CN102787133A - Method for screening transgenic paddy plant by phosphomannose-isomerase (PMI) gene of yeast - Google Patents
Method for screening transgenic paddy plant by phosphomannose-isomerase (PMI) gene of yeast Download PDFInfo
- Publication number
- CN102787133A CN102787133A CN201110129582XA CN201110129582A CN102787133A CN 102787133 A CN102787133 A CN 102787133A CN 201110129582X A CN201110129582X A CN 201110129582XA CN 201110129582 A CN201110129582 A CN 201110129582A CN 102787133 A CN102787133 A CN 102787133A
- Authority
- CN
- China
- Prior art keywords
- gene
- pmi
- callus
- substratum
- sucrose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the technical field of plant genetic engineering and relates to a method for screening a transgenic paddy plant by a phosphomannose-isomerase (PMI) gene of yeast. The method comprises the following steps of primer designing, PCR amplification, carrier construction, genetic transformation, screening and identification. A PMI gene obtained by cloning of brewer's eucaryon yeast is used as a selection marker. Through an agrobacterium-mediated transformation method, the PMI gene is introduced into a paddy acceptor. Transformed paddy callus is screened in mannose mediums having different concentration gradients so that a transgenic paddy plant is obtained. The method has the advantages that in plant transformation and screening, antibiotics and herbicides are not used; and the transgenic paddy plant screened by the method does not contain an antibiotic gene or a herbicide gene and is safe for the environment and a human body.
Description
Technical field
The invention belongs to the plant transgenic technology field, be specifically related to a kind of method of utilizing yeast mannose isomerase genescreen paddy rice transfer-gen plant.
Background technology
Plant genetic engineering starts from the seventies in 20th century, nineteen eighty-three tobacco successfully come out as the first transgenic plant, have at least 35 sections 200 various plants transgenics to succeed at present.Transgenic research provides the new way of an orderly improvement crop for breeding man, thereby it can change the desirable genes that derives from plant, animal or mikrobe over to improvement that plant is realized former kind output, quality or resistance.
The screening system of plant transgene often utilizes antibiotic resistance gene or anti-herbicide gene as selective marker; Their expression product can be removed the toxicity of antibiotics and the generation of antiweed class pair cell; Can remove Totomycin toxicity like the hpt gene as selective marker; The bar gene can be removed Glyphosate 62 IPA Salt toxicity as selective marker, and this transformant that makes produces resistance, and non-transformed cell is called " bearing selective system " because of the screening strategy of responsive " being killed ".Yet traditional microbiotic or antiweed can directly produce transformed cell growth as selective agent and poison; Or have a negative impact indirectly through the Toxic accumulation that non-brownization of conversion necrotic tissue discharges, there is research to claim that this system suppresses the regeneration of transformed plant adventive root in addition.
Transgenosis safe receives in many ways extensively arguement in recent years; And selectable marker gene is one of focus of paying close attention to the safety issue of ecotope and food health; In the transgenic plant planting process that fears are entertained that; Antibiotic resistance gene possibly shift and be incorporated into microbial genome increase resistance pathogenic bacteria quantity; Anti-herbicide gene possibly horizontal transfer given wild relatives and make it become injurious weed, has the application of the marker gene of microbiotic or Herbicid resistant in addition, may destroy the eubiosis, jeopardize human health.Therefore, avoid utilizing antibiotic resistance gene or anti-herbicide gene as selective marker, the hope that can efficiently screen the acquisition transfer-gen plant again is very urgent.The main path that addresses this problem is exploitation, utilizes safe marker gene, is used for genetic transformation of plant and the screening of transgenic plant, cultivate to environment and human body safely, the green good transgenic plant new variety that have no side effect.
Use uncontested Biosafety selective marker, different with conventional marker gene, these marker gene do not have microbiotic or Herbicid resistant, and the regulation and control that gene itself and coded product are participated in are safe to environment with biology.The aspect research of Biosafety marker gene is more has green fluorescence protein gene gfp, ribitol operon rtl, 6-phosphomannose isomerase (phosphomannose-isomerase, PMI) gene pmi, xylose isomerase gene xylA etc.
Mannose phosphonic isomerase PMI gene pmi extensively is present in bacterium, yeast, animal and human's class.In plant, except Chinese cassia tree and some other leguminous plants, all do not have the PMI gene, therefore, the PMI gene can be used as selective marker and is applied to the plant gene conversion.
Vegetable cell can not normal growth differentiation on the substratum that with the seminose is carbon source.When in vegetable cell is containing the substratum of seminose, growing; Vegetable cell absorbs seminose from substratum; And under the effect of HK, seminose phosphoric acid is turned to the 6-phosphomannose; The cell that does not contain the PMI gene can not further utilize the 6-phosphomannose; The accumulation of 6-phosphomannose can consume intracellular inorganic phosphate on the one hand, can suppress glucosephosphate isomerase on the other hand and hinder glycolytic cycle, this just make unconverted cell contain carbon hunger is taken place on the substratum of seminose can not normal growth.And cell transformed contains the PMI gene; Under the effect of mannose phosphonic isomerase, the 6-phosphomannose is converted into fructose-1, 6-diphosphate; Fructose-1, 6-diphosphate can the involved in sugar glycolysis and further utilized; So just making transformant can be carbon source with the seminose, is containing normal growth on the substratum of seminose, and obtains metabolic advantage.Utilize this principle; With Phophomannose isomerase gene serve as a mark gene, with seminose as selective agent; The PMI/ seminose system development that utilizes sugar metabolism to screen is swift and violent, and (Boscariol R L, Almeida WA B have succeedd in the transgenic research of many plants; Derbyshire M T V C; Et al.The use of the PMI/mannose selection system to recover transgenic sweet orange plants (Citrus sinensis L.Osbeck) .Plant Cell Rep, 2003,22:122-128; Dale P J.Spread of engineered genes to wild relatives.Plant Physiol, 1992,100:13-15.; Degenhardt J; Poppe A, Montag J, Szankowski I.The use of the phosphomannose-isomerase/mannose selection system to recover transgenic apple plants.Plant Cell Rep; 2005,25:1149-1156; He Z, Duan Z, Liang W, Chen FJ, Yao W, Liang H, Yue C, Sun Z, Chen F, Dai F.Mannose selection system used for cucumber transformation.Plant Cell Rep, 2006,25:953-958; Joersbo M, Donaldson I, Kreiberg J, et al.Analysis of mannose selection used for transformation of sugar beet.Mol Breed, 1998,4 (2): 111-117; Joersbo M; Mikkelsen J D; Brunstedt J.Relationship between promoter strength and transformation frequencies using mannose selection for the production of transgenic sugar beet.Mol Breed; 2000,6 (2): 207-213; Joersbo M; Petersen S G; Okkels F T.Parameters interacting with mannose selection employed for the production of transgenic sugar beet.Physiol Plant, 1999,105:109-115; Lee B T; Matheson N K.Phosphomannoisomerase and phosphoglucoisomerase in seeds of Cassia coluteoides and some other legumes that synthesize galactomannan.Phytochem; 1984,23:983-987; Lindsey K and Gallois P.Transformation of sugar beet (Beta vulgaris) by Agrobacterium tumefaciens.J Exp Bot, 1990,41:529-536; Lucca P, Ye X D, Potrykus I.Effective selection and regeneration of transgenic rice plants with mannose as selective agent.Mol Breed, 2001,7 (1): 43-49; Min BW, Cho YN, Song MJ; Noh TK, Kim BK, Chae WK; Park YS, Choi YD, Harn CH.Successful genetic transformation of Chinese cabbage using phosphomannose isomerase as a selection marker.Plant Cell Rep; 2007,26 (3): 337-344; Negrotto D; Jolley M; Beer S; Et al.The use of phosphomannose-isomerase as a selectable marker to recover transgenic plants (Zea mays L.) via Agrobacterium transformation.Plant Cell Rep, 2000,19 (8): 798-803; Reed J; Privallel M, Powell L, et al.Phosphomannose isomerase:an efficient selectable marker for plant transformation.In Vitro Cell Dev Boil Plant; 2001,37:127-132; Sigareva M; Spivey R; Willits MG, Kramer CM, Chang YF.An efficient mannose selection protocol for tomato that has no adverse effect on the ploidy level of transgenic plants.Plant Cell Rep; 2004,23:236-245; Todd R; Tague B W.Phosphomannose isomerase:A versatile selectable marker for Arabidopsis thaliana germ-line transformation.Plant Mol Biol Rep; 2001,19:307-319; Van Sehaftingen E, Jaeken J.Phosphomarmomutase deficiency is cause of earbohydrated-deficient giycoprotein syndrome type I.FFBS letters, 1995,377:318-320; Wang AS; Evans RA, Altendorf PR, Hanten JA; Doyle MC; Rosichan JL.A mannose selection system for production of fertile transgenic maize plants from protoplasts.Plant Cell Reports, 2000,19:654-660; Wright M; Dawson J, Dunder E, et al.Efficient biolistic transformation of maize (Zea mays L.) and wheat (Triticum aestivum L.) using the phosphomannose isomerase gene; Pmi; As the seleetable marker.Plant Cell Rep, 2001,20:429-436; Zhu YJ, Agbayani R, McCafferty H; Albert HH; Moore PH.Effective selection of transgenic papaya plants with the PMI/Man selection system.Plant Cell Rep, 2005,24:426-432).
But more than used Phophomannose isomerase gene all is to come from intestinal bacteria in the research, does not also utilize the report of phosphomannose isomerase (PMI) gene of yeast saccharomyces cerevisiae as the selection markers of plant genetics such as paddy rice conversion at present.
Summary of the invention
The objective of the invention is to overcome the defective of prior art, propose a kind of phosphomannose isomerase (PMI gene) that derives from yeast saccharomyces cerevisiae, quick and precisely obtain the novel method of transgenic plant as the selection markers that rice genetic transforms.The present invention need not add any microbiotic or weedicide; The selective agent that uses seminose to transform as transgenic plant; Have advantage safe for human and animal and environment, therefore, the present invention can eliminate the worry to selection markers gene of people to transgenic plant safety.The more important thing is that yeast saccharomyces cerevisiae is a kind of eukaryote; It is nearer than intestinal bacteria with the sibship of plants such as paddy rice; Its gene will be more suitable in the eukaryote plant, expressing than deriving from procaryotic bacillus coli gene; Bring into play higher screening efficiency, improve the success ratio that plant genetic transforms.And former used PMI gene all derives from intestinal bacteria.Intestinal bacteria generally are in environment such as animal intestinal, ight soil, to survive, and derive from colibacillary gene and can cause people's worry rather as selective marker, and yeast are usually used in making food such as bread, steamed bun and are applied to wine industry.Consider that from psychological angle the PMI gene that utilizes the PMI gene of barms to replace in the intestinal bacteria is accepted by people as the Security Choice mark more easily.
The present invention realizes through following technical scheme:
The applicant has set up a kind of method of utilizing yeast saccharomyces cerevisiae Phophomannose isomerase gene PMI to obtain transgenic paddy rice; Make safe transgenic selection markers with brewing yeast mannose isomerase gene PMI, described PMI gene is imported in the acceptor paddy rice, utilize seminose to replace microbiotic or weedicide to make selective agent through agriculture bacillus mediated genetic transforming method; Recipient cell to after transforming screens; Detect through PCR and RT-PCR, screening obtains transfer-gen plant, and its preparation process is following:
1) uses the XhoI restriction enzyme that plasmid pCAMBIA1303 is carried out enzyme and cut, wherein hygromycin gene hpt is cut away, do not contained the carrier segments of hygromycin gene hpt;
2) design a pair of special primer, its nucleotide sequence is as follows:
Forward primer P1:5 '-GCCTCGAGCCAGAAAATTTTAAAAACATG-3 ',
Reverse primer P2:5 '-GCCTCGAGAGAAAGAAAGCTAATTTGG-3 ';
Utilize above-mentioned primer amplification yeast saccharomyces cerevisiae phosphomannose isomerase PMI gene, obtain the dna fragmentation shown in SEQ ID NO:1;
3) with step 2) described dna fragmentation is connected among the plasmid pCAMBIA1303 that step 1) obtains, makes up and obtain expression plasmid pPMI;
4) the expression plasmid pPMI with step 3) transforms agrobacterium tumefaciens, obtains containing the agrobacterium tumefaciens of pPMI plasmid, with institute
The agrobacterium tumefaciens of stating is incubated in the YEP substratum, obtains transforming bacterial strain;
5) rice paddy seed is seeded in obtains callus on the callus inducing medium, subsequent use; Maybe, subsequent use with the callus subculture twice on subculture medium that obtains;
6) callus that step 5) is obtained is transferred in the pre-incubated pre-culture medium, cultivates four days in the dark place;
7) callus that step 6) is obtained places the substratum that infects that contains the step 4) agrobacterium tumefaciens, infects callus 30min, and the bacterial concentration OD600=1.0 of Agrobacterium cultivated 3 days altogether;
8) utilize the mannose concentration in the seminose screening culture medium progressively to screen positive callus from low to high;
9) callus of step 8) is induced differentiation on division culture medium; Root induction on root media obtains transgenic rice plant;
10) utilize PCR and RT-PCR method to identify transfer-gen plant;
Wherein
The described callus inducing medium of step 5) is pressed following prescription:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L,, pyridoxine hydrochloride 0.5mg/L; 2,4-D 2.5mg/L, caseinhydrolysate 600mg/L, 30g sucrose; 3g/L Phytage; PH5.8;
The pre-culture medium of step 6) is pressed following formulation:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L, KH2PO4 200mg/L; FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L, H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L; 100 μ M Syringylethanones, caseinhydrolysate 600mg/L, 30g/L sucrose, 8g/L agarose; PH5.6;
Step 7) is described to infect substratum by following formulation:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L, KH2PO4 200mg/L; FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L, H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L; Syringylethanone 100 μ M, caseinhydrolysate 1000mg/L, 20g/L sucrose, 10g/L glucose; PH5.4
The described culture medium altogether of step 7) is pressed following formulation:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L; KH2PO4 200mg/L, FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L; H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L; Pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L, 100 μ M Syringylethanones; Caseinhydrolysate 1000mg/L, 20g/L sucrose, 10g/L glucose, 8g/L agarose; PH5.6
The described seminose screening culture medium of step 8) prepares by following prescription and step:
Substratum is used in screening for the first time:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L; Glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 5g/L, sucrose 15g/L, Phytagel 4g/L; PH5.8;
Programmed screening is used substratum:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L; Glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 11g/L, sucrose 9g/L, Phytagel 4g/L; PH5.8;
Substratum is used in screening for the third time:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L; Glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 15g/L, sucrose 5g/L, Phytagel 4g/L; PH5.8;
The prescription of the described division culture medium of step 9) is following:
A large amount of compositions of the inorganic salt of MS substratum, the trace ingredients of the inorganic salt of N6 substratum, 6-BA2mg/L, KT2mg/L; NAA0.2mg/L, IAA0.2mg/L, caseinhydrolysate 600mg/L, proline 3 00mg/L; Totomycin 50mg/L, 30g/L sucrose, 03g/L Phytage; PH5.8;
The prescription of the described root media of step 9) is following:
The 1/2MS substratum, 20g/L sucrose, 3g/LPhytage; PH5.8.
Above-mentioned yeast saccharomyces cerevisiae PMI gene order is from the described sequence of Genebank accession number: M85238.The bacterial strain that extracts genes of brewing yeast group DNA is yeast saccharomyces cerevisiae HB52 (see Confucian Garden, Hao Bo explains sub-ox, the seed selection of Zinc-rich saccharomyces cerevisiae and culture process thereof, food and biotechnology journal,, the 25th the 6th phase of volume in 2006).
2, the molecular Biological Detection of transfer-gen plant
1) PCR identifies:
The blade of the transgenic paddy rice that the seminose screening of medium of learning from else's experience is come out; Utilize the extracting of CTAB method to change the pmi paddy DNA (referring to J. Sa nurse Brooker etc.; " molecular cloning experiment guide (second edition) "; 1996 editions, Science Press) method of introducing, the right nucleotide sequence of the special primer of the PMI gene that is used to increase is as follows:
Forward primer P1:5 ' GCCTCGAGCCAGAAAATTTTAAAAACATG3 ',
Reverse primer P2:5 ' GCCTCGAGATAGAAAGAAAGCTAATTTGG3 ';
Have or not the PMI gene to exist in the PCR reaction detection rice genome.
2) RT-PCR detects
Utilize Trizol method (reagent is available from Shanghai Ying Jun Bioisystech Co., Ltd, according to the product description operation) the total RNA of extracting paddy rice, carry out RT-PCR, detect PMI gene transcription situation.
3) GUS dyeing
Get the root dyeing of the transgenic paddy rice that screens, the gus gene expression that inspection and PMI gene change over to simultaneously.GUS prescription of its dyeing liquor (referring to J. Sa nurse Brooker etc., " molecular cloning experiment guide (second edition) ", 1996 editions, Science Press).
Description of drawings
Sequence table SEQ ID NO:1 is yeast saccharomyces cerevisiae Phophomannose isomerase gene PMI gene (the Genbank accession number M85238) sequence that the present invention clones, and the sequence total length is 1455bp.
Fig. 1, technological line figure of the present invention.
Fig. 2, plant conversion carrier pPMI physical map of the present invention.
Fig. 3, transgenic rice plant PCR Molecular Identification result in the embodiment of the invention, the swimming lane sequence number is following among the figure: M:Marker; 1,2 is two independent individual plants; The positive contrast of C1; The negative contrast of C2.
Fig. 4, embodiment transgenic paddy rice RT-PCR qualification result among the present invention, the swimming lane sequence number is following among the figure: M:Marker; 1,2 is two independent individual plants; 1-L, 1-R, 2-L are respectively No. 1 blade, No. 1 root and No. 2 blades; C1: positive control is a template with the plasmid that contains total length yeast PMI gene; C2: negative control is a template with the non-cDNA that changes the pmi rice leaf.
Fig. 5, embodiment transgenic paddy rice root GUS coloration result among the present invention.
Embodiment
The clone of embodiment 1 yeast saccharomyces cerevisiae phosphomannose isomerase PMI gene
(be so kind as to give by professor Hao Bo of life science technical college of Hua Zhong Agriculture University, from yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) HB52 referring to Confucian Garden, Hao Bo; Explain sub-ox; The seed selection of Zinc-rich saccharomyces cerevisiae and culture process thereof, food and biotechnology journal, 2006; The 25th the 6th phase of volume) extract genomic dna, the clone obtains phosphomannose isomerase PMI gene.Concrete steps are following: inoculation one encircles fresh yeast saccharomyces cerevisiae in 20mL YPD liquid nutrient medium, and the YPD nutrient solution contains: 2% tryptone, 1% yeast extract, 2% glucose, 30 ℃, 180r/min shaking culture 18～22h.Centrifugal collection thalline, resuspended with saline water, the centrifugal supernatant of abandoning.Place the 5mL centrifuge tube with collecting good thalline; Add 1mL lysis buffer (50mmol/L Tris-HCl pH 8.0,180mmol/L EDTA pH 8.0,1%SDS according to every 0.5g thalline; Join) at present; A small amount of thalline can adopt the 1.5mL centrifuge tube, adds an amount of lysis buffer, and guaranteeing vibrates to open is advisable.The silica sand that adds 3/10 TV simultaneously covers tight centrifuge tube lid, and the 5～8min that on the vortex oscillation device, vibrates is every at a distance from the 1min centrifuge tube 30s that firmly teetertotters, and makes contents mixed even.Place 10min, add 600 μ L 7.5mol/L ammonium acetate solutions, ice bath 8min for 65 ℃.With the centrifugal 5min of maximum speed of revolution, shift supernatant to another aseptic 5mL centrifuge tube, the NaAc of the 3mol/L of 0.1 times of volume of adding and the Virahol of 0.6 times of volume are put upside down mixing, ice bath 8min.With the maximum speed of revolution centrifugal collecting precipitation, abandon supernatant under the room temperature, with 200 μ L TE dissolution precipitations, add an amount of RNase, 65 ℃ of temperature are bathed 10min.Take out; Add 200 μ L chloroforms: primary isoamyl alcohol (24: 1) extracting once changes supernatant in another aseptic 1.5mL centrifuge tube over to, the NaAc of the 3mol/L of 0.1 times of volume of adding and the absolute ethyl alcohol of 2.5 times of volumes; Collect chromosomal DNA with the centrifugal 8min of 15000rpm; 70% washing with alcohol is once treated the ethanol volatilization fully, with an amount of TE solution or water dissolution deposition.
According to (the Genebank registration number: the M85238) sequence of described PMI gene, with Primer Premier software design the right nucleotide sequence of primer of this gene that increases, as follows:
Upstream primer P1:5 ' GC
CTCGAGCCAGAAAATTTTAAAAACATG3 ' (underscore of primer partly is an Xho I restriction enzyme site);
Downstream primer P2:5 ' GC
CTCGAGATAGAAAGAAAGCTAATTTGG3 ' (underscore of primer partly is an Xho I restriction enzyme site).
PCR reaction system: contain in the 50 μ LPCR reaction solutions: 1 * buffer, 1.5mM/L MgCl
2, 200 μ M/L dNTP, 0.4 μ M/L primer, 2U LA archaeal dna polymerase (TaKaRa), 0.1 μ g cerevisiae dna, reaction conditions is: 94 ℃ of preparatory sex change of 2min; 94 ℃ of 30S sex change, 56 ℃ of 45S annealing, 72 ℃ of 1min 30s extend 20 circulations; 72 ℃ of 5min insulations.The PCR product is connected on the pGEM-T carrier (Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company) order-checking.
(the Genebank registration number: M85238) carry out the comparison of nucleotide sequence and aminoacid sequence of clone's yeast saccharomyces cerevisiae PMI gene and the PMI40 in the ncbi database in this experiment; There are 99.4% similarity in yeast PMI gene sequencing result and PMI40 sequence; There are 9 Nucleotide there are differences; 1 is arranged in intron, and 8 intersperse among in the exon.(Open Read Frame has 4 amino acid whose differences in ORF) to aminoacid sequence comparison result shows ORFs, and the 15th Ser (Tyr), Ser are neutral polarity aliphatic amino acid, and Tyr is a neutral polarity die aromatischen Aminosaeuren; The 25th Ala (Arg), Ala are nonpolar fatty family amino acid, and Arg is positively charged basic aminoacids; The 151st Gln (Lys), Gln are neutral polarity amide-containing amino acid; Lys is the positive charge basic aminoacids; The 214th Glu (Lys), Glu are electronegative acidic amino acid, and Lys is positively charged basic aminoacids.The amino acid character that relatively finds differences has obvious difference, and this species diversity possibly come from yeast strain genome itself, but amino acid whose otherness need be carried out enzyme activity assay to the influence of PMI enzymic activity.The variation of other DNA base sequence can not cause the change of amino acid kind.
The structure of the pPMI carrier of embodiment 2 PMI genes
The conversion carrier that contains the PMI gene that the applicant makes up, this carrier is named as pPMI, is to be transformed by plasmid pCAMBIA1303 to form (make up schema and see Fig. 2).PCAMBIA1303 contains kalamycin resistance gene, has the hygromycin gene that links to each other with the CaMV terminator with 35S promoter and the GUS-GFP antigen-4 fusion protein gene that links to each other with the NOS terminator with 35S promoter between the T-DNA border, the left and right sides.The intestinal bacteria that contain the pCAMBIA1303 plasmid be seeded in the LB nutrient solution (10% tryptone, 5% yeast extract, 10%NaCl) in, 37 ℃ of 150rpm incubated overnight are extracted plasmid, use chloroform: primary isoamyl alcohol (volume ratio is 24: 1) plasmid purification.37 ℃ of enzymes that spend the night are cut plasmid purification, with the excision hygromycin gene.Same cutting with Xho I enzyme spent the night behind the PCR product purification.Cut product 3 μ L, T4 dna ligase (Promega) 0.5 μ L by pCAMBIA1303 plasmid enzyme restriction product 1 μ L, PCR enzyme, 10 * buffer, 0.5 μ L, 16 ℃ of connections are spent the night.1 μ L connects product and mixes with 50 μ L intestinal bacteria DH10B electricity transformed competence colibacillus, and it is 1800V that electric conversion instrument voltage is set, electric shock.Add 800 μ L SOC solution (20% tryptone, 5% yeast extract, 0.5%NaCl, 250mM/L KCl, 20mM/L glucose), be put in 37 ℃ of insulation 5min after the mixing, 37 ℃ of 130rpm recover to cultivate 45min-1h again.Get 100 μ L cultures and be coated on the LB substratum (10% tryptone, 5% yeast extract, 10%NaCl, 15g/L agar powder) that contains the 50mg/L kantlex, treat to be put in after moisture blots 37 ℃ of baking ovens and be inverted cultivation 16h.The picking bacterial plaque is inoculated in 500 μ L and contains in the LB nutrient solution of 50mg/L 37 ℃ of 150rpm incubated overnight.With 1mL bacterium liquid is template; Whether detect yeast PMI gene with primer P1, P2 inserts; Use primer P3:5 ' CCCTTATCTGGGAACTACTC3 ', the direction that P4:5 ' TTCGACAGGTCCTCTGGT3 ' detect to insert whether with plasmid vector on the promotor direction consistent.Cultivate and preserve the correct clone of direction of insertion.The carrier that builds is seen Fig. 2.The carrier that builds is transformed importing Agrobacterium EHA105 (paddy rice group professor Lin Yongjun of crop genetic improvement National Key Laboratory of Hua Zhong Agriculture University is so kind as to give) through electricity.
Embodiment 3 rice genetics transform and screening
Recipient plant of the present invention is No. 8, paddy rice (Oryza Sativa L) kind Mudanjiang, and the seed of this kind is provided by paddy rice group professor Lin Yongjun of crop genetic improvement National Key Laboratory of Hua Zhong Agriculture University.The method of the genetic transformation of present embodiment is: remove earlier husk, with 70% alcohol immersion 1min, with 0.15% mercuric chloride sterilization 20min, be seeded to rice callus for 3-4 time through aseptic washing then and organize inducing culture again, 26 ℃ of cultivation callus inductions secretly.Through 35-40 days, to get strong, the faint yellow particulate state callus of vitality and change subculture medium over to, 26 ℃ of dark place succeeding transfer culture, the embryo callus subculture that subculture is 1-2 time just can carry out agriculture bacillus mediated genetic transformation experiment.The fine and close faint yellow callus particle of the strong quality of 2 times, vitality inserts preparatory culture medium to get succeeding transfer culture, and cultivated 4 days in advance the dark place.Cultivate in advance and finish preceding 2 days, Agrobacterium EHA105 (pPMI) rules on the LB flat board, and 28 ℃ of dark places are left standstill and cultivated 2 days.Cultivate in advance and finish, the Agrobacterium on the LB flat board is scraped into activation medium, 28 ℃ of shaking culture 3-4h, adjustment bacterium liquid OD value is about 1.0.Agrobacterium bacterium liquid after the activation soaks cultivates rice callus 0.5h in advance, after remove bacterium liquid, the callus after will infecting is placed on the sterilization filter paper and blots surperficial bacterium liquid, changes common culture medium over to, cultivated 3 days 20 ℃ of dark places.After cultivating 3 days altogether, callus is through aseptic water washing 3-5 time, and access contains screening and culturing on seminose (the selecting to press) screening culture medium, per 2 all subcultures screenings 1 time behind the airing.Seminose and hygromycin resistance callus that screening is obtained insert presorting substratum, change division culture medium over to after 26 ℃ of dark 1 weeks of cultivation, and 26 ℃, intensity of illumination is 2000Lux, and about 3-4 week differentiates young shoot.The seedling that differentiation is obtained changes root media over to, treats that the healthy and strong flourishing back of root system acclimatization and transplants is in native alms bowl.
Callus inducing medium is pressed following prescription:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L,, pyridoxine hydrochloride 0.5mg/L; 2,4-D 2.5mg/L, caseinhydrolysate 600mg/L, 30g sucrose; 3g/L Phytage; PH5.8;
Pre-culture medium is pressed following formulation:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L, KH2PO4 200mg/L; FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L, H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L; 100 μ M Syringylethanones, caseinhydrolysate 600mg/L, 30g/L sucrose, 8g/L agarose; PH5.6;
Infect substratum by following formulation:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L, KH2PO4 200mg/L; FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L, H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L; Syringylethanone 100 μ M, caseinhydrolysate 1000mg/L, 20g/L sucrose, 10g/L glucose; PH5.4.
Culture medium is pressed following formulation altogether:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L; KH2PO4 200mg/L, FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L; H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L; Pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L, 100 μ M Syringylethanones; Caseinhydrolysate 1000mg/L, 20g/L sucrose, 10g/L glucose, 8g/L agarose; PH5.6.
The seminose screening culture medium prepares by following prescription and step:
Substratum is used in screening for the first time:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L; Glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 5g/L, sucrose 15g/L, Phytagel 4g/L; PH5.8;
Programmed screening is used substratum:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L; Glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 11g/L, sucrose 9g/L, Phytagel 4g/L; PH5.8;
Substratum is used in screening for the third time:
KNO3 2830mg/L, NH4SO4 463mg/L, CaCl22H2O 166mg/L, MgSO47H2O 185mg/L, KH2PO4 400mg/L; FeSO47H2O 27.8mg/L, MnSO44H2O 4.4mg/L, ZnSO47H2O 1.6mg/L, H2BO3 0.8 KI 1.6mg/L; Glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 15g/L, sucrose 5g/L, Phytagel 4g/L; PH5.8;
Division culture medium prepares by following prescription and step:
A large amount of compositions of the inorganic salt of MS substratum, the trace ingredients of the inorganic salt of N6 substratum, 6-BA2mg/L, KT2mg/L; NAA0.2mg/L, IAA0.2mg/L, caseinhydrolysate 600mg/L, proline 3 00mg/L; Totomycin 50mg/L, 30g/L sucrose, 03g/L Phytage; PH5.8;
Root media prepares by following prescription and step:
The 1/2MS substratum, 20g/L sucrose, 3g/LPhytage; PH5.8.
The composition of the subculture medium of above-mentioned callus such as callus induction based component are identical.
The evaluation of embodiment 4 transgenic paddy rices
1) PCR identifies:
The blade of the transgenic paddy rice of the seminose screening of medium of learning from else's experience differentiation; Utilize the CTAB method (referring to J. Sa nurse Brooker etc.; " molecular cloning experiment guide (second edition) ", 1996 editions, Science Press) the total DNA of extracting blade; Designed the special primer of amplification PMI gene, its nucleotide sequence is as follows:
P1：5’GCCTCGAGCCAGAAAATTTTAAAAACATG3’，
P2：5’GCCTCGAGATAGAAAGAAAGCTAATTTGG3’；
PCR detects and has or not the PMI gene to exist in the rice genome.The result sees Fig. 3.Show that its DNA has integrated the PMI gene, amplifies a band about 1.5kb through the transgenic rice plant of screening, unconverted adjoining tree does not then have this DNA bands of a spectrum.
2) RT-PCR detects
Utilize Trizol method (reagent is available from Shanghai Ying Jun Bioisystech Co., Ltd, according to the product description operation) the total RNA of extracting paddy rice and carry out RT-PCR, detect PMI gene transcription situation.The result sees Fig. 4.Electrophoretogram shows, compares with the amplified production of genomic dna, and the result of the RT-PCR of RNA wants little about 100bp, and further inspection is the successfully shearing of intron sequences quilt of yeast saccharomyces cerevisiae PMI gene length 93bp.The eukaryote intron all has some common characteristics, at intron and exon intersection the base of two high conservatives is arranged respectively, and 5 ' end is GT (corresponding to GU among the mRNA); 3 ' end is AG; Have only minority gene exception, the intron that yeast PMI gene is excised in rice cell meets the characteristic of eukaryote intron, explains that yeast pmi transcribes in rice callus; Intron is sheared by correct, and the mRNA splicing system of paddy rice can be discerned the intron of yeast genes and accurately processing.
3) GUS dyeing
GUS coloration result Fig. 5 shows: rice root is dyed blueness, and contrast does not have colour-change, and the T-DNA that contains yeast PMI gene and gus gene is described, and stable integration is in rice genome together, and gus gene is expressed at the root of rice transformation.
Claims (1)
1. method of utilizing yeast saccharomyces cerevisiae Phophomannose isomerase gene PMI to obtain transgenic paddy rice; It is characterized in that; Make safe transgenic selection markers with brewing yeast mannose isomerase gene PMI, described PMI gene is imported in the acceptor paddy rice, utilize seminose to replace microbiotic or weedicide to make selective agent through agriculture bacillus mediated genetic transforming method; Recipient cell to after transforming screens; Detect through PCR and RT-PCR, screening obtains transfer-gen plant, and its preparation process is following:
1) uses the XhoI restriction enzyme that plasmid pCAMBIA1303 is carried out enzyme and cut, wherein hygromycin gene hpt is cut away, do not contained the carrier segments of hygromycin gene hpt;
2) design a pair of special primer, its nucleotide sequence is as follows:
Forward primer P1:5 '-GCCTCGAGCCAGAAAATTTTAAAAACATG-3 ',
Reverse primer P2:5 '-GCCTCGAGAGAAAGAAAGCTAATTTGG-3 ';
Utilize above-mentioned primer amplification yeast saccharomyces cerevisiae phosphomannose isomerase PMI gene, obtain the dna fragmentation shown in SEQ ID NO:1;
3) with step 2) described dna fragmentation is connected among the plasmid pCAMBIA1303 that step 1) obtains, makes up and obtain expression plasmid pPMI;
4) the expression plasmid pPMI with step 3) transforms agrobacterium tumefaciens, obtains containing the agrobacterium tumefaciens of pPMI plasmid, and described agrobacterium tumefaciens is incubated in the YEP substratum, obtains transforming bacterial strain;
5) rice paddy seed is seeded in obtains callus on the callus inducing medium, subsequent use; Maybe, subsequent use with the callus subculture twice on subculture medium that obtains;
6) callus that step 5) is obtained is transferred in the pre-incubated pre-culture medium, cultivates four days in the dark place;
7) callus that step 6) is obtained places the substratum that infects that contains the step 4) agrobacterium tumefaciens, infects callus 30min, and the bacterial concentration OD600=1.0 of Agrobacterium cultivated 3 days altogether;
8) utilize the mannose concentration in the seminose screening culture medium progressively to screen positive callus from low to high;
9) callus of step 8) is induced differentiation on division culture medium; Root induction on root media obtains transgenic rice plant;
10) utilize PCR and RT-PCR method to identify transfer-gen plant;
Wherein
The described callus inducing medium of step 5) is pressed following prescription:
KNO
32830mg/L, NH
4SO
4463mg/L, CaCl
22H
2O 166mg/L, MgSO
47H
2O 185mg/L, KH
2PO
4400mg/L, FeSO
47H
2O 27.8mg/L, MnSO
44H
2O 4.4mg/L, ZnSO
47H
2O 1.6mg/L, H
2BO
30.8 KI 1.6mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L,, pyridoxine hydrochloride 0.5mg/L, 2,4-D 2.5mg/L, caseinhydrolysate 600mg/L, 30g sucrose; 3g/L Phytage; PH5.8;
The pre-culture medium of step 6) is pressed following formulation:
KNO
31415mg/L, NH
4SO
4231.5mg/L, CaCl
22H
2O 83mg/L, MgSO
47H
2O 92.5mg/L, KH
2PO
4200mg/L, FeSO
47H
2O 13.9mg/L, MnSO
44H
2O 2.2mg/L, ZnSO
47H
2O 0.8mg/L, H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L; Vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L; 100 μ M Syringylethanones, caseinhydrolysate 600mg/L, 30g/L sucrose, 8g/L agarose; PH5.6;
Step 7) is described to infect substratum by following formulation:
KNO3 1415mg/L, NH4SO4 231.5mg/L, CaCl22H2O 83mg/L, MgSO47H2O 92.5mg/L, KH2PO4 200mg/L; FeSO47H2O 13.9mg/L, MnSO44H2O 2.2mg/L, ZnSO47H2O 0.8mg/L, H2BO3 0.4 KI 0.8mg/L, glycocoll 2mg/L; Nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L; Syringylethanone 100 μ M, caseinhydrolysate 1000mg/L, 20g/L sucrose, 10g/L glucose; PH5.4
The described culture medium altogether of step 7) is pressed following formulation:
KNO
31415mg/L, NH
4SO
4231.5mg/L, CaCl
22H
2O 83mg/L, MgSO
47H
2O 92.5mg/L, KH
2PO
4200mg/L, FeSO
47H
2O 13.9mg/L, MnSO
44H
2O 2.2mg/L, ZnSO
47H
2O 0.8mg/L, H
2BO
30.4 KI 0.8mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L, 2,4-D2.5mg/L, 100 μ M Syringylethanones, caseinhydrolysate 1000mg/L, 20g/L sucrose, 10g/L glucose, 8g/L agarose; PH5.6
The described seminose screening culture medium of step 8) prepares by following prescription and step:
Substratum is used in screening for the first time:
KNO
32830mg/L, NH
4SO
4463mg/L, CaCl
22H
2O 166mg/L, MgSO
47H
2O 185mg/L, KH
2PO
4400mg/L, FeSO
47H
2O 27.8mg/L, MnSO
44H
2O 4.4mg/L, ZnSO
47H
2O 1.6mg/L, H
2BO
30.8 KI 1.6mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 5g/L, sucrose 15g/L, Phytagel 4g/L; PH5.8;
Programmed screening is used substratum:
KNO
32830mg/L, NH
4SO
4463mg/L, CaCl
22H
2O 166mg/L, MgSO
47H
2O 185mg/L, KH
2PO
4400mg/L, FeSO
47H
2O 27.8mg/L, MnSO
44H
2O 4.4mg/L, ZnSO
47H
2O 1.6mg/L, H
2BO
30.8 KI 1.6mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 11g/L, sucrose 9g/L, Phytagel 4g/L; PH5.8;
Substratum is used in screening for the third time:
KNO
32830mg/L, NH
4SO
4463mg/L, CaCl
22H
2O 166mg/L, MgSO
47H
2O 185mg/L, KH
2PO
4400mg/L, FeSO
47H
2O 27.8mg/L, MnSO
44H
2O 4.4mg/L, ZnSO
47H
2O 1.6mg/L, H
2BO
30.8 KI 1.6mg/L, glycocoll 2mg/L, nicotinic acid 0.5mg/L, vitamin 1.0mg/L, pyridoxine hydrochloride 0.5mg/L; 2,4-D2.5mg/L, caseinhydrolysate 500mg/L, Totomycin 50mg/L; Cephamycin 400mg/L, seminose 15g/L, sucrose 5g/L, Phytagel 4g/L; PH5.8;
The prescription of the described division culture medium of step 9) is following:
A large amount of compositions of the inorganic salt of MS substratum, the trace ingredients of the inorganic salt of N6 substratum, 6-BA2mg/L, KT2mg/L; NAA0.2mg/L, IAA0.2mg/L, caseinhydrolysate 600mg/L, proline 3 00mg/L; Totomycin 50mg/L, 30g/L sucrose, 03g/L Phytage; PH5.8;
The prescription of the described root media of step 9) is following:
The 1/2MS substratum, 20g/L sucrose, 3g/LPhytage; PH5.8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110129582XA CN102787133A (en) | 2011-05-19 | 2011-05-19 | Method for screening transgenic paddy plant by phosphomannose-isomerase (PMI) gene of yeast |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110129582XA CN102787133A (en) | 2011-05-19 | 2011-05-19 | Method for screening transgenic paddy plant by phosphomannose-isomerase (PMI) gene of yeast |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102787133A true CN102787133A (en) | 2012-11-21 |
Family
ID=47152723
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110129582XA Pending CN102787133A (en) | 2011-05-19 | 2011-05-19 | Method for screening transgenic paddy plant by phosphomannose-isomerase (PMI) gene of yeast |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102787133A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103993039A (en) * | 2014-06-04 | 2014-08-20 | 安徽省农业科学院水稻研究所 | Method for introducing foreign gene into cleistogamy japonica rice by utilizing PMI (phosphomannose isomerase) selection marker |
| CN103993038A (en) * | 2014-06-04 | 2014-08-20 | 安徽省农业科学院水稻研究所 | Method for guiding exogenous gene into cleistogamous indica rice by using PMI (phosphomannose isomerase) selection marker |
| CN104046636A (en) * | 2014-06-19 | 2014-09-17 | 安徽省农业科学院水稻研究所 | Codon vegetalization-transformed PMI gene and applications thereof |
| CN104928252A (en) * | 2015-04-21 | 2015-09-23 | 安徽省农业科学院水稻研究所 | Application of arabidopsis thaliana phosphomannose isomerase gene to plant genetic transformation |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1844397A (en) * | 2006-04-30 | 2006-10-11 | 北京北方杰士生物科技有限责任公司 | Phophomannose isomerase gene and its coded protein and use |
-
2011
- 2011-05-19 CN CN201110129582XA patent/CN102787133A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1844397A (en) * | 2006-04-30 | 2006-10-11 | 北京北方杰士生物科技有限责任公司 | Phophomannose isomerase gene and its coded protein and use |
Non-Patent Citations (5)
| Title |
|---|
| DAVID J. SMITH等: "PMI40, an Intron-Containing Gene Required for Early Steps in Yeast Mannosylation", 《MOLECULAR AND CELLULAR BIOLOGY》 * |
| LAURA S. PRIVALLE: "Phosphomannose Isomerase, a Novel Plant Selection System", 《ANNALS OF THE NEW YORK ACADEMY OF SCIENCES》 * |
| ZHENGQUAN HE等: "Phosphomannose-isomerase (pmi) gene as a selectable marker for rice transformation via Agrobacterium", 《PLANT SCIENCE》 * |
| 林拥军 等: "农杆菌介导的牡丹江8号高效转基因体系的建立", 《作物学报》 * |
| 马宏敏 等: "pmi基因作为一种新型的安全选择标记基因的研究进展", 《福建稻麦科技》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103993039A (en) * | 2014-06-04 | 2014-08-20 | 安徽省农业科学院水稻研究所 | Method for introducing foreign gene into cleistogamy japonica rice by utilizing PMI (phosphomannose isomerase) selection marker |
| CN103993038A (en) * | 2014-06-04 | 2014-08-20 | 安徽省农业科学院水稻研究所 | Method for guiding exogenous gene into cleistogamous indica rice by using PMI (phosphomannose isomerase) selection marker |
| CN103993039B (en) * | 2014-06-04 | 2017-01-18 | 安徽省农业科学院水稻研究所 | Method for introducing foreign gene into cleistogamy japonica rice by utilizing PMI (phosphomannose isomerase) selection marker |
| CN103993038B (en) * | 2014-06-04 | 2017-01-18 | 安徽省农业科学院水稻研究所 | Method for guiding exogenous gene into cleistogamous indica rice by using PMI (phosphomannose isomerase) selection marker |
| CN104046636A (en) * | 2014-06-19 | 2014-09-17 | 安徽省农业科学院水稻研究所 | Codon vegetalization-transformed PMI gene and applications thereof |
| CN104928252A (en) * | 2015-04-21 | 2015-09-23 | 安徽省农业科学院水稻研究所 | Application of arabidopsis thaliana phosphomannose isomerase gene to plant genetic transformation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106957855A (en) | Use CRISPR/Cas9 technology targeting knock out paddy rice Dwarfing genes SD1 method | |
| CN102703499B (en) | Method for converting disease-resistance genes of rice and obtaining transgenic descendants without selective markers | |
| CN113801891B (en) | Construction method and application of beet BvCENH3 gene haploid induction line | |
| CN107383179A (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN102787133A (en) | Method for screening transgenic paddy plant by phosphomannose-isomerase (PMI) gene of yeast | |
| CN101265481B (en) | Culture medium for increasing wheat mature embryo regeneration ratio and conversion method for agrobacterium tumefaciens thereof | |
| CN103409460A (en) | Maize transformation method | |
| CN112522291B (en) | Rice OsSH3P2 gene and application thereof | |
| Kang et al. | A robust genome-editing method for wild plant species Nicotiana attenuata | |
| CN106480084B (en) | Application of OsLAC13 and miR397a/b in cultivation of high-setting-rate or high-yield rice | |
| CN110484561B (en) | Method for obtaining high-oleic-acid cotton by using gene editing technology | |
| CN110106171B (en) | Long-chain non-coding RNA and application thereof in regulating and controlling low temperature resistance of plants | |
| CN103215307B (en) | Genetic transformation method of agrobacterium-induced plum blossom mature cotyledon regeneration system | |
| CN105950644B (en) | The albumen and application of asparagus enzyme, namely chalcone isomerase gene and its coding | |
| CN102286527A (en) | Genetic transformation method for DREB (Dehydration Responsive Element Binding) gene transformation Anthurium | |
| CN108866080A (en) | Tomato stress response gene, its recombinant expression carrier and its application in cultivation salt tolerant tomato | |
| CN110951771B (en) | Chinese cymbidiummiR390aApplication in controlling plant root system development | |
| CN102816784A (en) | Construction and transformation of chamomile farnesyl diphosphate synthase (FPS) gene eukaryotic expression vector | |
| CN104120134B (en) | The application in cultivating resistance of reverse transgenic plant of the GsHSFB2b albumen | |
| CN102533804A (en) | Artemisia sphaerocephala krasch delta 12 fatty acid dehydrogenase (As flavin adenine dinucleotide 2 (FAD2)) gene and application | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN105886528A (en) | Method for acquiring transgenic hevea plant by virtue of laticifer specific promoter | |
| CN101831454A (en) | Gateway inlet vector pEn-L4*-PrbcS-*T-GFP-L3*, construction method thereof and application thereof | |
| JP2007306917A (en) | Method for increasing the resistance of rice plant to pathogenic microorganism and pathogenic microorganism-resistant rice transformant | |
| Potts | CRISPR Genome editing of transcription factors related to aluminum toxicity in tomato (Solanum lycopersicum) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121121 |