CN102805867B - Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor - Google Patents
Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor Download PDFInfo
- Publication number
- CN102805867B CN102805867B CN201210318388.0A CN201210318388A CN102805867B CN 102805867 B CN102805867 B CN 102805867B CN 201210318388 A CN201210318388 A CN 201210318388A CN 102805867 B CN102805867 B CN 102805867B
- Authority
- CN
- China
- Prior art keywords
- nfatc3
- tumor
- multidrug resistance
- transcription factor
- drug
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a new use of a transcription factor NFATC3 (nuclear factor of activated T cell 3), namely an application of the transcription factor NFATC3 as a drug target in reversing multidrug resistance of a tumor. A drug is an NFATC3 inhibitor which comprises tacrolimus, cyclosporin A or VIVIT; and the multidrug resistance of the tumor is mediated by P-gp. The important points of the application are that a close tie between the transcription factor NFATC3 and the multidrug resistance is found, and the NFATC3 inhibitor has an obvious reversing effect on the multidrug resistance of tumor cells, and has little toxic or side effect; and therefore, the invention provides a new target for the design of a new drug which resists the multidrug resistance, of the tumor and a new clue for reversing the multidrug resistance of the tumor.
Description
Technical field
The present invention relates to the new purposes of one of transcription factor NFATC3, relate in particular to transcription factor NFATC3 inhibitor in the application of preparing in tumor multi-drug resistance reversal medicine.
Background technology
Tumor is a class disease of serious harm human health, occupies first of all kinds of causes of the death.Tumor large contingent is suffered from by China at present, and the number of dying from every year tumor exceedes 1,600,000.In the nearly kind more than 200 of antitumor drug of the existing approved listing of China, but along with the extensive use of tumor chemotherapeutic drug, the multidrug resistance problem of tumor highlights, become one of the most common and insoluble problem of chemotherapy of tumors failure, more than 90% tumor patient is died from drug resistance in various degree according to statistics.
Tumor multi-medicine drug-resistant (multidrug resistance, MDR) refer to when tumor cell develops immunity to drugs to a kind of antitumor drug, the antineoplastic agent deposits yields cross resistance different with mechanism of action to structure, thus the curative effect of antitumor drug greatly reduced.Therefore, the generation mechanism of research MDR, overcomes MDR phenomenon and has become study hotspot both domestic and external thereby seek effective drug resistance inversion measure.The MDR of transmembrane protein mediation is the most classical MDR generation mechanism, and wherein modal is P-glycoprotein.P-glycoprotein (P-glycoprotein, P-gp) also claim p170 glycoprotein, a kind of ATP dependency protein called membrane transporters coded by Multidrug resistance gene MDR1, P-gp is a kind of drug efflux pump, multi-medicament can be pumped to extracellular, make medicine in born of the same parents build up minimizing, thereby weaken the cytotoxicity of medicine, finally make tumor cell produce drug resistance.P-gp mainly mediates the MDR that lipotropy antitumor drug causes, comprises that antibiotics is as doxorubicin/amycin (ADM), mitomycin (MMC), and plant medicine is as vincristine (VCR), etoposide (Vp216) etc.According to MDR generation mechanism, select the synthetic new drug that directly acts on drug-resistant tumor of distinctive shot design to carry out targeted therapy, the treatment to tumor is highly profitable.
In recent years, researcher has been found a lot of drug targets relevant to tumor multi-medicine drug-resistant, but the reversal agent of drug resistance of researching and developing or filtering out according to these these drug targets has serious toxic and side effects conventionally, thereby their application are clinically hindered, therefore, find the relevant target spot of new tumor drug resistance, and the multidrug-resistance reversal agent that design filters out high-efficiency low-toxicity on this basis urgently can not be treated.
NFAT(nuclear factor of activated T cells) be nuclear factor of activated T cells, belong to a class transcription factor family, in immunoreation, induced gene is transcribed and played an important role.NFAT is divided into tetra-kinds of hypotypes of NFATC1-NFATC4.NFAT all has expression in the cell of various types of immunocytes (as B cell, NK cell, mastocyte, mononuclear cell and eosinophilic granulocyte) and tumor and formation tumor microenvironment, its activity is subject to the adjusting of the dependent calmodulin, CaM phosphate of calcium ion (Calcineurin), and its activation process is divided into three steps: dephosphorylation, core transposition, raising to DNA affinity.In akinete, NFAT albumen is phosphorylated and is present in cytoplasm, DNA is had to low-affinity, in the case of flowing in the extracellular Ca2＋ being caused by any factor (as flowed in the extracellular Ca2＋ being mediated by transient receptor potential channel TRPC5), above-mentioned calcium ion dependency calmodulin, CaM phosphate will impel the quick dephosphorization acidify of NFAT albumen and enter nucleus, and the NFAT entering after core strengthens the affinity of DNA.NFAT inhibitor can be blocked NFAT path by suppressing above-mentioned calmodulin, CaM phosphate as tacrolimus (FK-506), cyclosporin A (CyclosporinA), VIVIT etc.
At present, both at home and abroad there are no transcription factor NFAT application in reverse multiple drug resistance of tumor as drug target.
Summary of the invention
In view of the foregoing defects the prior art has, the object of the present invention is to provide the new purposes of one of transcription factor NFATC3 inhibitor, that is: transcription factor NFATC3 inhibitor is in the application of preparing in tumor multi-drug resistance reversal medicine.
Described NFATC3 inhibitor comprises tacrolimus, cyclosporin A or VIVIT.
Described tumor multi-medicine drug-resistant is to be produced by P-gp mediation.
Useful technique effect of the present invention is:
Study discovery through the inventor, compared with responsive type tumor cell (as MCF-7/WT), the P-gp albumen that mediation tumor produces multidrug resistance has higher levels of expression in multidrug resistance tumor cells (as MCF-7/ADM), in addition, predict and confirmed that transcription factor NFATC3 can combine with MDR1 promoter region, under the activation flowing in the extracellular Ca2＋ of transient receptor potential channel TRPC5 mediation, thereby the transcriptional activity of transcription factor NFATC3 strengthens the expression that raises p-gp, proves that this transcription factor and tumor multi-medicine drug-resistant are closely related; Experimental result shows, NFATC3 inhibitor (FK-506, CyclosporinA, VIVIT) has obvious reverse effect to the multidrug resistance of tumor cell, and this toxic and side effects within the scope of using dosage of above-mentioned inhibitor is very little; Therefore, the present invention provides new target spot for the design of artitumor multi-medicine-resistant new drug, for the preparation of tumor multi-drug resistance reversal medicine provides new thinking.
Accompanying drawing explanation
Fig. 1 is the process schematic diagram that the NFATC3 after activation and the activation of transcription factor NFATC3 raises MDR1 gene expression.
Fig. 2 is the testing result schematic diagram of MDR1 mRNA transcriptional level in multidrug resistance tumor cells in the embodiment of the present invention 1.
Fig. 3 predicts and confirms the experimental result schematic diagram that transcription factor NFATC3 combines with MDR1 promoter region in the embodiment of the present invention 2.
The testing result schematic diagram of the activation of stream to transcription factor NFATC3 in the extracellular Ca2＋ of TRPC5 mediation in Fig. 4 embodiment of the present invention 3.
The experimental result schematic diagram of the reverse effect of NFATC3 inhibitor to tumor cell multidrug resistance in Fig. 5 embodiment of the present invention 4.
specific embodiment mode
Below in conjunction with specific embodiments and the drawings, the present invention is further illustrated.
As shown in Figure 1, the activation process of transcription factor NFATC3 is divided into three steps: dephosphorylation, core transposition, raising to DNA affinity.The in the situation that of flowing into endochylema (cytosol) in extracellular Ca2＋ passes through calcium channel (ion channel), calcium ion dependency calmodulin, CaM phosphate (A B) will impel the acidify of NFATC3 quick dephosphorization and enter nucleus (nucleus), being combined in promoter (promotor) region that enters the NFATC3 MDR1 gene in nucleus after core, raises the expression of P-gp by regulating and controlling the mRNA transcriptional level of this gene.
Cell line: wild type human breast cancer cell MCF-7/WT deposits storehouse (ATCC) purchased from US mode culture; The human embryonic kidney cell HEK293 of multidrug resistance MCF-7/ADM and energy stably express TRPC5 is prepared and is preserved by Southern Yangtze University's drug design and molecular pharmacology research department.Above-mentioned multidrug resistance MCF-7/ADM preparation method is: the wild type human breast cancer cell MCF-7/WT cell (purchased from ATCC) of newly recovery is cultivated to 2 generation～3 generations under cell culture normal condition, make Growth of Cells stable, in the time that cell converges, digest with pancreatin and go down to posterity, within second day, upgrade culture medium, simultaneously add amycin take 1/10 of MCF-7/WT IC50 as initial concentration, within second day, again change liquid in dosing, and the concentration that maintains amycin is carried out the routine cultivation of going down to posterity, after cytotostatic growth, improving drug level continues to cultivate, until cell can be stable growth in the culture medium of 5 μ g/ml in doxorubicin concentration, obtain, whole preparation process is lasted 8 months, the human embryonic kidney cell HEK293 preparation method of above-mentioned energy stably express TRPC5 is: Examination on experimental operation routinely, respectively TRPC5 gene (is given by the professor D. E. Clapham of Harvard University by EcoR I and Not I, Gene ID:7224) and pCDNA6A carrier (purchased from Addgene company of the U.S.) carry out double digestion, reclaim gene and carrier segments through double digestion, build the recombinant expression plasmid pCDNA6A-TRPC5 of TRPC5 and pCDNA6A, and by this recombinant expression plasmid transfected with human embryonic kidney cell HEK293(purchased from ATCC) gained.
Plasmid and gene: mdr1-luc is purchased from Panomics company of the U.S., for carrying the plasmid of 800bp MDR1 promoter sequence on luciferase reporter gene carrier; PRL-CMV, pCDNA6A and pCDNA6A-NFATc3 are purchased from Addgene company of the U.S.; Green fluorescent protein GFP gene and NFATC3 gene are purchased from Addgene company of the U.S..
Reagent and test kit: Trizol Reagent is purchased from American I nvitrogen company; Hot start Fluo-PCR mix is purchased from Bio-Rad company of the U.S.; NFATC3 antibody is purchased from Abcam company of the U.S.; VIVIT, FK506 and CyclosporinA are purchased from sigma company of the U.S.; VIVIT, FK506 and CyclosporinA are purchased from sigma company of the U.S.; Anti-P-gp(SC-55510) purchased from Santa Cruz company of the U.S.; Horseradish peroxidase-labeled goat anti-mouse IgG (H+L) is (A0216) purchased from the green skies, Shanghai bio tech ltd; Reverse transcription test kit iScript TM cDNA Synthesis Kit is purchased from Bio-Rad company of the U.S.; Two luciferase element reporter gene detection kit are purchased from Promega company of the U.S.; Nucleic acid protein precipitation reagent box chromatin Immunoprecipitation Assay kit is purchased from cell signaling company of the U.S.; Rite-directed mutagenesis test kit Quick Change Site-directed Mutagenesis Kit is purchased from Stratagene company of the U.S..
Experimental apparatus: iCycler iQ quantitative real time PCR Instrument is purchased from Bio-Rad company of the U.S.; Fluorescence microscope is purchased from Japanese Nikon company; Microplate reader is purchased from Bio-Rad company of the U.S.; 5%CO
2constant temperature cell culture incubator is purchased from Thermo company of the U.S.; Albumen transfer printing instrument is purchased from Bio-Rad company of the U.S.; SDS-PAGE electrophresis apparatus system is purchased from Bio-Rad company of the U.S..
In embodiment 1 multidrug resistance tumor cells, the transcriptional level of MDR1 mRNA detects
Experimental technique:
Get respectively MCF-7/WT and MCF-7/ADM each 1 × 10
5individual, and extract total RNA of above-mentioned cell according to method described in Trizol Reagent reagent operating instruction; Cell total rna said extracted being obtained according to method described in reverse transcription test kit iScript TM cDNA Synthesis Kit operating instruction carries out reverse transcription, obtains cDNA, and reverse transcription primer is that mentioned reagent box carries universal primer.
By the mRNA transcriptional level of P-gp in Real-time fluorescence quantitative PCR detection MCF-7/WT and MCF-7/ADM.Real-time pcr amplification carries out on iCycler iQ quantitative real time PCR Instrument.Fluorescence quantification PCR primer design: forward primer is 5 '-GCCGGGAGCAGTCATCTGTGG T-3 ', and downstream primer is 5 '-GAT CCA TTCCGACCTCGCGCT-3 '; Quantitative fluorescent PCR reaction condition is: 95 ℃ of 15s, 53 ℃ of 40s, 40 circulations; Quantitative fluorescent PCR reaction system is: in 20 μ L reaction systems, Hot start Fluo-PCR mix 10 μ L, forward primer (50 pmol/ μ L) 0.2 μ L, downstream primer (50 pmol/ μ L) 0.2 μ L, sterile deionized water 7.6 μ L, above-mentioned cDNA product 2 μ L; PCR object product is 251bp; Use iCycler iQ quantitative real time PCR Instrument software to analyze experimental data.
Experimental result:
Experimental result is shown in Fig. 2.As shown in Figure 2, compared with MCF-7/WT, in MCF-7/ADM, the P-gp mRNA amount of transcribing obviously increases.This experimental result shows, compared with responsive type tumor cell (MCF-7/WT), P-gp has higher levels of expression in multidrug resistance tumor cells (MCF-7/ADM).
Experimental technique:
Use Transcription Factor Binding Sites Prediction software TESS(Transcription Elemen Search System) binding site of prediction NFATC3 and MDR1 promoter region.
Take MCF-7/WT and MCF-7/ADM as sample, detect the combination situation of NFATC3 and MDR1 promoter according to method described in nucleic acid protein precipitation reagent box chromatin Immunoprecipitation Assay kit operating instruction, first adopt chromosome co-immunoprecipitation (CHIP) technology to precipitate the chromatin fragment combining with target protein, then detect precipitated chromatin fragment by PCR.If experimental group and matched group, experimental group adopts NFATC3 antibody as hatching antibody, and matched group adopts new zealand rabbit preimmune serum IgG(to be obtained by Protein G affinity column purification) as hatching antibody; PCR design of primers: forward primer is 5 '-ctctctgtgacagctcagtc-3 ', downstream primer is 5 '-TTGGTAGGTTACTGGGAAGA-3 '; PCR target product comprises the NFATC3 that predicted by above-mentioned Transcription Factor Binding Sites Prediction software TESS and the calmodulin binding domain CaM of MDR1 promoter.
Experimental result:
Experimental result is shown in Fig. 3.From Fig. 3-A, Transcription Factor Binding Sites Prediction software TESS predicts in the promoter sequence at 1500bp place, MDR1 transcriptional start site upstream, have a NFATC3 binding site, its binding site base sequence is that TTTTCC(marks with underscore in the drawings), its base sequence of above-mentioned binding site of Fig. 3-B:-542 ~-537 finger prediction is positioned at region, MDR1 transcriptional start site upstream-542 ~-537,-725 ~-356 fingers are in CHIP experiment, the base sequence of PCR product is positioned at region, MDR1 transcriptional start site upstream-725 ~-356, ATG is the translation initiation site of P-gp, show by agarose gel electrophoresis analysis, in experimental group (Anti-NFATC3), the PCR product amount of MCF-7/ADM sample (being ADM in the drawings) is obviously more than the PCR product amount of MCF-7/WT sample (in the drawings for WT), in matched group (serum), both nearly all do not have PCR product.This experimental result shows, in the MCF-7/ADM of high level expression P-gp, transcription factor NFATC3 can combine with the promoter region of MDR1 gene, and this binding site is positioned at the calmodulin binding domain CaM scope that above-mentioned TESS predicts.
The activation of stream to transcription factor NFATC3 in the extracellular Ca2＋ that embodiment 3 is mediated by TRPC5
Experimental technique:
The HEK293 cell of energy stably express TRPC5 is inoculated in to 24 orifice plates with the density of 30,000 cells in every hole, is placed in 5%CO
2after cultivating 12h in constant temperature cell culture incubator, carry out cotransfection, cotransfection system is: 0.2 μ g reporter plasmid (mdr1-luc or NFAT binding site disappearance plasmid Δ TTTTCC-mdr1-luc, wherein, Δ TTTTCC-mdr1-luc uses rite-directed mutagenesis test kit Quick Change Site-directed Mutagenesis Kit and according to method described in this test kit operating instruction, the base in the binding site region of TESS prediction in embodiment 2 is carried out to deletion mutation gained, design of primers: forward primer is 5 '-GTAAACAAATGAATTTCCATAAAGCTAATTTATCTTTATAATACTTATTACTTCAA ATTCTTGTTACATTT-3 ', downstream primer is 5 '-AAATGAACAA GAATTTGAAGTAATAAGTATTATAAAGATAAATTAGCTTTATGGAAATTCATTTGT TTAC-3 '), 0.2 μ g expression plasmid (pCDNA6A-NFATc3 or empty carrier control plasmid pCDNA6A), 0.04 μ g internal reference plasmid (pRL-CMV), with 100 μ M carbachols (carbachol) process the above-mentioned HEK293 through cotransfection with activate TRPC5, after continuing to cultivate 48h, detect according to method described in luciferase reporter gene detection kit operating instruction, using renilla luciferase activity as internal reference, represent the transcriptional activity of transcription factor NFATC3 with LUC Photinus pyralis LUC Photinus pyralis FL activity.
Experimental technique builds the recombiant plasmid of green fluorescent protein GFP gene and NFATC3 gene routinely, and by the HEK293 of this Transfected Recombinant Plasmid energy stably express TRPC5, process the above-mentioned HEK293 through transfection to activate TRPC5 with 100 μ M carbachol, then use fluorescence microscope with the NFATC3 of green fluorescent protein the location situation in above-mentioned HEK293.
Experimental result:
Experimental result is shown in Fig. 4.From Fig. 4-A, in the time that TRPC5 is not activated by carbachol (Vehicle group), the transcriptional activity of MDR1 does not have significant difference, after carbachol activates TRPC5 activity (Carbachol group), the transcriptional activity of transcription factor NFATC3 significantly strengthens, in the time of base deletion in the binding site region of above-mentioned TESS prediction, there is again obvious decline in its transcriptional activity; From Fig. 4-B, when activating TRPC5, carbachol makes in extracellular Ca2＋ after stream, and along with the prolongation (0min, 10min, 30min, 50min) of time, NFATC3 is transferred to karyon by endochylema gradually, is activated gradually.This experimental result shows, thereby the transcriptional activity that in the extracellular Ca2＋ being mediated by TRPC5, stream can obviously activate NFATC3 raises the expression of p-gp.
The reverse effect of embodiment 4 NFATC3 inhibitor to tumor cell multidrug resistance
Experimental technique:
MCF-7/ADM is inoculated in to 6 orifice plates by the density of 300,000 cells in every hole, after cell attachment, in orifice plate, add respectively NFATC3 inhibitor VIVIT, FK506 and CyclosporinA, VIVIT group drug dose is: 1 μ M, 2 μ M, 0.1%DMSO(matched group); FK506 group drug dose is:, 5 μ M, 10 μ M, 0.1%DMSO(matched group); CyclosporinA group drug dose is: 7.5 μ M, 15 μ M, 0.1%DMSO(matched group), cell is placed in to 5%CO
2after constant temperature cell culture incubator overnight incubation, collect every porocyte, according to routine operation method, use Western blot to detect the impact that various NFATC3 inhibitor are expressed P-gp, wherein, hatching primary antibodie is Anti-P-gp(SC-55510), hatch two resist for horseradish peroxidase-labeled goat anti-mouse IgG (H+L) (A0216).
MCF-7/ADM and MCF-7/WT are inoculated in respectively to 25cm
2cell bottle in, in the time that MCF-7/ADM cell collects 80%, add respectively NFATC3 inhibitor VIVIT(2 μ M), FK506(10 μ M), CyclosporinA(15 μ M) and 0.1%DMSO(matched group), MCF-7/WT, without any drug treating, is placed in 5%CO by cell
2overnight incubation in constant temperature cell culture incubator, collect respectively through the MCF-7/ADM of said medicine processing cell with without the MCF-7/WT cell of drug treating, density according to 7000 cells in every hole is inoculated in 96 orifice plates, after 24 hours, add amycin according to Concentraton gradient, cultivate after 48 hours, detect the drug sensitivity of cell with mtt assay.
Experimental result:
Experimental result is shown in Fig. 5.From Fig. 5-A, compared with matched group, along with the increase gradually of NFATC3 inhibitor concentration, in MCF-7/ADM, P-gp expression is lowered gradually; From Fig. 5-B, multidrug resistance tumor cells (MCF-7/ADM) is starkly lower than wild-type cell (MCF-7/WT) to the sensitivity of amycin, and when multidrug resistance tumor cells (MCF-7/ADM) is after NFAC3 inhibitor is processed, its drug sensitivity obviously strengthens.This experimental result shows, NFATC3 inhibitor has obvious reverse effect to the multidrug resistance of tumor cell, and exploitation and preparation that prompting transcription factor NFATC3 inhibitor can be tumor multi-drug resistance reversal medicine provide new thinking.
Above-described is only the preferred embodiment of the present invention, the invention is not restricted to above embodiment.Be appreciated that the oher improvements and changes that those skilled in the art directly derive or associate without departing from the spirit and concept in the present invention, within all should thinking and being included in protection scope of the present invention.
Claims (2)
1. transcription factor NFATC3 inhibitor, in the application of preparing in tumor multi-drug resistance reversal medicine, is characterized in that: described NFATC3 inhibitor is VIVIT.
2. transcription factor NFATC3 inhibitor, in the application of preparing in tumor multi-drug resistance reversal medicine, is characterized in that according to claim 1: described tumor multi-medicine drug-resistant is produced by P-gp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210318388.0A CN102805867B (en) | 2012-09-02 | 2012-09-02 | Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210318388.0A CN102805867B (en) | 2012-09-02 | 2012-09-02 | Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102805867A CN102805867A (en) | 2012-12-05 |
| CN102805867B true CN102805867B (en) | 2014-07-09 |
Family
ID=47229850
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210318388.0A Active CN102805867B (en) | 2012-09-02 | 2012-09-02 | Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102805867B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103622957B (en) * | 2013-12-11 | 2015-05-20 | 南京大学 | Application of tacrolimus FK506 to preparation of drugs for treating non-small cell lung cancers |
| CN106405114B (en) * | 2016-09-20 | 2018-07-13 | 上海交通大学医学院附属新华医院 | The screening reagent box of the Expression modulation reagent of NFATc3 and the arsenical sensitive cell based on NFATc3 |
| CN111450231B (en) * | 2020-02-12 | 2023-10-31 | 南昌大学第一附属医院 | Application of indirubin derivative in preparing synergist medicine of tacrolimus or cyclosporine |
| CN111454952A (en) * | 2020-04-14 | 2020-07-28 | 台州市立医院 | Screening method of target sequence capable of inhibiting NFAT gene and application thereof |
-
2012
- 2012-09-02 CN CN201210318388.0A patent/CN102805867B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| FK506 reverses adriamycin resistance in a mutidrug-resistant human leukemia cell line;Natazuka T.;《kobe juornal of medical sciences》;19920630;第38卷(第6期);347-363 * |
| Natazuka T..FK506 reverses adriamycin resistance in a mutidrug-resistant human leukemia cell line.《kobe juornal of medical sciences》.1992,第38卷(第6期),347-363. |
| 杨巧，庄英帜.肿瘤多药耐药治疗策略:P-gp抑制剂研究进展.《海南医学》.2011,第22卷(第6期),112-115. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102805867A (en) | 2012-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Long noncoding RNA Malat1 regulates cerebrovascular pathologies in ischemic stroke | |
| Liu et al. | MicroRNA-135a contributes to the development of portal vein tumor thrombus by promoting metastasis in hepatocellular carcinoma | |
| He et al. | MiR-30a-5p suppresses cell growth and enhances apoptosis of hepatocellular carcinoma cells via targeting AEG-1 | |
| Zhou et al. | G-MDSCs-derived exosomal miRNA-143-3p promotes proliferation via targeting of ITM2B in lung cancer | |
| Ai et al. | MicroRNA‑181c suppresses growth and metastasis of hepatocellular carcinoma by modulating NCAPG | |
| CN102805867B (en) | Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor | |
| Feng et al. | RETRACTED ARTICLE: Long noncoding RNA DLEU1 aggravates glioma progression via the miR-421/MEF2D axis | |
| Han et al. | Retracted: Effects of FOSL1 silencing on osteosarcoma cell proliferation, invasion and migration through the ERK/AP‐1 signaling pathway | |
| CN108707668A (en) | A kind of long non-coding RNA SNHG15 and its application in preparing diagnosis and treatment cancer drug | |
| Zhang et al. | Hepatitis B virus X protein upregulates alpha‐fetoprotein to promote hepatocellular carcinoma by targeting miR‐1236 and miR‐329 | |
| Piccolo et al. | Up-regulation of miR-34b/c by JNK and FOXO3 protects from liver fibrosis | |
| Puls et al. | Overlapping morphological, immunohistochemical and genetic features of superficial CD34-positive fibroblastic tumor and PRDM10-rearranged soft tissue tumor | |
| CN110117657A (en) | Application of the circular rna hsa_circ_0004872 in diagnosing gastric cancer | |
| CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
| Feng et al. | mir-218-2 promotes glioblastomas growth, invasion and drug resistance by targeting CDC27 | |
| Yu et al. | miRNA-338-3p inhibits glioma cell proliferation and progression by targeting MYT1L | |
| Liu et al. | Promoting roles of long non-coding RNA FAM83H-AS1 in bladder cancer growth, metastasis, and angiogenesis through the c-Myc-mediated ULK3 upregulation | |
| CN109468380A (en) | IL1R2 is in Prognosis in Breast Cancer assessment and the application in targeted therapy | |
| Ji et al. | Deoxyelephantopin Suppresses Pancreatic Cancer Progression In Vitro and In Vivo by Targeting linc00511/miR‐370‐5p/p21 Promoter Axis | |
| CN116103403B (en) | Biomarker for diagnosis and prognosis of ovarian cancer and application thereof | |
| Xue et al. | miR-485 regulates Th17 generation and pathogenesis in experimental autoimmune encephalomyelitis through targeting STAT3 | |
| CN107488735B (en) | MiR-339-5p is inhibiting the application in prostate cancer with osseous metastasis and TGF-β signal path | |
| CN111996251B (en) | Application of malignant glioma biomarker | |
| JP2024505587A (en) | Composition for preventing or treating kidney disease | |
| CN103505745A (en) | Application of micromolecule RNA used as immunosuppressor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |