and obtain complete recombinant plasmid, by recon correct for qualification order-checking, check order correct person's called after pHBM905BDM-gene-1.

3. the method for a kind of in vitro structure multi-copy Pichia Expression Vector according to claim 1 and 2, is characterized in that the step of the multiple copied recombinant vectors pHBM905BDM-gene-n built containing foreign gene is:

By part recombinant plasmid pHBM905BDM-gene-1 EcoRI+SpeI double digestion, agarose gel reclaims and obtains fragment C, part pHBM905BDM-gene-1 is used XbaI+BamHI double digestion, agarose gel reclaims and obtains fragment D, part pHBM905BDM-gene-1 is used EcoRI+BamHI double digestion, agarose gel reclaims and obtains pHBM905BDM carrier framework; Carrier framework after double digestion, fragment C and fragment D are mixed according to the mole ratio of 1:2:2, connect after 2h through Solution I ligase enzyme 16 DEG C, transformation of E. coli DH10 β bacterial strain, amicillin resistance LB plate screening transformant, cuts qualification through the comparison of plasmid size, PCR qualification and enzyme and obtains 2 correct copy recombinant plasmid pHBM905BDM-gene-2; 3 copies, just on the basis of 2 copies, just can obtain by similar above-mentioned steps, by that analogy, just can obtain the above recombinant plasmid of 3 copies.