CN102417882A - Expression method of pseudomonas stutzeri A1501 rpoN gene - Google Patents
Expression method of pseudomonas stutzeri A1501 rpoN gene Download PDFInfo
- Publication number
- CN102417882A CN102417882A CN2011103267044A CN201110326704A CN102417882A CN 102417882 A CN102417882 A CN 102417882A CN 2011103267044 A CN2011103267044 A CN 2011103267044A CN 201110326704 A CN201110326704 A CN 201110326704A CN 102417882 A CN102417882 A CN 102417882A
- Authority
- CN
- China
- Prior art keywords
- chlamydomonas
- expression
- gene
- rpon
- chloroplast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an expression method of pseudomonas stutzeri A1501 rpoN gene, and the expression method comprises the following steps: constructing an expression cassette of the rpoN gene; inserting the constructed expression cassette of the rpoN gene between homologous fragments of chlamydomonas reinhardtii chloroplast genome on a chlamydomonas reinhardtii chloroplast expression vector to construct a recombinant chlamydomonas reinhardtii chloroplast expression vector; transforming chlamydomonas reinhardtii by the recombinant chlamydomonas reinhardtii chloroplast expression vector; screening transgenic chlamydomonas reinhardtii, inducing the expression of the rpoN gene in the transgenic chlamydomonas reinhardtii, obtaining and purifying the expressed protein. The method of the invention successfully realizes the stable and high-efficient expression of pseudomonas stutzeri A1501 rpoN gene in chlamydomonas reinhardtii chloroplast, and provides material base for further study of the nitrogen fixation mechanism of pseudomonas stutzeri and the purification, functions and characteristics of rpoN protein.
Description
Technical field
The present invention relates to the rpoN expression of gene method of fixed nitrogen pseudomonas stanieri (Pseudomonas stutzeri) A1501; Relate in particular to the method for the rpoN gene that utilizes chlamydomonas chloroplast expression system expression pseudomonas stanieri Pseudomonas stutzeri A1501, belong to fixed nitrogen pseudomonas stanieri A1501 rpoN expression of gene field.
Background technology
Nitrogen is the essential substance that constitutes protein and nucleic acid, is occurring in nature animal, plant, the indispensable bioelement of mikrobe.Nitrogen has multiple existence form at nature; Quantity is maximum is that nitrogen in the atmosphere accounts for 79% of atmosphere volume; About 3.9 * 10,700,000,000 tons of total amount; But can not be that most of biologies (comprising all plant and animals) directly utilize, thus ammonia-state nitrogen be supplied in main determining factor for the organic sphere prosperity and development.At present, fixed nitrogen mainly contains following dual mode, i.e. technical azotification and biological nitrogen fixation.Technical azotification refers to the method with high temperature, high pressure, chemical catalysis; Biological nitrogen fixation is meant that the prokaryotic organism of some kind utilize intravital nitrogenase that airborne nitrogen is reduced to ammonia, for plant-growth provides nitrogen.
The mankind will trace back to 19th-century for the understanding of biological nitrogen fixation, apart from modern existing more than 100 year history.As far back as 1830, Boussingault report leguminous plants can fixed nitrogen.Hellriegel Wilfarth in reports in 1886 and delivered in 1888 can fixed nitrogen about leguminous plants reliable basis, and confirmed that fabaceous root nodule is the main place of fixed nitrogen.Soon subsequently, anaerobic Clostridium pasteurianum, the good Azotobacter chroococcum that supports; And cyanobacteria; Photosynthetic bacteria, Klebsiella spp., Archaebacteria; Desulfovibrio sp. waits the ranks that join fixed nitrogen.Up to the present, along with deepening continuously of research, it is wider to find that mikrobe kind scope that occurring in nature can carry out biological nitrogen fixation distributes, and can be divided into from 3 kinds in growing nitrogen-fixing, symbiotic nitrogen fixation and united symbiosis fixed nitrogen.
Biological nitrogen fixation mainly relies on most prokaryotic organism, and these prokaryotic organism why can fixed nitrogen, is because the cause of nitrogenase.Nitrogenase is a kind of metalloenzyme of complicacy, forms (or be called component I and component I I, also be referred to as Dinitrogenase and Dinitrogenase reductant) by Mo-Fe protein and ferritin.Nitrogen fixation is the process of a complicacy, and its adjusting realizes on transcriptional level, mainly is to regulate and control according to the content of oxygen in the environment and the level of ammonium.
The rpoN gene of fixed nitrogen pseudomonas stanieri (Pseudomonas stutzeri) A1501 plays important effect in the fixed nitrogen regulating effect of pseudomonas stanieri A1501.RNA polymerase need rely on σ
54(product of rpoN gene) could start transcribing of main nif gene cluster, therefore could guarantee some procaryotic nitrogen fixation.
Nitrogen fixation mechanism and the proteic function of rpoN, characteristic and purifying mode etc. for deep research fixed nitrogen pseudomonas stanieri need a large amount of rpoN albumen as basic substance.Therefore, provide a kind of method stable, that express the rpoN gene efficiently to establish basic substance for the fixed nitrogen regulating effect mechanism and the researchs such as the proteic function of rpoN, characteristic and purifying mode of fixed nitrogen pseudomonas stanieri.
Summary of the invention
Technical problem to be solved by this invention is the deficiency that overcomes prior art; The rpoN expression of gene method of a kind of fixed nitrogen pseudomonas stanieri A1501 is provided; This method is an expression system with the chlamydomonas chloroplast(id), can stablize, in the chlamydomonas chloroplast(id), express efficiently the rpoN gene.
Technical problem to be solved by this invention realizes through following technical scheme:
The rpoN expression of gene method of fixed nitrogen pseudomonas stanieri (Pseudomonas stutzeri) A1501 comprises: make up rpoN expression of gene box; Constructed rpoN expression of gene box is inserted between the homologous fragment of the chlamydomonas chloroplast gene group on the chlamydomonas chloroplast expression carrier, makes up the chlamydomonas chloroplast expression carrier that obtains recombinating; The chlamydomonas chloroplast expression carrier of will recombinating transforms chlamydomonas; Screening transgenic chlamydomonas is induced the rpoN genetic expression in the transgenic chlamydomonas, results and the expressed albumen of purifying.
Wherein, the nucleotides sequence of the rpoN gene of described pseudomonas stanieri Pseudomonas stutzeri A1501 is classified as shown in the SEQ ID NO:1;
Described rpoN expression of gene box is made up of chlamydomonas chloroplast(id) specific promoter, rpoN gene and the special terminator of chlamydomonas chloroplast(id), and wherein, the rpoN gene places under the regulation and control of chlamydomonas chloroplast gene specific promoter and terminator; Described chlamydomonas chloroplast(id) specific promoter includes but not limited to atpA, atpB, psbA, psbD or rbcL, is preferably the atpA promotor; The special terminator of described chlamydomonas chloroplast(id) is preferably the rbcL terminator.
The homologous fragment of described chlamydomonas chloroplast gene group is the trnE2-psbH gene, and its nucleotides sequence is classified as shown in the SEQ ID NO:2;
Used chlamydomonas among the present invention (Chlamydomonas reinhardtii) can be any wild-type Chlamydomonas reinhardtii, all can realize technique effect of the present invention; In order to reach better technique effect, chlamydomonas of the present invention (Chlamydomonas reinhardtii) is strain cw15 more preferably;
Wherein, The mode that described reorganization chlamydomonas chloroplast expression carrier transforms chlamydomonas preferably adopts the particle gun bombardment that is enclosed with reorganization chlamydomonas chloroplast expression carrier to be in the chlamydomonas in growth logarithmic phase later stage and the screening of medium through no acetate obtains transgenic chlamydomonas (chlamydomonas transformant); Experimental result finds that the resistance that the present invention screens the transgenic chlamydomonas aadA that obtains disappears.
The present invention adopts the dna homolog recombinant technology; The rpoN that derives from pseudomonas stanieri Pseudomonas stutzeri A1501 is gene constructed to the expression cassette that is driven by chlamydomonas chloroplast(id) specific promoter atpA and terminator rbcL combination; Utilize trnE2-psbH in the chlamydomonas chloroplast gene group as homologous fragment; Homologous recombination takes place; Import in the chlamydomonas chloroplast(id) through the particle gun conversion method, detect the final transgenic chlamydomonas that obtains, prove that the rpoN gene of pseudomonas stanieri Pseudomonas stutzeri A1501 can be stablized in the chlamydomonas chloroplast(id), express efficiently through PCR, Western blot equimolecular biological means.
Chlamydomonas (Chlamydomonas reinhardtii) has attracted the attention of research fields such as cell and molecular biology day by day as better simply unicellular eukaryote.Chlamydomonas (Chlamydomonas reinhardtii) is a unicell green alga, ovalize, and the approximately long 10 μ m of cell size, wide 3 μ m have single cup-shaped chloroplast(id), account for the 40%-60% of cell TV.The present invention adopts the chlamydomonas chloroplast(id) as rpoN expression of gene system; Not only remedied the deficiency of consideration conveyization; But also have the advantage of following several respects: the first, the present invention realizes the gene site-directed insertion of rpoN through the homologous fragment of design chloroplast gene group on conversion carrier through the homologous recombination effect; Avoid the generation of position effect and gene silencing, guaranteed the stably express of rpoN gene.The second, chlamydomonas chloroplast gene group genetic expression system has prokaryotic.Codon and prokaryotic organism that arrangement mode, control methods, GC base pair content and the translation of Chlamydomonas reinhardtii chloroplast gene group gene are had a preference for are close, and this helps directly expressing the rpoN gene.The 3rd, the rpoN gene can be stablized in the chlamydomonas chloroplast(id), express efficiently.
Stable in the chlamydomonas chloroplast(id), the expression efficiently of rpoN gene with fixed nitrogen pseudomonas stanieri Pseudomonas stutzeri A1501 of the inventive method success; Adopt the inventive method to obtain a large amount of reorganization rpoN albumen, for basic substance has been established in the mechanism of action and the researchs such as the proteic purifying of rpoN, function and characteristic that launch the fixed nitrogen pseudomonas stanieri through chlamydomonas chloroplast expression system.
Description of drawings
Fig. 1 changes the transgenic chlamydomonas PCR detected result of goal gene rpoN; 1, wild-type chlamydomonas; 2, the transformant sample 1; 3, the transformant sample 2.
The structure diagram of Fig. 2 carrier p72B-LG.
The restriction enzyme mapping of Fig. 3 plasmid paptY.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.Therefore should be appreciated that and the invention is not restricted to the ad hoc approach described in this paper, experimental program, clone, construct and reagent and can change.Should be appreciated that also method used among this paper is the purpose that only is used to describe specific embodiment, and and be not intended to limit category of the present invention, category of the present invention will only be limited by the claims of enclosing.
Explain: the technology that in following examples, does not describe in detail, all carry out according to related Sections in following laboratory manual or the document or part, comprising: people such as Sambrook, Molecular Cloning, A Laboratory Manual (the 3rd edition .2001); Kriegler, Gene Transfer and Expression:A Laboratory Manual (1990); With Current Protocols in Molecular Biology (people such as Ausubel compiles, 1994).
Only if in addition definition, otherwise used all technology of the present invention and scientific terminology all have with those skilled in the art and understand identical implication usually.Though in practice of the present invention or test, can use any method, device and the material similar or equivalent, describe preferred method, device and material now with person described herein.
Experiment material
1.E.coli TOP10 is available from Promega company; The rpoN gene of fixed nitrogen pseudomonas stanieri Pseudomonas stutzeri A1501 is preserved by Chinese Academy of Agricultural Sciences's biotechnology; (explain: the CW-15 described in the present invention can be replaced by any wild-type Chlamydomonas reinhardtii wild-type Chlamydomonas reinhardtii (Chlamydomonas reinhardtti) CW-15; All can realize technique effect of the present invention) preserve by Biological Technology institute, Chinese Academy of Agricultural Sciences; Concrete cultural method can be with reference to relevant document (Hyams with characteristic; J.and D.R.Davies; The induction and characterisation of cell wall mutants of Chlamydomonas reinhardtii.Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, 1972.14 (4): p.381-389); PaptY, p72B-LG are preserved by Biological Technology institute, Chinese Academy of Agricultural Sciences;
The insertion nucleotides sequence of carrier p72B-LG is classified as shown in the SEQ ID No.3, and its structure diagram is seen Fig. 1, and wherein, insertion sequence is 2.2kb, and the pUC9 carrier is 2.67kb, and the total order of carrier p72B-LG is classified 4.87kb as.
The carrier collection of illustrative plates of plasmid paptY (pBlutscript II-aptY) is seen Fig. 2, can make up according to relevant document about the structure of paptY and obtain this plasmid paptY (Expression of human soluble TRAIL in Chlamydomonas reinhardtii chloroplast.Chinese Science Bulletin 2006 Vol.51 No.14 1703-1709).
Enzyme and reagent: various restriction enzymes, T
4Dna ligase, Klenow enzyme and supporting damping fluid thereof are available from Promega company;
2. biochemical reagents: IPTG, X-Gal are the Promega Company products; Agarose is a Sun biotech Company products; Tris, dNTPs are available from Sigma company; Peptone, yeast extract, Tryptones are all available from OXOID company; Ethidium bromide (EB) is available from Fluka company; The goat-anti rabbit rpoN antibody of HRP mark; TEMED (N, N, N ', N '-Tetramethyl Ethylene Diamine) is available from Sweden LKB BROMMA company; SDS is the BDH Company products; Beta-mercaptoethanol, Tris is available from Sigma company; Coomassie brilliant blue R-250, N, N '-methylene diacrylamide is available from Switzerland Fluka Chemie AG company; Acrylic amide is an Aldrich chemistry ltd product; Nitrocellulose filter Hybond-N and nylon membrane Hybond-C are the Amersham product;
3. substratum: the intestinal bacteria substratum be the LB substratum (1% peptone, 0.5% yeast extract, 1% NaCl, pH7.0); The chlamydomonas substratum is the TAP substratum;
The structure of the acquisition of the rpoN gene of embodiment fixed nitrogen pseudomonas stanieri Pseudomonas stutzeri A1501, reorganization chlamydomonas chloroplast expression carrier and the evaluation of conversion and transgenic chlamydomonas
1. the clone of the rpoN gene of fixed nitrogen pseudomonas stanieri Pseudomonas stutzeri A1501 and the structure of expression vector
1.1 the acquisition of goal gene
Sequence according to the rpoN of known fixed nitrogen pseudomonas stanieri Pseudomonas stutzeri A1501 designs primer respectively, and introduces XbaI and HindIII site respectively, and two pairs of primers are following:
F?rpoN：5′-A
TCTAGAATGAAGCAAGGTTTGCAATTAAG-3′
The XbaI enzyme cutting site
R?rpoN：5′-A
AAGCTTTCAGACCAGTTGTTTACGCTG-3′
The HindIII restriction enzyme site
In 0.5mL Eppendorf pipe, add
Response procedures:
1.2 the recovery of product
Carry out electrophoresis with ordinary gel, downcut required DNA band, put into the Eppendorf pipe after weighing, add the 6mol/L NaI solution of 3 times of volumes (v/w); Under 37 ℃ gel is fully dissolved, add 10 μ L glass milk adsorption of DNA again, room temperature held 5min, centrifugal slightly 5s; Remove supernatant, deposition is washed once with New Wash washing lotion, repeated centrifugation, washing three times; Dry the back with 30 μ L, 0.1 * TE Buffer dissolving DNA, get supernatant after centrifugal, DNA is stored in-20 ℃ subsequent use.
1.3 enzyme is cut and ligation
Enzyme cut with the ligation reference reagent box description of product in the optimum reaction conditions of various enzymes carry out.Reaction system comprises DNA 1～2 μ g, and 10 * enzyme reaction buffer solution of 1/10 volume, enzyme amount are 2-4M/ μ g DNA, and TV is 15～20 μ L.Optimum temperuture (being generally 37 ℃) is reaction 1～2h down, identifies with agarose gel electrophoresis whether complete enzyme is cut.
1.4 the conversion of DNA or connection product
Get-70 ℃ of frozen competent cells, with the hands rub with the hands to most of back (necessarily can not melt fully) of melting and put on ice rapidly.Competent cell melts the back fully and adds DNA 20～100ng or connect mixture 5 μ L, mixing gently, ice bath 30min.42 ℃ of heat shock 90sec put 1～2min on ice rapidly.Add 1mL and be incubated to 37 ℃ LB substratum, 37 ℃ of vibrations (≤150rpm) cultivation 1h.4, the centrifugal 5min of 000g goes behind the part supernatant (staying 150～200 μ L) to coat and contains on the suitable antibiotic LB flat board.Be inverted overnight cultures for 37 ℃.
1.5 alkaline lysis method of extracting plasmid DNA
(1) with aseptic toothpick picking list bacterium colony from the LB flat board, be inoculated in 4mL and contain in the LB liquid nutrient medium of 100 μ g/mL ampicillins, 37 ℃, 230r/min, shaking culture is spent the night;
(2) get the 1.5mL overnight culture in the Eppendorf pipe, 5, the centrifugal 5min of 000rpm collects thalline, abandons supernatant;
(3) with 150 μ L Sol I suspension deposition, ice bath 10min;
(4) add 300 μ L Sol II and 150 μ L chloroforms, reverse ice bath 5min behind the mixing gently;
(5) add 450 μ L SolIII, ice bath 10min behind the reversing mixing;
The centrifugal 10min of (6) 12,000rpm gets supernatant, adds 0.6 times of volume Virahol, places 20min in 4 ℃ behind the mixing;
The centrifugal 10min of (7) 12,000rpm abandons supernatant, deposition be dissolved in 250 μ L TER (contain 20 μ g/mL RNaseA 1 * TE) in, 37 ℃ of digestion 20min add 300 μ L PPt precipitate B uffer, the rearmounted 4 ℃ of 20min of mixing;
The centrifugal 10min of (8) 12,000rpm abandons supernatant, and 70% ethanol is washed once, the vacuum-drying deposition, and with 80 μ L0.1 * TE (pH8.0) dissolving ,-20 ℃ of preservations are subsequent use.
1.6 the evaluation of recon
Enzyme is cut evaluation: extracting DNA at first in a small amount, and utilize XbaI and HindIII to carry out endonuclease reaction then, the plasmid of the DNA band of the about 1.37kb of appearance is recombinant plasmid pEASY-T3-rpoN behind the electrophoresis.Recombinant plasmid pEASY-T3-rpoN is carried out two-way order-checking, and sequencing result is consistent with expected results.
The structure of 2 reorganization chlamydomonas chloroplast expression carriers
Plasmid patpY contains chlamydomonas chloroplast gene group specific promoter 5 ' atpA and terminator 3 ' rbcL reaches by one group of initial MCS of BamHI.The positive recombinant plasmid pEASY-T3-rpoN that order-checking is correct; With XbaI and Hind III double digestion; With the purpose fragment that reclaims; Be connected between patpY carrier XbaI and the HindIII, the rpoN fragment is placed under chlamydomonas chloroplast gene specific promoter 5 ' atpA and terminator 3 ' the rbcL regulation and control, obtain plasmid patpY-rpoN; Use EcoRV and Not I double digestion again; And mend and put down the NotI site; Recovery contains the 2.6kbDNA fragment of rpoN coding region expression cassette, with its p72B-LG plasmid EcoRV site that is cloned into homologous recombination fragment trnE-psbH, is built into coding chlamydomonas chloroplast expression carrier p72B-LG-rpoN.
3 particle guns transform
3.1 the preparation of cultivation of chlamydomonas and chlamydomonas recipient cell
The wild-type chlamydomonas is grown in the TAP liquid nutrient medium, and 20～25 ℃, 160rpm, photoperiod 12hr/12hr consults document Harris (1989) (The Chlamydomonas soursebooke, 1989 Academic Press, San Diego).
Get 1.5mL and grow to the logarithm later stage (5～6 * 10
6Cells/mL) chlamydomonas in centrifuge tube, concentrate (5,000rpm, 20 ℃; 5min), remove supernatant, stay 200 μ L; Be applied on the TAP solid plate, the illumination condition of 3000Lux was cultivated 1～2 day down, used aseptic scoop to dig out that long equably the diameter of one deck chlamydomonas is arranged is the culture block of 2～3cm; Put into the aseptic plate of 9cm central authorities, in order to bombardment.
3.2 the preparation of particulate bullet (DNA coated microprojectiles)
The bronze (Bio-Rad) of claiming 60mg 1.0 μ m is in 1.5mL Eppendorf pipe; Add the 1mL absolute ethyl alcohol, fully vortex (vortex) leaves standstill 10min then, and 10, the centrifugal 10sec of 000rpm; The careful supernatant of removing adds the 1mL sterilized water, abundant vortex, and 10, the centrifugal 10sec of 000rpm abandons supernatant; Repeat with sterilized water washing 2 times; With the aseptic resuspended bronze particle of 50% (v/v) glycerine of 1mL.Bronze after the processing can be-20 ℃ of prolonged preservation;
Get that 50 μ l are above-mentioned to prepare and the bronze particle of vortex, change in the aseptic 1.5mL eppendorf pipe, be sequentially added into 5 μ L DNA (1 μ g/ μ L), 50 μ l 2.5mol/L CaCl
2With 20 μ L 0.1mol/L spermidines (Free base joins existing usefulness) at present; With mixture vortex 1min, place 1min on ice; Repeat 10 times; Place on ice more than the 30min; 15, the centrifugal 5sec of 000rpm removes supernatant; The bronze particle that encapsulates with 250 μ L absolute ethanol washings 2 times, 10, the centrifugal 10sec of 000rpm removes supernatant; The resuspended bronze particle of 60 μ L absolute ethyl alcohols.
3.3 equipment particle gun
(1) preparation of particle gun
Particle gun is positioned on the Bechtop of big model, opens more than the super clean bench uv lamp sterilization 30min; Clean particle gun Vakuumkammer and various element with 70% alcohol; Can split film (Rupt μ re disk1 with the soaking disinfection method; 100psi), carrier film (Macrocarrier), stop net (Stopping screen) and the Macrocarrier holders 15min that in absolute ethyl alcohol, sterilizes; Then Rupture disk and Macrocarrier are placed on the aseptic filter paper, in super clean bench, dry up; Clamp Macrocarrier holder with tweezers, on spirit lamp flame, pause calcination and be placed on the aseptic filter paper; After treating Macrocarrier holder cooling, Macrocarrier is placed in one and flattens with tweezers.Get the bronze particle absolute ethyl alcohol suspension-s that 10 μ L encapsulate DNA, put, in Bechtop, dry up in the Macrocarrier central position; Turn on the power switch, vacuum pump and helium tank valve; Take out Macrocarrier launch assembly, twist the lid off, Stopping screen calcination on spirit lamp flame is placed in the groove, Macrocarrier holder back-off on groove, the lid of screwing; Rupture disk is loaded in the fixed cap and screws; The Macrocarrier launch assembly that assembles is placed last several second grid of particle gun Vakuumkammer; The petridish that the tobacco culture block is housed is placed Target shelf center, and Target shelf is placed last several the 4th grid of Vakuumkammer, making target distance is 9cm; Fasten the Vakuumkammer wicket.
(2) bombardment
Vacuumize: press the VAC key, when vacuum tightness reaches 25～28inches Hg, the VAC key directly is locked in the HOLD position;
Bombardment: pin the FIRE key, until Rupture disk explosion; Press the VENT key again, make the vacuum meter pointer return zero.Open the Vakuumkammer wicket, take out sample.Usually each sample bombardment is 2 times.
The screening of 4 transgenic chlamydomonas
4.1 transform the excessive cultivation of back chlamydomonas
Chlamydomonas after the bombardment places the illumination condition of 3000Lux to cultivate 8h (20～25 ℃) down, washes the chlamydomonas on the agar block with the 1mL sterilized water again, is applied to the upward cultivation of resistance selection substratum (TAP) that 5 wares do not contain acetate.
4.2 transform the screening and culturing of chlamydomonas
Chlamydomonas on the selection substratum that is applied to the acetate disappearance was being cultivated about about 10 days under the continuous illumination condition of 3000Lux, and picking list algae falls within the body of acetate disappearance and selects to cultivate in the substratum (TAP).
4.3 transform the confirmatory reaction of chlamydomonas
Get the chlamydomonas of part normal growth in the selection substratum (TAP) of acetate disappearance, coat the solid resistance and select substratum (TAP+Spc 100 μ g/mL) to go up cultivation, chlamydomonas was dead in general 7-10 days.
4.4 the homogeneity of chlamydomonas transformant is cultivated
Although have only a chloroplast(id) in the chlamydomonas cell; But but contain 80～100 chloroplast gene group copies in the chloroplast(id); Both contained genetically modified genome in the initial chlamydomonas chloroplast(id) that transforms; Also contain wild type gene group copy, so its chloroplast gene group is heterogeneous, needs further homogeneity screening.
With the transformant of cultivating about 7 days in the TAP liquid selective medium (acetate disappearance); Recoat and be distributed in upward cultivation of solid selection substratum TAP (acetate disappearance); Then picking list algae falls to forwarding to cultivation in the liquid nutrient medium (acetate disappearance) again; So repeat many wheels and carry out succeeding transfer culture, improve the degree of homogenization of foreign gene in the chloroplast gene group to reach.
The detection of 5 transgenic chlamydomonas
5.1 the extraction of chlamydomonas DNA
(1) get the chlamydomonas nutrient solution that 10mL is in the logarithmic growth later stage, 5,000rpm, 4 ℃ of centrifugal 5min;
(2) after the chlamydomonas cell precipitation suspends with 350 μ L NET solution (20mM Tris-HCl, pH 8.0 for 0.1mol/LNaCl, 50mM EDTA), add 25 μ L Proteinase K (10mg/mL), 25 μ L, 20% SDS, mixing, 55 ℃ of water-bath 2h.
(3) place cooled on ice, add 200 μ L 5M potassium acetates (KAc), leave standstill 30min on ice.
(4) 12,000rpm, 4 ℃ of centrifugal 5min, supernatant add isopyknic phenol/chloroform (1: 1) extracting twice, use isopyknic chloroform extracting more once.Water adds the absolute ethyl alcohol of 2 times of volumes, and mixing is placed on-20 ℃ and leaves standstill 20min.
(5) 12,000rpm, 4 ℃ of centrifugal 5min, deposition is used 70% washing with alcohol, is dissolved in after the vacuum-drying in the 30 μ L ultrapure waters.
5.2 transgenic chlamydomonas PCR detects
(1) PCR of chlamydomonas transformant rpoN coding region DNA detects
The PCR system:
Response procedures is:
Get 4 μ L PCR products and be splined on electrophoresis on 1% sepharose, amplification obtains and the big or small on all four fragment of expection respectively in the chlamydomonas transformant, in the wild-type chlamydomonas, does not then have corresponding band (Fig. 1) to occur.
(2) PCR of the chloroplast transgenic chlamydomonas degree of homogenization detects
P1：GCCTCGCCTATCGGCTAACAAG
P2：GTAAATTCAGACTTCCAAGAAC
With transgenic chlamydomonas DNA is template, carries out pcr amplification with LA Taq archaeal dna polymerase.
The PCR system:
Response procedures is:
Amplification; Through the 4 chlamydomonas chloroplast transgenic beggars that change the rpoN gene respectively that take turns behind the resistance screening; All expand the band that a 0.86kb and the band of a 3.5kb; Size conforms to expected results, and gene site-directed being inserted in the chlamydomonas chloroplast gene group of pseudomonas stanieri Pseudomonas stutzeri A1501 rpoN is described.
5.3 the extraction of chlamydomonas total protein
(1) will be the 10mL chlamydomonas nutrient solution in logarithm later stage vegetative period, centrifugal collection;
(2) deposition is boiled 5min with 200 μ L lysates (2% SDS, 50mM Tris-Cl pH 7.5,5% beta-mercaptoethanols) after resuspended;
(3) 12000rpm, centrifugal 5min, it is 10% that supernatant adds trichoroacetic acid(TCA) to final concentration, mixing;
(4) 12000rpm, centrifugal 10min, deposition is used 90% washing with acetone, and most of chlorophyll extracting is fallen;
(5) treat that acetone vapors away after, deposition is resuspended in sample loading buffer, in order to analysis of protein.
5.4Western blot detects
(1) gets total protein and carry out electrophoresis;
(2) cut the NC film of required size, change in the transfering buffering liquid film over to 5min at least then; Also gel is immersed in the transfering buffering liquid simultaneously;
(3) on electroporation, spread filter paper, NC film, gel, filter paper successively, with the glass stick bubble of rushing, with 1.5mA/cm
2The constant current transfer printing 1.5h of gel area;
(4) take out the good film of transfer printing, put into PBS and shake gently and wash film 10min;
(5) PBS that inclines adds sealing liquid chamber temperature jog 1h;
(6) the film immersion is contained in the confining liquid of first antibody (1: 1500), 4 ℃ of jogs spend the night;
(7) film is put into washings and shake gently and wash film 3 times, each 10min;
(8) film is changed among the PBS of the goat-anti rabbit two anti-(1: 1000) that contains the HRP mark over to room temperature jog 1h;
(9) film is put into washings and shake gently and wash film 3 times, each 10min;
(10) film is changed among the PBS, jog is washed film 2 times, each 5min;
(11) film is changed in the DAB colour developing liquid of newly joining, colour developing 5-10min in dark place under the room temperature when having treated tangible colour developing band, uses the rinsed with deionized water termination reaction.
Specific hybridization signal band appears in the result in the 52kDa position, visible signal band does not then appear in not genetically modified wild-type chlamydomonas.This explanation rpoN albumen has obtained expression in the chloroplast(id) of three strain chlamydomonas transformants.
Interpretation of result shows, the present invention utilize chlamydomonas the chloroplast(id) successful expression albumen of pseudomonas stanieri Pseudomonas stutzeri A1501 rpoN.
< 110>Biological Technology institute, Chinese Academy of Agricultural Sciences
< 120>fixed nitrogen pseudomonas stanieri A1501 rpoN expression of gene method
<130> dqxl0026
<160> 3
<170> PatentIn?version?3.5
<210> 1
<211> 1374
<212> DNA
<213> Pseudomonas?stutzeri
<400> 1
atgctcgagc?gtgaagagga?cggtgacgac?ttcgacggct?ccgaccccat?ggccgaggcc
60
gtcgatcgtt?cgagcgacgc?tggcagcgaa?aagatcagta?ctcaggaaag?cacctatgaa
120
gagccttcgc?acagcggcga?aggcctcgac?gaggccgact?ggggtgagcg?cattcccagc
180
gagctaccgg?tcgacaccgc?ctgggaagac?atctaccaga?ccagcgccag?cagcctgccg
240
agcaacgacg?acgacgaatg?ggacttcacc?agccgtacgt?ccagcggtgt?cagcctgcag
300
agccatctgc?tgtggcagct?caacctcgcc?cccatgagcg?acaccgaccg?cctgatcgcc
360
accacactga?tcgactgcat?caacgatcag?ggctatctcg?aggagtctct?gcaggaaatc
420
gtggacagct?tcgacccgga?gcttgaaatc?gagctcgacg?aggtcgaagt?cgtgctgcgt
480
cgcgtacagc?agttcgaacc?tgccggtatc?ggcgcacgag?atttgcgcga?atgcctgctc
540
ctgcagctgc?gccagctccc?tgaccgcacc?ccttggctca?gcgaagccca?gcggctggtg
600
agtgaccatc?tggacctgtt?gggtagccgc?gactacagcc?tgctgatgcg?ccgcatgaag
660
ctcaaggaag?acgagctgcg?ccaggtcatc?gagctcatcc?agagcctcaa?ccctcgcccg
720
ggctcgcaga?tcgaggcgag?cgagccggag?tacgtggtgc?cggacgtcat?cgtacgcaag
780
cacaacgatc?gctggttggt?ggagctcaac?caggacgcca?tgccccgact?tcgcgtcaat
840
gcccagtacg?ccagcttcgt?aaagcgcgcc?gattcgagtg?ccgacaatac?cttcatgcgc
900
aaccagctgc?aggaagcgcg?ctggttcatc?aagagcctgc?tcagtcgcaa?cgaaacactg
960
atgaaggtcg?ccacccagat?cgtcgagcac?cagcgtgcct?tcctcgaaca?cggcgacgag
1020
gcgatgaagc?cgctggtgct?gcacgacatc?gccgaagccg?tggggatgca?tgagtcgacg
1080
atttcccgcg?tcaccacgca?gaaatacatg?catacgccgc?gtggcatcta?cgaactcaaa
1140
tacttcttct?ccagccacgt?cagcacggcg?gaaggcggcg?aatgttcgtc?caccgcgatc
1200
cgcgcgatca?tcaagaagct?ggtcgccgcg?gaaaacccga?aaaagccgtt?gagcgacagc
1260
aagatcgctg?gtttactgga?ggcgcagggc?atccaggtgg?cccgccgcac?cgttgcgaaa
1320
taccgcgagt?cgctcggtat?cgcaccgtcc?agcgagcgta?aacgattgct?gtga
1374
<210> 2
<211> 1214
<212> DNA
<213> Chlamydomonas?reinhardtii
<400> 2
gaatccgcgt?tttctccgtg?aaagggaggt?gtcctaggcc?tctagacgat?gggggctttt
60
tgttatattt?tactaaatat?atattataat?taaaaaaaat?tgaattgtca?atttttaatg
120
tacacttagt?tgaaagtgcc?cctgtcccct?tggccatatt?taacagaagt?tatttataac
180
gcagctgttt?tttggagtct?ataaatttat?aacatcagtt?actatggatt?tccctttagt
240
tttatggcct?aggacgtccc?cttccccttc?gatgctggag?gcatcctttt?acgggacaat
300
aaataaattt?gttgcctcgc?ctatcggcta?acaagttcct?tcggagtata?taaatatagg
360
atgttaatac?tgctataaac?tttagttgcc?caatatttat?attaggacgc?cagtggcagt
420
ggtaccgcca?ctgcctgctt?cgcagtatat?aaatataggc?agttggcagg?caactgccac
480
tgacgtccta?ttttaatact?cccaagttta?cttgcctagg?cagttggcag?gcaacaaatt
540
tatttattgt?ccactaaaat?ttatttgccc?gaaggggacg?tccactaaaa?tttatttacc
600
cgaaggggac?gtcctaatat?aaatatgggg?atgtcaatgc?tccgttagga?agtaactaac
660
gtttttcaaa?taaattttat?cccggaggga?agtaggcagt?agcccgccac?tgtcatcctt
720
taagtggatc?tctcgtcagg?caatttgctt?acacctttaa?attaaaaatt?aaatttaaag
780
aaaagtgagc?tattaacgcg?tttatcttaa?cggaaggcca?gtggcagttg?gcggtgccac
840
tgccgaatat?aaatatggtt?gagttgctta?gtttacctta?gcgaaaagaa?gacttagcag
900
ctagccttaa?caaacagttt?tatattttat?gtttgtgtta?aataaaatta?agaaacttta
960
gctaaagttt?cccaactcat?agaaacgtca?tctaaaatta?aagaactgtt?gtaaatttct
1020
aaaatgatta?ataagaatgc?tgcaaataaa?aggataaata?cagccattaa?aacagttgta
1080
ccccagcctg?gtaatacttt?acctgcttct?gagttaagtg?gacgtaataa?agtacctaat
1140
ggtgtaacta?aaccaggttc?ttggaagtct?gaatttactt?ttgatggttt?agctttagaa
1200
gttcctgttg?ccat
1214
<210> 3
<211> 2201
<212> DNA
<213> Artifical?sequence
<400> 3
gaattcgaat?ccgcgttttc?tccgtgaaag?ggaggtgtcc?taggcctcta?gacgatgggg
60
gctttttgtt?atattttact?aaatatatat?tataattaaa?aaaaattgaa?ttgtcaattt
120
ttaatgtaca?cttagttgaa?agtgcccctg?tccccttggc?catatttaac?agaagttatt
180
tataacgcag?ctgttttttg?gagtctataa?atttataaca?tcagttacta?tggatttccc
240
tttagtttta?tggcctagga?cgtccccttc?cccttcgatg?ctggaggcat?ccttttacgg
300
gacaataaat?aaatttgttg?cctcgcctat?cggctaacaa?gttccttcgg?agtatataaa
360
tataggatgt?taatactgct?ataaacttta?gttgcccaat?atttatatta?ggacgccagt
420
ggcagtggta?ccgccactgc?ctgcttcgca?gtatataaat?ataggcagtt?ggcaggcaac
480
tgccactgac?gtcctatttt?aatactccca?agtttacttg?cctaggcagt?tggcaggcaa
540
caaatttatt?tattgtccac?taaaatttat?ttgcccgaag?gggacgtcca?ctaaaattta
600
tttacccgaa?ggggacgtcc?taatataaat?atggggatgt?caatgctccg?ttaggaagta
660
actaacgttt?ttcaaataaa?ttttatcccg?gagggaagta?ggcagtagcc?cgccactgtc
720
atcctttaag?tggatctctc?gtcaggcaat?ttgcttacac?ctttaaatta?aaaattaaat
780
ttaaagaaaa?gtgagctatt?aacgcgtact?agtcaattgg?atatcagatc?tgcggccgcc
840
tcgagacgcg?tttatcttaa?cggaaggcca?gtggcagttg?gcggtgccac?tgccgaatat
900
aaatatggtt?gagttgctta?gtttacctta?gcgaaaagaa?gacttagcag?ctagccttaa
960
caaacagttt?tatattttat?gtttgtgtta?aataaaatta?agaaacttta?gctaaagttt
1020
cccaactcat?agaaacgtca?tctaaaatta?aagaactgtt?gtaaatttct?aaaatgatta
1080
ataagaatgc?tgcaaataaa?aggataaata?cagccattaa?aacagttgta?ccccagcctg
1140
gtaatacttt?acctgcttct?gagttaagtg?gacgtaataa?agtacctaat?ggtgtaacta
1200
aaccaggttc?ttggaagtct?gaatttactt?ttgatggttt?agctttagaa?gttcctgttg
1260
ccataattga?ttaaatgaat?taagcgttat?tagcgctatt?ttatttactt?tctgtaaaaa
1320
ataaggaaaa?tattcttcag?tgcattccct?ctcaggatta?taaatactct?gaggataacg
1380
ttctctcgtc?aaggggttgc?ttcttgtgag?tatagaaacc?tactagcaca?agaaataaat
1440
tgcataaaaa?tgtatttacc?taggaccgca?gtaggcagtc?ccttttcccc?ttcagaactg
1500
cctgctttaa?aagaatgaaa?aaactgcctt?gtctggtaag?taaaactctt?taattactca
1560
ctaaagacga?tcttagaagt?tctttgttca?ttttttattt?aatataatat?ttgttatata
1620
aaaattaaat?aatttttaat?taatgtttaa?ctttgtaagg?acagtttcaa?agtgacatga
1680
atggctactg?caaaaacgaa?gtaagttatt?ctttctcagg?gcaaaatttt?gagtagatta
1740
attttgttta?aaaatgtggg?acacagtcgt?caagtctttt?gaactatcta?agagatatgt
1800
tgaaaagaga?ataattttat?tattaaatga?gctatggaaa?gtccagcttt?tttctttacc
1860
ttttttttat?ggtttcttct?gttaagtgta?actggctatt?cagtttatgt?tagttttggt
1920
ccaccttcaa?aaaaattacg?tgatcctttt?gaagaacacg?aagattaaac?aagttaaaaa
1980
gtactatttt?tacaagtgac?ttcggtgcct?ctgagaaccc?tagttatagt?gatataaaat
2040
aactagctaa?ctactttata?tttttatgaa?agtcattttg?tcgagcatat?aaacaaaaac
2100
aaaattgcta?tactaggcag?tcacagtgca?actgtctccg?tctccttaac?cgagaaaggg
2160
taaacgtctt?cggtaaagta?acaaacttta?gttatgttcc?c
2201
Claims (9)
- A fixed nitrogen pseudomonas stanieri ( Pseudomonas stutzeri) A1501 RpoNThe expression of gene method is characterized in that, comprising: make up RpoNThe expression of gene box; With constructed RpoNThe expression of gene box is inserted between the homologous fragment of the chlamydomonas chloroplast gene group on the chlamydomonas chloroplast expression carrier, makes up the chlamydomonas chloroplast expression carrier that obtains recombinating; The chlamydomonas chloroplast expression carrier of will recombinating conversion chlamydomonas ( Chlamydomonas reinhardtii); Screening transgenic chlamydomonas is induced in the transgenic chlamydomonas RpoNGenetic expression, results and the expressed albumen of purifying.
- 2. according to the described expression method of claim 1, it is characterized in that: said RpoNThe expression of gene box by chlamydomonas chloroplast(id) specific promoter, RpoNGene and the special terminator of chlamydomonas chloroplast(id) are formed.
- 3. according to the described expression method of claim 2, it is characterized in that: said RpoNGene places under the regulation and control of chlamydomonas chloroplast gene specific promoter and terminator.
- 4. according to claim 2 or 3 described expression methods, it is characterized in that: described chlamydomonas chloroplast(id) specific promoter comprises AtpA, AtpB, PsbA, PsbDOr RbcLThe special terminator of described chlamydomonas chloroplast(id) does RbcLTerminator.
- 5. according to any one described expression method of claim 1-3, it is characterized in that: the nucleotides sequence of said rpoN gene is classified as shown in the SEQ ID NO:1.
- 6. according to the described expression method of claim 1, it is characterized in that: the homologous fragment of described chlamydomonas chloroplast gene group does TrnE2-psbHGene, its nucleotides sequence are classified as shown in the SEQ ID NO:2.
- 7. according to the described expression method of claim 1, it is characterized in that: described chlamydomonas ( Chlamydomonas reinhardtii) strain be cw15.
- 8. according to the described expression method of claim 1, it is characterized in that: the mode that described reorganization chlamydomonas chloroplast expression carrier transforms chlamydomonas is in the chlamydomonas in growth logarithmic phase later stage for adopting the particle gun bombardment that is enclosed with reorganization chlamydomonas chloroplast expression carrier.
- 9. according to the described expression method of claim 1, it is characterized in that: described screening transgenic chlamydomonas is that the screening of medium through no acetate obtains the transgenic chlamydomonas.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103267044A CN102417882A (en) | 2011-10-25 | 2011-10-25 | Expression method of pseudomonas stutzeri A1501 rpoN gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103267044A CN102417882A (en) | 2011-10-25 | 2011-10-25 | Expression method of pseudomonas stutzeri A1501 rpoN gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102417882A true CN102417882A (en) | 2012-04-18 |
Family
ID=45942526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103267044A Pending CN102417882A (en) | 2011-10-25 | 2011-10-25 | Expression method of pseudomonas stutzeri A1501 rpoN gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102417882A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103614410A (en) * | 2013-11-20 | 2014-03-05 | 中国农业科学院生物技术研究所 | Application of rsmA gene in colonization and growth promotion of root surface of plant |
| CN111527057A (en) * | 2017-10-25 | 2020-08-11 | 皮沃特生物股份有限公司 | Gene target for fixing nitrogen for targeted improvement of plant traits |
| US11479516B2 (en) | 2015-10-05 | 2022-10-25 | Massachusetts Institute Of Technology | Nitrogen fixation using refactored NIF clusters |
| US11565979B2 (en) | 2017-01-12 | 2023-01-31 | Pivot Bio, Inc. | Methods and compositions for improving plant traits |
| US11739032B2 (en) | 2015-07-13 | 2023-08-29 | Pivot Bio, Inc. | Methods and compositions for improving plant traits |
| US11946162B2 (en) | 2012-11-01 | 2024-04-02 | Massachusetts Institute Of Technology | Directed evolution of synthetic gene cluster |
| US11993778B2 (en) | 2017-10-25 | 2024-05-28 | Pivot Bio, Inc. | Methods and compositions for improving engineered microbes that fix nitrogen |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010061404A1 (en) * | 2008-11-27 | 2010-06-03 | International Centre For Genetic Engineering And Biotechnology | A method of expressing foreign protein in plastids |
| CN101812468A (en) * | 2009-11-20 | 2010-08-25 | 中国农业科学院生物技术研究所 | Method for preparing rabies virus antigen by chloroplast |
-
2011
- 2011-10-25 CN CN2011103267044A patent/CN102417882A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010061404A1 (en) * | 2008-11-27 | 2010-06-03 | International Centre For Genetic Engineering And Biotechnology | A method of expressing foreign protein in plastids |
| CN101812468A (en) * | 2009-11-20 | 2010-08-25 | 中国农业科学院生物技术研究所 | Method for preparing rabies virus antigen by chloroplast |
Non-Patent Citations (3)
| Title |
|---|
| YAN Y. 等: "登录号：CP000304.1", 《GENBANK》, 28 May 2008 (2008-05-28) * |
| 刘国宪 等: "衣藻叶绿体表达系统的研究", 《生物技术通报》, no. 9, 31 December 2009 (2009-12-31) * |
| 韩四海 等: "外源基因在莱茵衣藻叶绿体中的表达", 《生物技术通报》, no. 1, 31 December 2007 (2007-12-31) * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11946162B2 (en) | 2012-11-01 | 2024-04-02 | Massachusetts Institute Of Technology | Directed evolution of synthetic gene cluster |
| CN103614410A (en) * | 2013-11-20 | 2014-03-05 | 中国农业科学院生物技术研究所 | Application of rsmA gene in colonization and growth promotion of root surface of plant |
| CN103614410B (en) * | 2013-11-20 | 2016-02-24 | 中国农业科学院生物技术研究所 | RsmA gene plant root table surely grow with growth-promoting in application |
| US11739032B2 (en) | 2015-07-13 | 2023-08-29 | Pivot Bio, Inc. | Methods and compositions for improving plant traits |
| US11479516B2 (en) | 2015-10-05 | 2022-10-25 | Massachusetts Institute Of Technology | Nitrogen fixation using refactored NIF clusters |
| US11565979B2 (en) | 2017-01-12 | 2023-01-31 | Pivot Bio, Inc. | Methods and compositions for improving plant traits |
| CN111527057A (en) * | 2017-10-25 | 2020-08-11 | 皮沃特生物股份有限公司 | Gene target for fixing nitrogen for targeted improvement of plant traits |
| US11993778B2 (en) | 2017-10-25 | 2024-05-28 | Pivot Bio, Inc. | Methods and compositions for improving engineered microbes that fix nitrogen |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102417882A (en) | Expression method of pseudomonas stutzeri A1501 rpoN gene | |
| CN102199581B (en) | Zearalenone toxin degradation enzyme and coding gene and application thereof | |
| CN101985627B (en) | Novel esterase and application thereof | |
| CN100439506C (en) | Escherichia coli self-cracking method and its dedicated carrier and application | |
| CN112458072A (en) | Alkaline protease mutant and preparation thereof | |
| CN101880676A (en) | Constructing method of nifA gene-introduced rhizobium japonicum genetic engineering bacterial strain HD-SFH-01 | |
| CN105062992A (en) | Endolysin and polynucleotide for encoding the same | |
| CN111235083A (en) | Pseudomonas fluorescens biocontrol recombinant engineering bacterium for expressing chitinase coding gene and construction method and application thereof | |
| CN104450632B (en) | Amino acid sequence capable of improving heat-resistance temperature and heat stability of SOD and application thereof | |
| CN105861522A (en) | Antibacterial peptide Enterocin P and preparation method and application thereof | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN107475222A (en) | The heat-resisting human lysozyme of genetic engineering transformation | |
| CN101654681A (en) | Lactobacillus food grade expression vector pMG36N and preparation method thereof | |
| Zienkiewicz et al. | PEG-mediated, stable, nuclear and chloroplast transformation of Cyanidioschizon merolae | |
| CN114958893B (en) | Construction method of lactase required by preparation of suckling pig high-temperature creep feed | |
| CN109266676A (en) | A kind of method of electroporated Siam bacillus | |
| CN101974546A (en) | Nisin-rbLF-N fusion gene and pichia pastoris engineering bacteria for expressing same | |
| CN110106128A (en) | A kind of genetic engineering bacterium and its construction method producing recombinant basic protease | |
| CN104946606A (en) | Genetic engineering transformed thermal-resistant adverse-resistant SOD as well as encoding gene and application thereof | |
| JP3757325B2 (en) | Microalgae for carbon dioxide fixation | |
| CN101812468A (en) | Method for preparing rabies virus antigen by chloroplast | |
| CN111118039B (en) | Pathogenicity-related botrytis cinerea genes Bcmet3 and Bcmet16 and application | |
| CN106995793A (en) | A kind of fermentation process in high density for recombinating bG-CSF engineering bacteria | |
| CN104371984B (en) | Amino acid sequences capable of improving SOD stress resistance and stability in aqueous solution and application thereof | |
| CN103233035A (en) | China tachyplesin constitutive yeast expression vector and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120418 |