CN102307595A - Antibodies and methods for treating estrogen receptor-associated diseases - Google Patents

Abstract

Provided herein in certain embodiments are antibodies, antibody fragments, pharmaceutical compositions, methods for modulating the functions of estrogen receptor alpha 36, and methods for preventing and/or treating diseases mediated by estrogen receptor alpha 36.

Description

The antibody and the method for treatment estrogen receptor relevant disease

Invention field

The present invention relates to can be used for preventing and/or treating antibody, the pharmaceutical composition of estrogen receptor relevant disease and prevent and/or treat method.

Background technology

Estrogen is participated in the physiological function of multiple key in the human body.Estrogen function comprises grows female sexual organ, for pregnancy is done that the uterus is prepared and prepared for dividing the puerperium to do suckling.Estrogen also plays an important role aspect appropriate cardiovascular function and the bone density keeping.Estrogen can stimulate cellular proliferation, so can increase women cancered risk, particularly breast carcinoma and uterus carcinoma.

But estrogen conjugated estrogen hormone receptor and regulate cell function in target cell.Two kinds of estrogen receptor (hER) in human body cell, have been found, hER-α and hER-β.Their protein structure is similar, three independences is all arranged but interactional functional domain: N end structure territory (A/B domain), middle DNA binding structural domain (C-structure territory) and C end ligand binding domain (D/E/F domain).N end structure territory has the mobilizing function (AF-1) of part dependent/non-dependent, under the condition that does not have part to exist, can interact and participate in the transcriptional activation of target gene with the activation cofactor.The DNA binding structural domain can combine DNA sequence specifically, and in receptor dimerizationization, plays a significant role.The C end combines territory mediation part to combine, and has the mobilizing function (AF-2) of ligand dependent, can under the condition that part exists, transcribe by activated gene.

HER-α albumen total length 66kDa is called hER-α 66.HER-α 66 contains three whole functional domains.Find the splicing isomer of hER-α 66 subsequently, be called hER-α 46.HER-α 46 molecular weight are about 46KDa, the N end AF-1 domain among the disappearance hER-α 66.Found the hER-α variant of a kind of new 36kDa recently again, hER-36 α.The N end AF-1 domain of its disappearance hER-α 66 and C end AF-2 domain (Wang et al., Biochem.Biophys.Res.Commun.336,1023-1027 (2005)).

Thereby hER-α 66 is considered to stimulate cellular proliferation through the mediation estrogen of transcribing that activates the estrogen target gene.Estrogen combines can activate its trans-activation domain behind the hER-α 66, thereby stimulates the downstream target gene expression and finally cause cell proliferation.Discover that hER-α 46 can mediate nitric oxide production rapidly synthetic (Li et al., Proc.Natl.Acad.Sci.USA 100:4807-4812 (2003)) at cell membrane under estrogenic stimulation.The hER-α 46 in disappearance AF-1 territory can suppress the AF-1 active (Flouriot, G., EMBO, 19,4688-4700, (2000)) of hER-α 66.Because hER-α 36 disappearance AF-1 and AF-2 transcription activating domains so have hER-α 66 and the dominant negative inhibitor activity of hER-β, can suppress AF-1 and the AF-2 function of hER-α and hER-β.In addition, hER-α 36 mainly is positioned cell membrane, mediates estrogenic cell membrane signal transduction, stimulates cellular proliferation and mitosis.(Wang?et?al.，Biochem.Biophys.Res.Commun.336，1023-1027(2005)；Wanget?al.，Proc.Natl.Acad.Sci.U.S.A.103：9063-9068(2006))。

Big quantity research proves that the estrogen receptor signal transduction is by classical consideration convey record activation pathway and the mediation of non-classical film signal path.HER-α 66 and hER-α 46 maybe be mainly in nuclear performance function and hER-α 36 is main through bringing into play function outside the nuclear.

Research shows that also the spiral 8-12 of original hER-α 66 ligand binding domains of hER-α 36 disappearances is so changed the part binding specificity of hER-α 36 fully.Therefore, hER-α 36 can combine the part different with hER-β with hER-α 66.

Because the estrogen disease relevant with estrogen receptor be still at the many individualities of influence, so press for new departure such as new antibody and/or the new preventing/treating method that discovery can be used for preventing and/or treating these diseases.

Summary of the invention

The invention provides the antibody and the Fab thereof that can be used for treatment, prevention, diagnosis and estrogen receptor ER-α 36 (SEQ ID NO:1, the gene number of landing BX640939) correlation behavior, and pharmaceutical composition and method for using.

In some embodiments, the invention provides an antibody or its Fab, but its specificity combines ER-α 36 but not ER-α 66 (the gene number of landing X03635, aminoacid sequence see that Fig. 1 a) or ER-α 46 (aminoacid sequence is seen Fig. 1 b).In some embodiments, said antibody or its Fab can combine the amino acid residue 284 to 310 among the SEQ ID NO:1 specifically, or the amino acid residue among the SEQ ID NO:2 1 to 27.

In some embodiments; The invention provides an antibody or its Fab, its bonded epi-position is same as ScFv1 (SEQ ID NO:3), ScFv2 (SEQ ID NO:5), ScFv3 (SEQ ID NO:7), ScFv4 (SEQ ID NO:9), ScFv5 (SEQ ID NO:11), ScFv6 (SEQ ID NO:13), the bonded epi-position of ScFv7 (SEQ ID NO:15) institute's specificity basically.

In some embodiments, the invention provides an antibody or its Fab, it comprises HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.In some such embodiment, described antibody or its Fab comprise HCDR1, HCDR2 and the HCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.In some such embodiment, described antibody or its Fab comprise the variable region of heavy chain of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.

In some embodiments, antibody or its Fab comprise LCDR1, LCDR2 and/or the LCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.In some such embodiment, described antibody or its Fab comprise LCDR1, LCDR2 and the LCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.In some such embodiment, described antibody or its Fab comprise the variable region of light chain of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.

In some embodiments, antibody or its Fab contain 1) HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7; 2) LCDR1 of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7, LCDR2 and/or LCDR3 sequence.Under some such embodiment, described antibody or its Fab contain 1) HCDR1, HCDR2 and the HCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7; And 2) LCDR1 of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7, LCDR2 and LCDR3 sequence.

In some embodiments; Antibody or its Fab contain a variable region of heavy chain; It contains 1) a heavy chain CDR1, be selected from following one group: ScFv 1 HCDR1, ScFv 2 HCDR1, ScFv 3 HCDR1, ScFv 4 HCDR1, ScFv 5 HCDR1, ScFv 6 HCDR1 and ScFv 7 HCDR1; 2) a heavy chain CDR2; Be selected from following one group: ScFv 1 HCDR2, ScFv 2 HCDR2, ScFv 3 HCDR2, ScFv 4 HCDR2, ScFv 5 HCDR2, ScFv 6 HCDR2 and ScFv 7 HCDR2; With 3) a heavy chain CDR3, be selected from following one group: ScFv 1 HCDR3, ScFv 2 HCDR3, ScFv 3 HCDR3, ScFv 4 HCDR3, ScFv 5 HCDR3, ScFv 6 HCDR3 and ScFv 7 HCDR3.ScFv m HCDR i refers to the HCDR i (1≤i≤3,1≤m≤7) of ScFv m.

In some embodiments; Antibody or its Fab contain variable region of light chain; It contains 1) a light chain CDR1, be selected from following one group: ScFv 1 LCDR1, ScFv 2 LCDR1, ScFv 3 LCDR1, ScFv 4 LCDR1, ScFv 5 LCDR1, ScFv 6 LCDR1 and ScFv 7 LCDR1; 2) a light chain CDR2; Be selected from following one group: ScFv 1 LCDR2, ScFv 2 LCDR2, ScFv 3 LCDR2, ScFv 4 LCDR2, ScFv 5 LCDR2, ScFv 6 LCDR2 and ScFv 7 LCDR2; With 3) a light chain CDR3, be selected from following one group: ScFv 1 LCDR3, ScFv 2 LCDR3, ScFv 3 LCDR3, ScFv 4 LCDR3, ScFv 5 LCDR3, ScFv 6 LCDR3 and ScFv 7 LCDR3.ScFvm LCDRi is meant the LCDR i (1≤i≤3,1≤m≤7) of ScFvm.

In some embodiments, antibody provided by the invention or its Fab contain 1) variable region of heavy chain, it contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7; With 2) variable region of light chain, it contains LCDR1, LCDR2 and/or the LCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.In some such embodiment, said antibody or its Fab contain 1) variable region of heavy chain, it contains HCDR1, HCDR2 and the HCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7; 2) variable region of light chain, it contains LCDR1, LCDR2 and the LCDR3 sequence of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 or ScFv7.In some such embodiment; Said antibody or its Fab contain 1) variable region of heavy chain; Be selected from the group that forms by any variable region of heavy chain of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 and ScFv7; With 2) variable region of light chain, be selected from the group that forms by any variable region of light chain of ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 and ScFv7.

In some embodiments, antibody or its Fab contain:

A) variable region of heavy chain, it contains 1) a heavy chain CDR1 is selected from following one group: ScFv 1 HCDR1, ScFv 2 HCDR1, ScFv 3 HCDR1, ScFv 4 HCDR1, ScFv 5 HCDR1, ScFv 6 HCDR1 and ScFv 7HCDR1; 2) a heavy chain CDR2 is selected from following one group: ScFv 1 HCDR2, ScFv 2 HCDR2, ScFv 3 HCDR2, ScFv 4 HCDR2, ScFv 5 HCDR2, ScFv 6 HCDR2 and ScFv 7 HCDR2; And 3) a heavy chain CDR3 is selected from following one group: ScFv 1 HCDR3, ScFv 2 HCDR3, ScFv 3 HCDR3, ScFv 4 HCDR3, ScFv 5 HCDR3, ScFv 6 HCDR3 and ScFv 7 HCDR3; And

B) variable region of light chain, it contains 1) a light chain CDR1 is selected from following one group: ScFv 1 LCDR1, ScFv 2 LCDR1, ScFv 3 LCDR1, ScFv 4 LCDR1, ScFv 5 LCDR1, ScFv 6 LCDR1 and ScFv 7 LCDR1; 2) a light chain CDR2 is selected from following one group: ScFv 1 LCDR2, ScFv 2 LCDR2, ScFv 3 LCDR2, ScFv 4 LCDR2, ScFv 5 LCDR2, ScFv 6 LCDR2 and ScFv 7 LCDR2; And 3) a light chain CDR3 is selected from following one group: ScFv 1 LCDR3, ScFv 2 LCDR3, ScFv 3 LCDR3, ScFv 4 LCDR3, ScFv 5 LCDR3, ScFv 6 LCDR3 and ScFv 7 LCDR3.

In some embodiments, antibody provided by the invention or its Fab contain a variable region of heavy chain, and it contains 1) one or more aminoacid sequences of in SEQ ID NO:20, SEQ ID NO:21 and/or SEQ ID NO:22, listing; 2) one or more aminoacid sequences of in SEQ ID NO:26, SEQ ID NO:27 and/or SEQ ID NO:28, listing; 3) one or more aminoacid sequences of in SEQ ID NO:32, SEQ ID NO:33 and/or SEQ ID NO:34, listing; 4) one or more aminoacid sequences of in SEQ ID NO:38, SEQ ID NO:39 and/or SEQ ID NO:40, listing; 5) one or more aminoacid sequences of in SEQ ID NO:44, SEQ ID NO:45 and/or SEQ ID NO:46, listing; 6) one or more aminoacid sequences of in SEQ ID NO:50, SEQ ID NO:51 and/or SEQ ID NO:52, listing; Or 7) one or more aminoacid sequences of in SEQ IDNO:56, SEQ ID NO:57 and/or SEQ ID NO:58, listing.Under some such embodiment; Antibody or its Fab contain a variable region of heavy chain, and it comprises the sequence that is selected from like next group: SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72.

In some embodiments, antibody provided by the invention or its Fab contain a variable region of light chain, and it contains 1) one or more aminoacid sequences of in SEQ ID NO:17, SEQ ID NO:18 and/or SEQ ID NO:19, listing; 2) one or more aminoacid sequences of in SEQ ID NO:23, SEQ ID NO:24 and/or SEQ ID NO:25, listing; 3) one or more aminoacid sequences of in SEQ ID NO:29, SEQ ID NO:30 and/or SEQ ID NO:31, listing; 4) one or more aminoacid sequences of in SEQ ID NO:35, SEQ ID NO:36 and/or SEQ ID NO:37, listing; 5) one or more aminoacid sequences of in SEQ ID NO:41, SEQ ID NO:42 and/or SEQ ID NO:43, listing; 6) one or more aminoacid sequences of in SEQ ID NO:47, SEQ ID NO:48 and/or SEQ ID NO:49, listing; Or 7) one or more aminoacid sequences of in SEQ ID NO:53, SEQ ID NO:54 and/or SEQ ID NO:55, listing.In some embodiments; Antibody or its Fab contain a kind of variable region of light chain, and it comprises the sequence that is selected from like next group: SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of heavy chain; It contains 1) a heavy chain CDR1, comprise the sequence that is selected from like next group: SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38 and SEQ ID NO:44; 2) a heavy chain CDR2 comprises the sequence that is selected from like next group: SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39 and SEQ ID NO:45; With 3) a heavy chain CDR3, comprise the sequence that is selected from like next group: SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52 and SEQ ID NO:58.In some such embodiment; Said antibody or its Fab contain a variable region of heavy chain, and it comprises and is selected from one group following sequence: SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains 1) a light chain CDR1, comprise the sequence that is selected from like next group: SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:47 and SEQ ID NO:53; 2) a light chain CDR2 comprises the sequence that is selected from like next group: SEQ ID NO:18, SEQ ID NO:24, SEQ ID NO:36, SEQ ID NO:48 and SEQ ID NO:54; With 3) a light chain CDR3, select group composed of the following components: SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49 and SEQ ID NO:55.In some such embodiment; Described antibody or its Fab contain a variable region of light chain, and it comprises the sequence that is selected from like next group: SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71.

In some embodiments, antibody provided by the invention or its Fab contain:

A) variable region of light chain, it contains 1) one or more aminoacid sequences of in SEQ ID NO:17, SEQ ID NO:18 and/or SEQ ID NO:19, listing; 2) one or more aminoacid sequences of in SEQ ID NO:23, SEQ ID NO:24 and/or SEQ ID NO:25, listing; 3) one or more aminoacid sequences of in SEQ ID NO:29, SEQ ID NO:30 and/or SEQ ID NO:31, listing; 4) one or more aminoacid sequences of in SEQ ID NO:35, SEQ ID NO:36 and/or SEQ ID NO:37, listing; 5) one or more aminoacid sequences of in SEQ ID NO:41, SEQ ID NO:42 and/or SEQ ID NO:43, listing; 6) one or more aminoacid sequences of in SEQ ID NO:47, SEQ ID NO:48 and/or SEQ ID NO:49, listing; Or 7) one or more aminoacid sequences of in SEQ ID NO:53, SEQ ID NO:54 and/or SEQ ID NO:55, listing; With

B) variable region of heavy chain, it contains 1) one or more aminoacid sequences of in SEQ ID NO:20, SEQ ID NO:21 and/or SEQ ID NO:22, listing; 2) one or more aminoacid sequences of in SEQ ID NO:26, SEQ ID NO:27 and/or SEQ ID NO:28, listing; 3) one or more aminoacid sequences of in SEQ ID NO:32, SEQ ID NO:33 and/or SEQ ID NO:34, listing; 4) one or more aminoacid sequences of in SEQ ID NO:38, SEQ ID NO:39 and/or SEQ ID NO:40, listing; 5) one or more aminoacid sequences of in SEQ ID NO:44, SEQ ID NO:45 and/or SEQ ID NO:46, listing; 6) one or more aminoacid sequences of in SEQ ID NO:50, SEQ ID NO:51 and/or SEQ ID NO:52, listing; Or 7) one or more aminoacid sequences of in SEQ ID NO:56, SEQ ID NO:57 and/or SEQ ID NO:58, listing.

In some embodiments, antibody provided by the invention or its Fab contain:

A) variable region of heavy chain, it contains 1) a heavy chain CDR1, comprise the sequence that is selected from like next group: SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38 and SEQ ID NO:44; 2) a heavy chain CDR2 comprises the sequence that is selected from like next group: SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39 and SEQ ID NO:45; With 3) a heavy chain CDR3, comprise the sequence that is selected from like next group: SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52 and SEQ ID NO:58; With

B) variable region of light chain, it contains 1) a light chain CDR1, comprise the sequence that is selected from like next group: SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:47 and SEQ ID NO:53; 2) a light chain CDR2 comprises the sequence that is selected from like next group: SEQ IDNO:18, SEQ ID NO:24, SEQ ID NO:36, SEQ ID NO:48 and SEQ ID NO:54; With 3) a light chain CDR3, comprise the sequence that is selected from like next group: SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49 and SEQ ID NO:55.

In some embodiments; Said antibody or its Fab contain A) variable region of light chain, comprise the sequence that is selected from like next group: SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69 and SEQ ID NO:71; And B) variable region of heavy chain comprises the sequence that is selected from like next group: SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70 and SEQ ID NO:72.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:59, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:60, listing.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO:25, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:61, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:62, listing.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:31, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:63, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:64, listing.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:65, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:66, listing.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:67, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:68, listing.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:50, SEQ ID NO:51 and SEQ ID NO:52, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:69, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in sequence 70, listing.

In some embodiments; Antibody provided by the invention or its Fab contain a variable region of light chain; It contains one or more aminoacid sequences of in SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55, listing; With a variable region of heavy chain, it contains one or more aminoacid sequences of in SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58, listing.In some such embodiment, the variable region of light chain of said antibody or its Fab contains the aminoacid sequence of in SEQ ID NO:71, listing.In some embodiments, the variable region of heavy chain of this antibody or its Fab contains the aminoacid sequence of in sequence 72, listing.

In the embodiment more than some, disclosed antibody or its Fab further contain a lambda light chain, κ light chain, a γ 1 heavy chain, a γ 2 heavy chains, a γ 3 heavy chains or a γ 4 CH among the present invention.In some such embodiment, described antibody or its Fab contain an IgG2 constant region.In some embodiments, the disclosed antibody of the present invention is complete antibody.In some such embodiment, said antibody can be monoclonal antibody, polyclonal antibody, recombinant antibodies, bispecific antibody, humanized antibody, chimeric antibody, traget antibody, bivalent antibody, anti-idiotype antibody or fully human antibodies.In some embodiments, the antibody that provides among the present invention or its Fab can be camelization single domain antibody (camelized single chain domain antibody), bifunctional antibody (diabody); ScFv, scFv dimer, BsFv; DsFv, (dsFv) ₂, dsFv-dsFv ', Fv fragment, Fab, Fab ', F (ab ') ₂, ds bifunctional antibody (ds diabody), nano antibody, domain antibodies, or two valency domain antibodies.

In some embodiments, the antibody that provides among the present invention or its Fab can combine ER-α 36 and/or regulation and control ER-α 36 activity specifically.In some embodiments, the disease that disclosed antibody or its Fab can treat, suppress, reduce or prevention and ER-α 36 are relevant among the present invention.For example, disclosed antibody or its Fab can suppress tumor growth among the present invention, and its inhibitory action and tumor growth suppress percentage ratio and be functional relationship; Can reduce the tumor size; Or the specific size of delay tumor growth to.

In some embodiments, said antibody or its Fab and ER-α 36 bonded K _DValue≤1000pM.In some such embodiment, said antibody or its Fab and ER-α 36 bonded K _DValue≤500pM, in another embodiment≤200pM ,≤100pM ,≤50pM ,≤20pM ,≤10pM, or≤1pM.

In some embodiments; The invention provides some method; Can be through disclosed antibody or its Fab among one or more the present invention that the demand object treated effective dose, thus the relevant disease of inhibition in said object, treatment, minimizing or prevention and ER-α 36.In some embodiments, the single-dose dosage of said antibody or its Fab arrives about 100mg/kg (for example, about 10mg/kg or about 5mg/kg or still less) for about 0.01mg/kg.In some such embodiment, the single-dose dosage of described antibody or its Fab is 1mg/kg or still less, in other embodiment, is about 0.5mg/kg or still less, in other embodiment in addition, is about 0.1mg/kg or still less.In some embodiments, the administering mode of said antibody or its Fab is a multiple dosing, and each dosing interval is for arrive whenever bimonthly once a day.In some such embodiment, said antibody or its Fab can be administered once in an about week, and about two weeks are administered once, and are administered once January approximately, or are administered once approximately the bimester.

In some embodiments; The invention provides method of diagnosing; Through certain sample is contacted with antibody provided by the invention or its Fab; Confirm combining of said antibody or its Fab and said sample, thereby confirm the carrying out/regression of ER-α 36 proteic existence or certain disease relevant with ER-α 36.For example, the invention provides a test kit, contain disclosed antibody or its Fab among one or more the present invention.In some embodiments, said test kit contains the operation instruction of using said antibody or its Fab, and/or other component operation instructions in the test kit.

In some embodiments, the invention provides polynucleotide, the aminoacid sequence of its encode antibody disclosed by the invention or its Fab.In some other embodiment, the invention provides the carrier that contains above-mentioned polynucleotide, in some other embodiment, the invention provides the host cell that contains above-mentioned carrier.In some embodiments; The invention provides the method for expressing one or more antibody disclosed by the invention or its Fab; This method is through cultivating host cell under certain condition, makes encoding said antibody or the polynucleotide of its Fab in the carrier be able to express.In some embodiments, polynucleotide provided by the invention functionally are connected in the promoter in the carrier, like the CMV promoter.In some embodiments, the host cell that contains carrier provided by the invention is a Chinese hamster ovary cell.

In some embodiments, the invention provides pharmaceutical composition, it contains one or more antibody disclosed by the invention or its Fab.In some embodiments, said compositions further contains one or more pharmaceutical carriers (carrier).In some such embodiment, described one or more pharmaceutical carriers can be that one or more acceptable for pharmaceutical supporting agents comprise, for example, and diluent, antioxidant, adjuvant, adjuvant or non-toxic auxiliary substances.

In some embodiments, one or more antibody provided by the invention or its Fab can be used for making medicine, and it can be used for treating the disease relevant with ER-α 36.

Description of drawings

The behave aminoacid sequence of ER of Fig. 1.Wherein Fig. 1 a is the aminoacid sequence of ER α 66, and Fig. 1 b is the aminoacid sequence of ER α 46.

ScFv1 (S14), ScFv2 (S24), ScFv3 (S33), ScFv4 (S41), ScFv6 (S66) and ScFv7 (S72) the result in SDS-PAGE electrophoresis of Fig. 2 for existing with inclusion body.Fig. 2 a, 2b, 2c, 2d, 2e and 2f are the SDS-PAGE electrophoresis result, have shown ScFv1 respectively, ScFv2, ScFv3, ScFv4, ScFv6 and ScFv7 be at supernatant S14, S24, S33, S41, the existence of S66 and S72 (seeing arrow).

Fig. 3 is the SDS-PAGE electrophoresis result of the ScFv behind the purification.Fig. 3 a, ScFv1, ScFv4 and ScFv6 behind 3b and the corresponding purification of 3c difference.

Fig. 4 is the SDS-PAGE electrophoresis result of the ScFv after the renaturation.In Fig. 4 a, 1: the reduction SDS-PAGE electrophoretogram of the ScFv1 after the renaturation; 2: the non-reduced SDS-PAGE electrophoretogram of the ScFv1 after the renaturation.Fig. 4 b shows the reduction SDS-PAGE electrophoretogram (1: the ScFv4 after the renaturation of the ScFv4 after the renaturation; 2: molecular weight standard).Fig. 4 c has shown the reduction SDS-PAGE electrophoretogram (1: the ScFv6 after the renaturation of the ScFv6 after the renaturation; 2: molecular weight standard).

Fig. 5 is the reduction SDS-PAGE electrophoretogram of ScFv1～ScFv7 after the renaturation, S14 wherein, and S24, S33, S41, S53, S66 and S72 correspond respectively to ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 and ScFv7.

Fig. 6 is the ELISA result of anti-ER-α 36 ScFv1～ScFv7, shows the adhesion of ScFv1～ScFv7 and ER-α 36.

Fig. 7 is anti-ER-α 36 ScFv1 of tumor bearing nude mice difference administration, ScFv3, and ScFv4, ScFv7 and anti-ER-α 36 polyclonal antibodies, behind negative control IgG and the positive control Trastuzumab, the variation of its relative tumour volume.

Fig. 8 is anti-ER-α 36 ScFv1 of tumor bearing nude mice difference administration, ScFv3, and ScFv4, ScFv7 and anti-ER-α 36 polyclonal antibodies, behind negative control IgG and the positive control Trastuzumab, the variation of its tumor weight.

Fig. 9 is anti-ER-α 36 ScFv1 of tumor bearing nude mice difference administration, ScFv3, and ScFv4, ScFv7 and anti-ER-α 36 polyclonal antibodies, behind negative control IgG and the positive control Trastuzumab, the variation of its tumor control rate.

Figure 10 is tumor bearing nude mice difference administration negative control IgG (10a); Positive control Trastuzumab (10b); Anti-ER-α 36 polyclonal antibodies (10c); Anti-ER-α 36 ScFv1 (10d); Anti-ER-α 36 ScFv3 (10e), the photo of the tumor that take out ER-α 36 ScFv4 (10f) and anti-ER-α 36 ScFv7 (10g) back.

Figure 11 is tumor bearing nude mice administration contrast respectively, the relative tumour volume behind ScFv7 and the tamoxifen.

Figure 12 is tumor bearing nude mice administration contrast respectively, and ScFv7 is with the relative tumor growth rate behind the tamoxifen.

Figure 13 is tumor bearing nude mice administration contrast respectively, the tumor weight behind ScFv7 and the tamoxifen.

Figure 14 is tumor bearing nude mice administration contrast respectively, the inhibition rate of tumor growth behind ScFv7 and the tamoxifen.

Figure 15 is tumor bearing nude mice difference administration tamoxifen (a), the photo of the tumor of the taking-up after anti-tumour antibody (b) and the contrast (c).

Figure 16 is the Western Blot result who in SK-BR-3 and HEK293/ER36 cell, detects ER-α 36 with ScFv1～ScFv7.

The specific embodiment

The following description of the present invention only is explanation numerous embodiments of the present invention.Likewise, concrete modification mode discussed herein should not be construed as the restriction to invention scope.Those skilled in the art do not depart from the scope of the invention can draw multiple equivalent at an easy rate, changes and modification, should understand such embodiment that is equal to and be included in the scope of the present invention.

" antibody " speech among the present invention comprises monoclonal antibody, polyclonal antibody, multi-specificity antibody or bispecific (two valency) antibody that can combine certain specific antigen arbitrarily.A complete antibody comprises two heavy chains and two light chains.Every heavy chain is made up of a variable region and first, second, third constant region; Every light chain is made up of a variable region and a constant region.Mammiferous heavy chain can be divided into α, δ, and ε, γ, and μ, mammiferous light chain can be divided into λ or κ.Antibody is " Y " type, and the cervical region of " Y " type structure is made up of the second and the 3rd constant region of two heavy chains, and it passes through disulfide-bonded.Every arm of " Y " type structure comprises the wherein variable region and first constant region of a heavy chain, and it combines with the variable region and the constant region of a light chain.The variable region of light chain and heavy chain determines antigenic combination.Three hypervariable regions are all contained in the variable region of every chain, claim that (CDR of light chain (L) comprises LCDR1, LCDR2, LCDR3 to complementary determining region (CDR), and the CDR of heavy chain (H) comprises HCDR1, HCDR2, HCDR3.Kabat can be passed through in the CDR border of disclosed antibody and Fab among the present invention, Chothia or name of Al-Lazikani nomenclature or identification.(Al-Lazikani?1997；Chothia?1985；Chothia?1987；Chothia?1989；Kabat?1987；Kabat?1991)。Wherein, three CDR are spaced apart by the side continuous part that is become framework region (FR), and framework region is than CDR high conservative and form a stent support hypermutation ring more.The constant region of heavy chain and light chain combines irrelevant with antigen, but has multiple effector function.Antibody can be divided into several types according to the aminoacid sequence of CH.According to whether containing α, δ, ε, γ and μ heavy chain, antibody can be divided into five main classification or isomer: IgA, IgD, IgE, IgG and IgM respectively.Several main antibody classifications also can be divided into subclass, like IgG1 (γ 1 heavy chain), IgG2 (γ 2 heavy chains), IgG3 (γ 3 heavy chains), IgG4 (γ 4 heavy chains), IgA1 (α 1 heavy chain) or IgA2 (α 2 heavy chains) etc.

The antibody of " two valency " or its Fab contain two antigen binding sites.These two antigen binding sites can combine same antigen, or combine not synantigen respectively, and this antibody or its Fab are all thought " two valency " under the both of these case.

" Fab " speech among the present invention refers to a kind of antibody fragment, for example bifunctional antibody (diabody), Fab, Fab ', F (ab ') ₂, Fv fragment, stable Fv fragment (dsFv), (dsFv) of disulfide bond ₂, bispecific dsFv (dsFv-dsFv '); Bifunctional antibody (ds diabody), single-chain antibody molecule (scFv), scFv dimer (bifunctional antibodies of two valencys) that disulfide bond is stable; Two valency single-chain antibodies (BsFv), multi-specificity antibody, camelization single domain antibody (camelized single domain antibody), nano antibody, domain antibodies, two valency domain antibodies or any other conjugated antigen that forms by the part of the antibody that contains one or more CDR but the antibody fragment that do not have the complete antibody structure.Fab can combine identical antigen with maternal antibody or maternal antibody fragment (like parent scFv).In some embodiments, Fab can contain the one or more CDR from certain persona certa's antibody, moves the framework region that is connected to from one or more different people antibody.

" Fab " fragment of antibody is meant that part of antibody molecule that got up through disulfide-bonded by the variable region of a light chain (comprising variable region and constant region) and a heavy chain and constant region.

" Fab ' " fragment is meant the Fab fragment that has comprised the part hinge region.

" F (ab ') ₂" refer to the dimer of Fab.

" Fc " of antibody refers to that part of antibody of being made up of through disulfide-bonded second, third constant region of heavy chain.The Fc section of antibody is responsible for multiple different effector function such as ADCC and CDC, but does not participate in antigenic combination.

" Fv " section of antibody refers to the minimum antibody fragment that contains complete antigen binding site.The Fv fragment is made up of the variable region of a light chain and the variable region of a heavy chain.

" single-chain Fv antibody " or " scFv " is meant the engineered antibody (Houston 1988) that is directly linked to each other with variable region of heavy chain or be formed by connecting through a peptide chain variable region of light chain.

" single-chain antibody Fv-Fc " or " scFv-Fc " are meant the engineered antibody of being made up of the scFv that is connected to certain antibody Fc section.

" camelization single domain antibody (Camelized single domain antibody) ", " heavy chain antibody " or " HCAb (Heavy-chain-only antibodies, HCAb) " are meant and contain two V _HTerritory and do not contain the antibody of light chain (Riechmann 1999; Muyldermans 2001; WO94/04678; WO94/25591; U.S.Patent No.6,005,079).Derive obtains heavy chain antibody from camelidae (camel,, one-humped camel and yamma) at first.(Hamers-Casterman 1993 though disappearance light chain, camelization antibody (camelized antibodies) have the antigen of conclusive evidence to combine repertoire; Nguyen 2002; Nguyen 2003).The variable region of heavy chain antibody (VHH territory) is the antigen bonding unit (Koch-Nolte 2007) that minimum known acquired immunity produces.

" nano antibody " is meant a kind of antibody fragment, and it is formed from the VHH territory of heavy chain antibody and two constant region CH2 and CH3 by one.

" bifunctional antibody (diabody) " comprises the little antibody fragment that has two antigen binding sites, and wherein this fragment contains the V that on same polypeptide chain, links to each other _HTerritory and V _LTerritory (V _H-V _LOr V _H-V _L) (see also, Holliger 1993; EP404097; WO93/11161).Linker is very short between two territories, and two territories on same the chain can not be matched mutually, thereby forces the complementary territory pairing of two territories and another chain, forms two antibody combining sites.But these two antibody combining site targeting combine identical or different antigen (or epitope).

" domain antibodies " is meant the antibody fragment that only contains a variable region of heavy chain or a variable region of light chain.In some cases, two or more V _HThe territory is by a polypeptide linker covalent bond and form two valency domain antibodies.Two V of two valency domain antibodies _HBut the territory targeting is in identical or different antigen.

In some embodiments, " (dsFv) ₂" contain three peptide chains: two V _HLink to each other through a polypeptide linker between group, and through disulfide bond and two V _LGroup combines.

In some embodiments, " bispecific ds bifunctional antibody " contains V _L1-V _H2(linking to each other) and V by a polypeptide linker _H1-V _L2(also being to be linked to each other by a polypeptide linker), both are at V _H1And V _L1Between pass through disulfide-bonded.

In some embodiments, " bispecific dsFv " or " dsFv-dsFv " contain three polypeptide chain: V _H1-V _H2Group, wherein both heavy chains link to each other through polypeptide linker (as: long elasticity linker), and through disulfide bond respectively with V _L1And V _L2Group combines, and every pair has the different antigens specificity through the paired heavy chain light chain of disulfide bond.

In some embodiments, " scFv dimer " is two valency bifunctional antibodies or two valency single-chain antibody (BsFv), contains two V of dimerization _H-V _L(connecting) group by the polypeptide linker, the V of one of them group _HV with another group _LCooperation forms two binding sites, but these two binding site targeting combine same antigen (or epitope) or synantigen (or epitope) not.In other embodiments, " scFv dimer " is the bispecific bifunctional antibody, contains interconnective V _L1-V _H2(connecting) and V by the polypeptide linker _H1-V _L2(connecting), wherein V by the polypeptide linker _H1And V _L1Cooperation, V _H2And V _L2Cooperation, and the pairing of each cooperation has the different antigens specificity.

" epi-position " among the present invention is meant in the antigen molecule that part of aminoacid or the atomic radical with antibodies.If two kinds of antibody showed antigenic competitive the combination, then the identical epi-position on the possibility conjugated antigen.For example, if disclosed certain antibody or its Fab and ScFv1 among the present invention, ScFv2; ScFv3, ScFv4, ScFv5; ScFv6 or ScFv7 competition combine ER α 36, and then this antibody is possible, but not necessarily; Be considered to combine and ScFv1; ScFv2, ScFv3, ScFv4; ScFv5, the epi-position that ScFv6 or ScFv7 are identical.

" ER " among the present invention is meant multiple known estrogen receptor, a kind of among ER-α 66 or ER-α 46 or the ER-α 36.The people ER-α of total length is called hER-α 66, and it is the albumen of a 66kDa by conclusive evidence, contains 595 aminoacid and (sees Fig. 1 a).HER-α 66 by three independences but the functional domain that is mutually related form: N end A/B territory, C or DNA combine territory and D/E/F or ligand binding domain (see U.S. Patent application 10/591,199, incorporate into as list of references).The N end structure territory coding part dependent/non-dependent mobilizing function (AF-1) of ER-α 66, the interaction with the assisted activation factor is participated in this zone, and to the genes of interest transcriptional activation.DNA combines territory or C territory to contain two zinc fingerses, its receptor dimerizationization and with play a significant role during specific DNA sequence combines.C end D/E/F territory is a ligand binding domain, regulates part and combines receptor dimerizationization, nuclear translocation and ligand dependent mobilizing function (AF-2).AF-1 and AF-2 can different (Berry et.al., EMBO J., 9:2811 (1990) and Tzukerman et.al., Mol.Endocrin., 8:21 (1994)) in different cells and different DNA promoteres to the Relative Contribution of transcribing control.People ER-α 46 (h ER-α 46 sees Fig. 1 b) is the splicing isomer of hER-α 66, has the molecular weight of about 46kDa, contains 412 aminoacid, lacks the N end AF-1 territory of hER-α 66.People ER-α 36 (hER-α 36; Its sequence is shown in SEQ ID NO:1) be the isomer of the hER-α 66 of a 36kDa; The N end AF-1 territory of its disappearance hER-α 66 and C end AF-2 territory (Wang et al.; Biochem.Biophys.Res.Commun.336; 1023-1027 (2005); U.S. Patent application 10/591,199, WO2005/087811).But compare with hER-α 66 or hER-α 46, hER-α 36 has 27 unique amino acid residues to add at its C end.These 27 amino acid residues are the 284th to 310 amino acid residue among the SEQ ID NO:1, or the 1st to the 27th amino acid residue among the SEQ ID NO:2.

" ER active " among the present invention comprise by ER (as; HER-α 36) movable in Jie Dao the cell; As receptor phosphorylation (as; Tyrosine phosphorylation), endocellular signal molecule combines with receptor or other endocellular signal molecules, signal cascade initial; And/or certain biological respinse initial (as; Gene expression of cells with ER (like, hER-α 36) is induced and physiology or developmental variation (like, propagation)).

" cancer " among the present invention or " cancer state " are meant any by the growth of tumor or malignant cell, propagation or shift institute and mediate, and initiation solid tumor and non-solid tumor such as leukemic medical condition." tumor " among the present invention is meant the entity material of tumor and/or malignant cell.

" treatment " or " therapy " to certain state comprises prevention or alleviates certain state; Reducing certain state rises or the speed of development; Reduce and develop the risk that certain state; Prevention or the delay symptom development relevant with certain state; Minimizing or the termination symptom relevant with certain state; Produce the reverse wholly or in part of certain state, cure certain state, or above combination.For cancer, " treatment " or " therapy " can refer to suppress or slow down tumor or malignant cell growth, breeding, or shift, or some above combination.For tumor, " treatment " or " therapy " comprises and clearing all or the tumor of part, suppress or slow down tumor growth and transfer, prevents or delay the development of tumor, or some above combination.

" specificity knot platform " among the present invention is meant, refers to two intermolecular nonrandom association reactions, like the reaction between antibody and antigen.In some embodiments, specificity combines certain antigenic antibody or its Fab and the bonded affinity (K of antigen _D)≤10 ^-6M (as:≤5x10 ^-7M ,≤2x10 ^-7M ,≤10 ^-7M ,≤5x10 ^-8M ,≤2x10 ^-8M ,≤10 ^-8M ,≤5x10 ^-9M ,≤2x10 ^-9M ,≤10 ^-9M ,≤10 ^-10M).K among the present invention _DBe meant the speed of dissociating and the ratio (k that combines speed _Off/ k _On), can measure (as: with Biacore or Kinexa method) by means commonly known in the art.

The material of " separated " is changed by naturalness through artificial.If the material or the composition of certain " separated " appear in occurring in nature, it has been changed or has broken away from its initial condition so, or the two all has generation.For example; Naturally occurring polynucleotide or polypeptide are not separated in a certain living animal body; If but the material that these polynucleotide or polypeptide coexist with it enough separates and exist with enough pure state, then can think " separated " under native state.

" carrier " is meant among the present invention, a kind of vehicle that certain proteic polynucleotide of coding functionally can be inserted wherein and this albumen acquisition is expressed.Carrier can be used for conversion, transduction or transfection host cell, makes its hereditary material element that carries in host cell, be able to express.For instance; Carrier comprises: plasmid, phasmid, coemid, artificial chromosome such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or the deutero-artificial chromosome of P1 (PAC), phage such as bacteriophage lambda or M13 phage, and animal virus etc.Animal virus kind as carrier has retrovirus (comprising slow virus), adenovirus, adeno-associated virus, herpesvirus (like herpes simplex virus), poxvirus, baculovirus, human papillomavirus, papova viruses (like SV40).Carrier can contain the element that various control is expressed, and comprises promoter sequence, transcriptional initiation sequence, enhancer sequence, selection element and reporter gene.In addition, carrier also can contain replication origin.Carrier also can comprise assists it to get into the composition of cell, includes but not limited to virion, liposome or protein coat.

" host cell " is meant the cell that imports exogenous polynucleotide and/or carrier among the present invention.Host cell can be selected from the various kinds of cell kind; Like prokaryotic cells such as escherichia coli or hay bacterium, fungal cells such as yeast cells or aspergillosis, insect cells such as S2 drosophila cell or Sf9; Perhaps zooblast such as fibroblast; Chinese hamster ovary celI, COS cell, NSO cell; The HeLa cell; Bhk cell, HEK 293 cells, or people's cell.

" with ER or ER α 36 relevant or related diseases " among the present invention be meant, any raise owing to ER (as: ER α 36) is active or reduce cause, aggravate or state that other are correlated with.These states comprise that by cell-mediated cancer the growth of these cells, breeding or transfer depend on ER (like ER α 36); Skeletal diseases, for example bone loss, bone splits or osteoporosis; And inflammatory conditions, like rheumatoid arthritis, psoriasis, scleroderma, chronic obstructive pneumonia or asthma.

The ability of " blocking-up combines " among the present invention or " the competitive combination " is meant that antibody or its Fab are suppressed to two intermolecular bonded interactions the ability of any detectable degree.In some embodiments, two intermolecular bonded antibody of blocking-up or Fab can suppress at least 50% with two intermolecular bonded interactions.In some embodiments, such inhibitory action can be greater than 60%, in some embodiments greater than 70%, in some embodiments greater than 80%, in some embodiments greater than 90%.In some embodiments, repressed binding interactions can be ScFv 1, and ScFv 2, and ScFv 3, and ScFv 4, and ScFv 5, and ScFv 6, or the combining of ScFv 7 and hER-α 36.

" treatment effective dose " or " effective dose " among the present invention are meant that certain medicine is effectively treated dosage or the concentration with hER α 36 relevant diseases or state.For example; Purposes for disclosed antibody or its Fab among the present invention; The treatment effective dose is under this dosage or concentration; This antibody or antigen conjugate can clear all or the part tumor, suppress or slow down tumor growth, growth or the breeding, the inhibition tumor cell that suppress the cell of mediation cancer state shift, alleviate any symptom or the labelling relevant with tumor or cancer state; Prevent or delay the development of tumor or cancer state, or some above combination.

" acceptable for pharmaceutical " is meant supporting agent, solvent, diluent, adjuvant and/or the salt of indication, generally speaking chemically and/or physically with preparation in other batchings compatible mutually, and compatible mutually with the receiver on physiology.

The invention provides antibody and the Fab thereof of anti-hER α 36, it is characterized in that to combine the 284th～the 310th amino acids residue among the SEQ ID NO:1 specifically, and/or have the anti-tumor in vivo activity.

The invention discloses total length people single-chain antibody ScFv 1; ScFv 2; ScFv 3; ScFv 4; ScFv 5, and ScFv 6, or ScFv 7; All these all specific combination hER α 36 (like the 284th of hER α 36～the 310th amino acids residue) are all through obtaining with the screening of target polypeptide in phage exhibition scFv library.The sequence of this target polypeptide is listed in SEQ ID NO:2, corresponding to the 284th～the 310th amino acids residue among the SEQ ID NO:1.

SEQ ID NO:1, the aminoacid sequence of SEQ ID NO:2 and 7 kinds of single-chain antibodies is following listing (be connected polypeptide and underline, all CDR add frame).

The aminoacid sequence of SEQ ID NO:1:

Met?Ala?Met?Glu?Ser?Ala?Lys?Glu?Thr?Arg?Tyr?Cys?Ala?Val?Cys?Asn?Asp?Tyr?Ala?Ser?Gly?Tyr?His?Tyr?Gly?Val?Trp?Ser?Cys?Glu?Gly?Cys?Lys?Ala?Phe?Phe?Lys?Arg?Ser?Ile?Gln?Gly?His?Asn?Asp?Tyr?Met?Cys?Pro?Ala?Thr?Asn?Gln?Cys?Thr?Ile?Asp?Lys?Asn?Arg?Arg?Lys?Ser?Cys?Gln?Ala?Cys?Arg?Leu?Arg?Lys?Cys?Tyr?Glu?Val?Gly?Met?Met?Lys?Gly?Gly?Ile?Arg?Lys?Asp?Arg?Arg?Gly?Gly?Arg?Met?Leu?Lys?His?Lys?Arg?Gln?Arg?Asp?Asp?Gly?Glu?Gly?Arg?Gly?Glu?Val?Gly?Ser?Ala?Gly?Asp?Met?Arg?Ala?Ala?Asn?Leu?Trp?Pro?Ser?Pro?Leu?Met?Ile?Lys?Arg?Ser?Lys?Lys?Asn?Ser?Leu?Ala?Leu?Ser?Leu?Thr?Ala?Asp?Gln?Met?Val?Ser?Ala?Leu?Leu?Asp?Ala?Glu?Pro?Pro?Ile?Leu?Tyr?Ser?Glu?Tyr?Asp?Pro?Thr?Arg?Pro?Phe?Ser?Glu?Ala?Ser?Met?Met?Gly?Leu?Leu?Thr?Asn?Leu?Ala?Asp?Arg?Glu?Leu?Val?His?Met?Ile?Asn?Trp?Ala?Lys?Arg?Val?Pro?Gly?Phe?Val?Asp?Leu?Thr?Leu?His?Asp?Gln?Val?His?Leu?Leu?Glu?Cys?Ala?Trp?Leu?Glu?Ile?Leu?Met?Ile?Gly?Leu?Val?Trp?Arg?Ser?Met?Glu?His?Pro?Gly?Lys?Leu?Leu?Phe?Ala?Pro?Asn?Leu?Leu?Leu?Asp?Arg?Asn?Gln?Gly?Lys?Cys?Val?Glu?Gly?Met?Val?Glu?Ile?Phe?Asp?Met?Leu?Leu?Ala?Thr?Ser?Ser?Arg?Phe?Arg?Met?Met?Asn?Leu?Gln?Gly?Glu?Glu?Phe?Val?Cys?Leu?Lys?Ser?Ile?Leu?Leu?Leu?Asn?Ser?Gly?Ile?Ser?His?Val?Glu?Ala?Lys?Lys?Arg?Ile?Leu?Asn?Leu?His?Pro?Lys?Ile?Phe?Gly?Asn?Lys?Trp?Phe?Pro?Arg?Val

The aminoacid sequence of SEQ ID NO:2:

Gly?Ile?Ser?His?Val?Glu?Ala?Lys?Lys?Arg?Ile?Leu?Asn?Leu?His?Pro?Lys?Ile?Phe?Gly?Asn?Lys?Trp?Phe?Pro?Arg?Val

The aminoacid sequence of ScFv1 (SEQ ID NO:3):

The aminoacid sequence of ScFv 2 (SEQ ID NO:5):

The aminoacid sequence of ScFv 3 (SEQ ID NO:7):

The aminoacid sequence of ScFv 4 (SEQ ID NO:9):

The aminoacid sequence of ScFv 5 (SEQ ID NO:11):

The aminoacid sequence of ScFv 6 (SEQ ID NO:13):

The aminoacid sequence of ScFv 7 (SEQ ID NO:15):

The nucleotide sequence of seven kinds of single-chain antibodies of coding is listed as follows:

The nucleotide sequence of ScFv 1 (SEQ ID NO:4):

5‘-TCCTATGAGCTGACTCAGCCACCCTCGGTGTCAGTGGCCCCAGGAAAGACGGCCAGGATTACCT

GTGGGGGAAACAACATTGGAAGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCC

TGTGCTGGTCGTCTATGATGATAGCGACCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAA

CTCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACT

GTCAGGTGTGGGATAGTAGTAGTGATCATGTGGTATTCGGCGGAGGGACCAAGCTCACCGTCCTAG

GTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATCCTCGAGCGGTACCCA

GGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTTTCCTGTG

CAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCC

TGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCC

GATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCT

GAGGACACGGCCTTGTATTACTGTGCAAAAGTATCCGCGTATAGCAGCTCGTTTGACTACTGGGGC

CAGGGAACCCTGGTCACCGTCTCCTCAGCTAGC-3’

The nucleotide sequence of ScFv 2 (SEQ ID NO:6):

5’-CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCT

GCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCA

AAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGG

CTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTA

TTACTGCAGCTCATATACAAGCAGCAGCACTTTGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCT

AGGTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATCCTCGAGCGGTACC

CAGGTGCAGCTGTTGGAGTCTGGGGCTGAGGTGAAGAAGCCCGGGGCCTCAGTGAAGGTTTCCT

GCAAGGCATCTGGATACACCTTCACCGCCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAG

GGCTTGAGTGGATGGCAATGATCGACCCCAGTGGTAGTATCACAAGCTACGCACAGAAGTTCCAG

GGCAGAGTCACCATGAGCAGGGACACGTCCACGAGCACACTCTACATGGAGCTGAGCAGCCTGA

GATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATCTGAAAGAGGGGTTTAGTGTCCCTGGG

GCTTTTGATATCTGGGGCCAAGGGACAATGGTCACTGTCTCTTCAGCTAGC-3’

The nucleotide sequence of ScFv 3 (SEQ ID NO:8):

5’-CAGTCTGTGTTGACGCACCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCT

GCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCA

AAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGG

CTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTA

TTACTGCAGCTCATATACAAGCAGCAGCACTCTGGTATTCGGCGGAGGGACCAAGCTCACCGTCCT

AGGTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATCCTCGAGCGGTACC

GAGGTCCAGCTGGTACAGTCTGGGGGAGGCGTGGCCCAGCCTGGGAGGTCCCTGAGACTCTCCTG

TGCAGCCTCTGGAATCACCTTCAATAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGG

GCTGGAGTGGGTGGCAGTTATGCCATATGATGGAAGTAATGAATACTATGCAGACTCCGTGAAGGG

CCGATTCACCATCTCCAGAGACAATTCCAAGAACACACTGTATCTGCAAATGAACAGCCTGAGAGC

TGAGGACACGGCTGTGTATTACTGTGCGAAAGGTTCCGGGATGGTTCAGCTATGGGCGGATGCTTT

TGATGTCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGCTAGC-3’

The nucleotide sequence of ScFv 4 (SEQ ID NO:10):

5’-CAGTCTGTGTTGACGCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTC

TTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGA

ACGGCCCCCAAACTCCTCATCTATAGTAATAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTC

TGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCT

GATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCCGGTGTTCGGCGGAGGGACCAAGC

TGACCGTCCTAGGTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATCCT

CGAGCGGTACCCAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGG

TGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTACCAGCTGGGTGCGACA

GGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTACCTTTGGTACAGCAAACTAC

GCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATG

GAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGAGGGTCTGGGCT

ACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGCTAGC-3’

The nucleotide sequence of ScFv 5 (SEQ ID NO:12):

5’-CAGTCTGCCCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGTAGAGGGTCACCGTCTC

TTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGA

ACGGCCCCCAAACTCCTCATCTATAGTAATAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTC

TGCCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCT

GATTATTACTGTGCAGCATGGGATGATAGCCTGAATGGTCATGTGGTATTCGGCGGAGGGACCAA

GCTCACCGTCCTAGGTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATC

CTCGAGCGGTACCCAGGTGCAGCTGGTACAGTCTGGGGCAGAGGTGAAAAAGCCCGGGGAGTC

TCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCC

AGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATAC

AGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGC

AGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGCGGAATCTATGATGC

TTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGCTAGC-3’

The nucleotide sequence of ScFv 6 (SEQ ID NO:14):

5’-GAAATTGTGATGACGCAGTCTCCCGGCACCCTGTCTTTGTCTCCAGGGGAGAGAGCCACCCT

CTCCTGCAGGGCCAGTCAGAGTGTTGACAGCAACTTCTTAGCCTGGTATCAGCAAAGACCTGGC

CAGGCTCCCCGGCTCCTCATCTATGGTGTATCCAGCAGCGCCACTGGCATCCCAGACAGGTTCAG

TGGCAGTGGGTCTGGGACAGACTTCACTCTCTCCATCGACAGACTGGAGCCTGAAGATTTTGCT

GTGTATTACTGTCAGCAATATGGTAGCTCACCCACTTTCGGCGGAGGGACCAAGCTGGAAATCAA

ACGTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATCCTCGAGCGGTAC

CCAGGTGCAGCTGCAGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTC

CTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGA

AGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTG

AAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCC

TGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGATCCGGTGACTACGGGGCTTTTGATATC

TGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGCTAGC-3’

The nucleotide sequence of ScFv 7 (SEQ ID NO:16):

5’-CAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTC

CTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAA

CAGCCCCCAAACTCCTCATTTATGACAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCT

GGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCC

GATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGGGTGTTCGGCGGAGGGACCAAGC

TGACCGTCCTAGGTTCCGGAGGGTCGACCATAACTTCGTATAATGTATACTATACGAAGTTATCCT

CGAGCGGTACCGAGGTGCAGCTGGTACAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCC

TGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAA

GCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGC

GGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAA

ATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGAGGGAGATAGCAGTG

GCTGGTCCCCTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCTTCAGCTAGC-3’

Table 1 has been listed the heavy chain of seven kinds of single-chain antibodies and the sequence of variable region of light chain.The CDR region sequence of heavy chain and light chain kind is listed at table 2 and table 3.Say that at length the variable region of light chain of ScFv1 is listed in SEQ ID NO:59, the variable region of heavy chain of ScFv1 is listed in SEQ ID NO:60.The ScFv1 variable region of light chain is shown in SEQ ID NO:59; Light chain CDR1 (the ScFv1 LCDR1 that contains the 23rd～33 residue that is positioned at SEQ ID NO:59; SEQ ID NO:17); Be positioned at the 49th～55 light chain CDR2 (the ScFv1 LCDR2 of SEQ ID NO:59; SEQ ID NO:18); And the 88th～98 the light chain CDR3 (ScFv1 LCDR3, SEQ ID NO:19) that is positioned at SEQ ID NO:59.The ScFv1 variable region of heavy chain is shown in SEQ ID NO:60; Heavy chain CDR1 (the ScFv1 HCDR1 that contains the 31st～35 residue that is positioned at SEQ ID NO:60; SEQ ID NO:20); Be positioned at the 50th～66 light chain CDR2 (the ScFv1 HCDR2 of SEQ ID NO:60; SEQ ID NO:21); And the 99th～108 the light chain CDR3 (ScFv1 HCDR3, SEQ ID NO:22) that is positioned at SEQ ID NO:60.

Table 1

Table 2

Table 3

The CDR district of disclosed seven kinds of ScFv among the present invention; Light chain district and heavy chain district can move by means commonly known in the art and be connected to other frame areas or constant region, thereby form camelization single domain antibody (camelized single domain antibody), bifunctional antibody (diabody), scFv dimer, BsFv, dsFv, (dsFv) ₂, dsFv-dsFv ', Fv fragment, Fab, Fab ', a F (ab ') ₂, ds bifunctional antibody (ds diabody), nano antibody, domain antibodies, two valency domain antibodies or complete antibody.Disclosed antibody can be monoclonal antibody, recombinant antibodies, bi-specific antibody, humanized antibody, chimeric antibody, traget antibody, bivalent antibody, anti-idiotype antibody or fully human antibodies among the present invention.

Through CDR district or FR district random mutation, and carry out combination and functional experiment subsequently, can produce enhanced propertied (as: more high-affinity) antibody or its Fab seven kinds of disclosed ScFv.Therefore, in some embodiments, antibody that provides among the present invention and Fab contain one or more CDR sequences of seven kinds of disclosed ScFv, and wherein said one or more CDR sequences contain the replacement of one or more aminoacid, increase or delete.Thereby the antibody that obtains in this way or its Fab can have the antibody of better combination character with the character identification that combines of ER α 36 through screening.There is the antibody of better combination character to confirm activity, like the activity of growing in anticancer growth in vitro or proliferation activity or the inhibition tumor body through one or more functional experiments.

The method for using of antibody and antigen conjugate

Antibody that provides among the present invention and antigen conjugate can suppress tumor growth in vivo.Therefore, said antibody and Fab can be used for treating multiple and ER α 36 relevant state or disease.

In some embodiments, the invention provides the method that prevents and/or treats the disease relevant, comprise object is used the antibody that provides to some extent containing of treatment effective dose or the pharmaceutical composition of antigen conjugate with ER α 36.Comprise with ER α 36 relevant disease instances; But be not limited to bone loss; Fracture; Osteoporosis; Metastatic bone lesions; Handkerchief Zhe Shi is sick; Periodontal disease; Cartilage degeneration; Endometriosis; Hysteromyoma; Hot flush; The LDL cholesterol levels raises; Cardiovascular disease; The cognitive function damage; The brain degenerative disease; Postoperative restenosis; Gynecomasty; The pipeline smooth muscle cell proliferation; Fat; Incontinence; Anxiety; The depression that estrogen receptor causes; Menopausal depression; Postpartum depression; Premenstrual syndrome; Manic depression; Anxiety; Dull-witted; Obsession; Attention deficit disorder; Sleep disorder; Excitation; Impulsion; Immune deficiency; Autoimmune disease; The indignation management; Multiple sclerosis and parkinson (family name) disease; Inflammation; Inflammatory conditions; Inflammatory bowel; Respiratory system disease; Sexual dysfunction; Hypertension; Retinal degeneration; Asthma and cancer state.Preferably; Comprise depression, menopausal depression, postpartum depression, immune deficiency, autoimmune disease, inflammation, inflammatory conditions, asthma and cancer state that bone loss, fracture, osteoporosis, menopause, premenstrual syndrome, endometriosis, hysteropathy, sexual impotence, sexual dysfunction, the rising of LDL cholesterol levels, cardiovascular disease, pipeline smooth muscle proliferation, estrogen receptor cause with ER α 36 relevant disease instances.More preferably, comprise bone loss, endometriosis, sexual impotence, cardiovascular disease, atherosclerosis, immune deficiency, inflammation, inflammatory conditions, asthma and cancer state with ER α 36 relevant disease instances.Inflammatory conditions among the present invention comprises rheumatoid arthritis, Corii Bovis seu Bubali moss, scleroderma, chronic obstructive pulmonary disease, and asthma.Said object can be mammal such as Canis familiaris L., cat, cattle, sheep, horse or people, preferably is the people.The required therapeutic dose of said method can change according to disease specific to some extent, and those of ordinary skills can confirm according to the disclosure of invention.

In some embodiments, the invention provides the method that in certain object, prevents and/or treats the cancer state, comprise said object used containing the antibody that provides to some extent or the pharmaceutical composition of antigen conjugate.Cancer state and the tumor kind that can use antibody provided by the invention or its Fab to treat include but not limited to; The malignant tumor of malignant tumor, blastoma, sarcoma, germinoma or blood or lymph, for example: leukemia, lymphoma or boniness myeloma.More specifically; Can use the cancer state and the tumor kind of the treatment of antibody provided by the invention or its Fab to include but not limited to; Squamous cell carcinoma; Pulmonary carcinoma (as; Small cell lung cancer; Nonsmall-cell lung cancer (NSCLC); Pulmonary's adenocarcinoma; Or pulmonary's squamous cell carcinoma); Peritoneal cancer; Hepatocarcinoma (like hepatoma); Gastric cancer (like human primary gastrointestinal cancers); Cancer of pancreas; The brain cancer (as; Glioblast cerebroma/glioblastoma multiforme (GBM); Non-glioblast cerebroma; Or meningioma); Glioma (as; Ependymoma; Astrocytoma; Between the modification astrocytoma; Oligodendroglioma; Or mixed type glioma such as spider cell mixed tumor); Cervical cancer; Uterus carcinoma; Hepatocarcinoma (as; Hepatoblastoma; Hepatoma or hepatocarcinoma); Bladder cancer (as; The urothelium cancer); Breast carcinoma; Colon cancer; Intestinal cancer; Rectal cancer; Endometrium or cervical cancer; Salivary gland carcinoma; Renal carcinoma (as: kidney striped muscle appearance tumor); Carcinoma of prostate; Carcinoma vulvae; Carcinoma of penis; Anus cancer (as; Squamous cell Carcinoma of Anal Canal); Thyroid carcinoma; The incidence cancer (as; Nasopharyngeal carcinoma); Skin carcinoma (as; Melanotic cancer or squamous cell carcinoma); Carcinoid; Cancer eye (as: retinoblastoma); Mesothelioma; Lymphocytic leukemia (as; The acute lymphoblastic leukemia of T cell and B cell precursor pedigree (ALL); Chronic lymphocytic leukemia (CLL); Acute myeloid leukemia (AML); Comprise mast cell leukemia; Chronic granulocytic leukemia (CML); Hairy cell leukemia (HCL); Hodgkin lymphoma; Non-Hodgkin lymphoma; Chronic myelomonocytic leukemia (CMML); Follicular lymphoma (FL); Diffuse large B cell lymphoma (DLCL); Lymphoma mantle cell (MCL); Lymphoma (BL); Cutaneous T cell lymphoma; The Sezary syndrome; Cutaneous T cell lymphoma; Mastocytoma; Medulloblastoma; Nephroblastoma; Solitary plasmacytoma; Myelodysplastic syndrome; Chronic and non-chronic myeloproliferative disorder; Central nervous system's tumor; The hypophysis cerebri tumor; Vestibular nerve sheath tumor; Neuroectodermal tumors; Ependymoma; Papilloma of choroid plexus; Polycythemia vera; Thrombocytosis; Primary myelofibrosis; And child's cancer; As, children's's sarcoma (as: neuroblastoma; Rhabdomyosarcoma and osteosarcoma).In addition, tumor can be virulent (as: cancer) or benign (as: hypertrophy, cyst, pseudocyst, hamartoma and benign tumor).

In some embodiments, disclosed antibody and Fab are ER α 36 adjusting control agents among the present invention, are used in ER α 36 activity external and regulating cell in vivo.In some embodiments, antibody disclosed by the invention and Fab can arrive and cause cell death and/or cell proliferation.

At some embodiment, the method for regulation and control ER α 36 functions comprises that the cell of will express ER α 36 contacts with antibody disclosed by the invention and its antigen conjugate fragment in the cell.Said cell can endogenous expression ER α 36, or through genetic engineering heterogenous expression ER α 36.In one embodiment, the endogenous expression of said cell ER α 36.One preferred embodiment in, said cell is the cancerous cell of endogenous expression ER α 36.The cancerous cell instance of expressing ER α 36 has breast cancer cell, leukaemia, lung carcinoma cell, myeloma cell, prostate gland cancer cell, ovarian cancer cell, rectum cancer cell and stomach cancer cell.In a preferred embodiment, said cell is the breast cancer cell of endogenous expression ER α 36.The breast cancer cell instance of expressing ER α 36 has MCF7 and MDA-MB-231 cell.Through handling, the expression of endogenous ER α 36 is raise or reduction with one or more materials.The instance of described material has serum, E2 (17-estradiol), tamoxifen and ICI182,780.

In another embodiment, said cell is through the ER α 36 of gene engineering expression external source.The cell of expressing external source ER α 36 can make (seeing Sambrook etc., Molecular Cloning, A Laboratory Manual (2d Ed.1989) (Cold Spring Harbor Laboratory)) through gene engineering method well known in the art.Briefly, the ER α of external source 36 preparations also are inserted in the expression vector, change host cell over to, in being suitable for expressing the culture fluid of external source ER α 36, grow.The gene order instance of people ER α 36 has been disclosed in Wang et al., Biochem.Biophys.Res.Commun.336,1023-1027 (2005) (the GenBank number of landing BX640939).Express the cell of external source ER α 36 and can express or not express endogenous ER α 36.Through handling, the expression of the endogenous and external source ER α 36 in the said cell is raise or reduction with one or more other materials.The instance of described material has serum, E2 (17-estradiol), tamoxifen and ICI182,780.Express the cell of ER α 36 and can express or not express other estrogen receptor such as ER-α 66, ER-α 46 and ER-β.

Antibody disclosed by the invention and Fab can be individually dosed or with one or more other treatment means or material administering drug combinations.For example, the therapy of antibody disclosed by the invention and the Fab complication that can cause with chemotherapy, radiotherapy, treatment of cancer operation (like tumorectomy), one or more resisting emesis medicines or other chemotherapy or any other are used for the treatment for cancer material or any treatment of conditions material by ER α 36 mediations carries out coupling.In some such embodiment; When antibody disclosed by the invention and Fab and one or more therapeutant couplings; Can with the administrations simultaneously of described one or more therapeutants; In some such embodiment, described antibody and Fab can be used as the administration simultaneously of same part of pharmaceutical compositions.But, with the antibody of other treatment material " coupling " and antigen conjugate do not need administration simultaneously or with the administration in same compositions of this therapeutant.The implication of " coupling " is included in also that the antibody and the antigen conjugate of administration also is considered to and this therapeutant " coupling " before or after another therapeutant among the present invention, even said antibody or its Fab and second kind of material are through the different modes of administration administration.Under possible situation; With the other treatment material of antibody disclosed by the invention or its Fab coupling can be with reference to the method medication of the product description of this other treatment material; Or with reference to surgical desk reference book 2003 (Physicians ' Desk Reference, 57th Ed; Medical Economics Company; ISBN:1563634457; The 57th edition (in November, 2002)), or with reference to other methods well known in the art.The instance of therapeutant includes, but not limited to Herba Epimedii, tamoxifen, 17 β-estrogen, and ICI 182,780, and disclosed chemical compound in the U.S. Patent application 11/877,575 of application on October 23rd, 2007 is incorporated the present invention into the form of list of references; The U.S. Patent application 60/046,255 of application on April 8th, 2008 is incorporated the present invention into the form of list of references; Cytokine, VEGF antibody are (for example; Bevacizumab or A Wasiting), Anti-HER 2 (for example: Trastuzumab or Herceptin); And anti-egfr antibodies (Buddhist nun's trastuzumab (Nimotuzamab) or western appropriate former times (Erbitux)), tyrosine acceptor inhibitor (for example Gapatinib, Lapatinib).

The instance of cytokine includes but not limited to lymphocyte factor; Monokine; The human growth hormone; Bovine growth hormone; Parathyroid hormone; Thyroxine; Insulin; Proinsulin; Relaxin; Relaxin is former; Follicule-stimulating hormone (FSH); Thyrotropin; Lutropin; Liver growth factor; Fibre protogrowth factor; Prolactin antagonist; Human placental lactogen; Tumor necrosis factor; Miu Le (family name) manages inhibiting substances; Mice promoting sexual gland hormone related peptides; Inhibin; Activin; Integrin; Thrombopoietin; Nerve growth factor; Like NGF-β; PDGF; Transforming growth factor; As: TGF-α and TGF-β; Insulin-like growth factor I and II; Erythropoietin; Osteogenic factor; Interferon; As: interferon-' alpha ';-β; With-γ; Colony stimulating factor, like macrophage-CSF, granular leukocyte macrophage CSF and granulocyte-CSF, interleukin, like IL-1, IL-1 α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 and IL-12, tumor necrosis factor; As: TNF-α and TNF-β, and other polypeptide factors.

In some embodiments, the antibody announced of the present invention or its Fab can be through linking to each other with one or more chemotherapy materials or the method use of coupling.The instance of chemotherapy material comprises; But be not limited to; Amrubicin, atrasentan; Calcitriol; Cilengitide; Dasatinib; Moral card Brittany (decatanib); Yi Duotekalin (edotecarin); Grace is pricked appropriate woods (enzastaurin); Hydrochloric acid Erlotinib sheet; Everolimus; Gefitinib; Gossypol she in monoclonal antibody (gossypol ipilimumab); Luo Nafani (lonafarnib); Lucanthone; Niu Laidi (neuradiab); Nola Qu Te; Ao Limosen (oblimersen); Ou Fatumu monoclonal antibody (ofatumumab); Ou Gewo monoclonal antibody (oregovomab); Handkerchief Buddhist nun monoclonal antibody; Pa Zuo dissolves Buddhist nun (pazopanibrubitecan); Talampanel; Te Musiluoli (temsirolimus); Te Simili (tesmilifene); Tetrandrine; Carry James Slim monoclonal antibody (ticilimumab); Te La doubly specific (trabectedin); ZD6474; Wei Tesipan (vitespan); Zha Nuolimu monoclonal antibody (zanolimumab); Azoles logical sequence diphosphate; Histrelin; Azacitidine; Dexrazoxane; Alemtuzumab; Lenalidomide; Gemtuzumab; Ketoconazole; Chlormethine; Ibritumomab tiuxetan; Decitabine; Hexamethylmelamine; Bexarotene; Tositumomab; Arsenic trioxide; She is ground Tuo Naite (editronate); Ciclosporin; The Edwina-asparaginase; And strontium 89.

It is contemplated that; Antibody among the present invention or its Fab can be connected with multiple conjugate (to be seen; For example; " Conjugate Vaccines ", Contributions to Microbiology and Immunology, J.M.Cruse and R.E.Lewis; Jr. (eds.); Carger Press, New York, (1989)).These conjugates can pass through other modes such as covalent bond, affine combination, embedding, equal combination (coordinate binding), complexation, combination, mixing or adding and be connected with said antibody or antigen conjugate.In some embodiments, antibody disclosed by the invention and Fab can make it contain the specific site beyond the epi-position bound fraction through the method for engineering, and these sites can be used to combine one or more conjugates.For example, such site can comprise one or more reactive amino acid residues, and for example cysteine residues, histidine residues are used to assist covalently bound with conjugate.In some embodiments, antibody can be connected in conjugate indirectly, or links to each other through another conjugate.For example, said antibody or its Fab biotin-binding combine second conjugate then indirectly, and it links to each other with Avidin.

In some embodiments; The conjugate that links to each other with antibody disclosed by the invention or its Fab can comprise one or more materials; It is intended to change one or more metabolisming properties of said antibody or its Fab, and for example Polyethylene Glycol (PEG) can increase the half-life of said antibody or antigen fragment or reduce its immunogenicity.

In some embodiments, the conjugate that links to each other with antibody disclosed by the invention or its Fab can contain one or more detectable labellings.Said labelling comprises, but is not limited to, radiosiotope as ¹²³I, ¹²⁴I, ¹²⁵I, ¹³¹I, ³⁵S, ³H, ¹¹¹In, ¹¹²In, ¹⁴C, ⁶⁴Cu, ⁶⁷Cu, ⁸⁶Y, ⁸⁸Y, ⁹⁰Y, ¹⁷⁷Lu, ²¹¹At, ¹⁸⁶Re, ¹⁸⁸Re, ¹⁵³Sm, ²¹²Bi and ³²P, other lanthanide series, chemiluminescent labels, fluorescent marker be for example: fluorescein, rhodamine, red yellow acyl (dansyl), rhodophyll or Texas red (Texas Red), and enzyme-substrate label for example horseradish peroxidase, alkali phosphatase or beta-D-galactosidase.

In some embodiments, antibody disclosed by the invention or its Fab can be used as the part of pharmaceutical compositions administration, and this pharmaceutical composition contains one or more medicinal supporting agents of accepting.The medicinal supporting agent of accepting that is used in the pharmaceutical composition disclosed by the invention can comprise; For example; Acceptable for pharmaceutical liquid, gel or solid carriers, aqueous media, non-aqueous phase medium, antimicrobial material, etc. ooze material, buffer, antioxidant, anesthetis, suspending agent/dispersant, chelating agen, diluent, adjuvant, adjuvant or nontoxic auxiliary substance, other components well known in the art or above multiple combination.

The component that is suitable for can comprise, for example, antioxidant, filler, binding agent, disintegrating agent, buffer, antiseptic, lubricant, stirs flavor agent, thickening agent, coloring agent or emulsifying agent.

The antioxidant that is suitable for can comprise; For example, methionine, ascorbic acid, EDTA, sodium thiosulfate, platinum, catalase, citric acid, cysteine, mercapto glycerol, TGA, sulfydryl sorbitol, butyl methyl methoxybenzene, Yoshinox BHT and/or propyl gallate.Disclosed like the present invention, in a kind of compositions that contains antibody disclosed by the invention or its Fab, comprise one or more antioxidant such as methionine, can reduce the oxidation of said antibody or its Fab.Can prevent or reduce the reduction of binding affinity to the minimizing of Oxidation, thereby improve antibody stability and extend the shelf life.Therefore, in some embodiments, contain for example methionine of one or more described antibody or its Fab and one or more antioxidant in the compositions provided by the invention.The present invention further provides several different methods; Antibody or its Fab through providing among the present invention mix with one or more antioxidant; For example methionine can prevent said antibody or its Fab oxidation, prolongs its shelf-life and/or improve its activity.

Further say; The acceptable for pharmaceutical supporting agent can comprise; For example; Aqueous media such as sodium chloride injection; The ringer's solution injection; Deng oozing glucose injection; The sterilized water injection; Or glucose and lactated Ringer's injection; Non-aqueous media is for example: the fixed oil of plant origin, cottonseed oil, Semen Maydis oil; Oleum sesami; Perhaps Oleum Arachidis hypogaeae semen, the antibiotic substance under bacteriostatic or the fungus inhibition concentration, isotonic agent is like sodium chloride or glucose; Buffer is like phosphate or citric acid phthalate buffer; Antioxidant is like sodium bisulfate, local anesthetic is like procaine hydrochloride, and suspending agent and dispersant are like sodium carboxymethyl cellulose; Hydroxypropyl emthylcellulose; Or polyvinylpyrrolidone; Emulsifying agent is like polysorbate80 (tween 80); Chelating reagent such as EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol bis (2-amino-ethyl ether) tetraacethyl), ethanol; Polyethylene Glycol; Propylene glycol; Sodium hydroxide; Hydrochloric acid; Citric acid; Or lactic acid.Antibacterial as supporting agent can add in the pharmaceutical composition in the multidose container, and it comprises phenols or cresol, mercurial, and benzyl alcohol, chlorobutanol, methyl and propyl para-hydroxybenzoate, thiophene hydrargyrum spread, Neotran ammonium and chlorine Benzethonium.The adjuvant that is suitable for can comprise, for example, and water, salt, glucose, glycerol or ethanol.The nontoxic auxiliary substance that is suitable for can comprise, for example, and emulsifying agent, pH value buffer agent, stabilizing agent, solubilizing agent, the perhaps material of sodium acetate, sorbitan monolaurate, Emulphor FM or cyclodextrin and so on.

The treatment effective dose of the antibody that provides among the present invention or its Fab depends on multiple factor well known in the art; For example body weight, age, passing medical history, existing usefulness treatment, the health status of object and potentiality, allergy, the ultra quick and side effect of cross infection, and the degree of route of administration and tumor development.The one skilled in the art can require to reduce in proportion or rising dosage according to these or other conditioned disjunction.

In some embodiments, antibody provided by the invention or its Fab can be at the about 0.01mg/kg of treatment effective dose to administration (for example, about 0.01mg/kg between about 100mg/kg; About 0.5mg/kg, about 1mg/kg, about 2mg/kg; About 5mg/kg, about 10mg/kg, about 15mg/kg; About 20mg/kg, about 25mg/kg, about 30mg/kg; About 35mg/kg, about 40mg/kg, about 45mg/kg; About 50mg/kg, about 55mg/kg, about 60mg/kg; About 65mg/kg; About 70mg/kg, about 75mg/kg, about 80mg/kg; About 85mg/kg; About 90mg/kg, about 95mg/kg, or about 100mg/kg).In some embodiments, said antibody or its Fab are with about 50mg/kg or dosed administration still less, in some embodiments; Dosage is 10mg/kg or still less, 5mg/kg or still less, 1mg/kg or still less; 0.5mg/kg or still less, or 0.1mg/kg or still less.Certain given dose can be in the administration of a plurality of intervals, for example once a day, twice of every day or more, every month twice or more, once in a week, whenever biweekly, per three weeks once, every month once or per the bimester or more months once.In some embodiments, dosage can change with the treatment process.For example, in some embodiments, the comparable follow-up dosage of initial dosage is high.In some embodiments, dosage is adjusted according to the reaction of administration object in the treatment process.

Dosage regimen can reach peak optimization reaction (like therapeutic response) through adjustment.For example, can carry out single dose administration or divide the dosed administration of a plurality of separations in a period of time.

Disclosed antibody and Fab can be through administering mode administrations well known in the art among the present invention; For example drug administration by injection or non-injection administration; (as; Subcutaneous injection, lumbar injection, intravenous injection; Comprise intravenous drip; Intramuscular injection or intradermal injection) or non-injection administration (as, oral administration, nasal-cavity administration, sublingual administration, rectally or topical administration).In said antibody or the embodiment of its Fab with the injection system administration; Injectable pharmaceutical composition can any routine prepare; For example, liquid flux, suspending agent, emulsifying agent or be applicable to the solid form that produces liquid flux, suspending agent or emulsifying agent.Ejection preparation can comprise used aseptic and/or apyrogeneity solution, use before the existing and bonded aseptic exsiccant soluble substance of solvent; Like lyophilized powder; Comprise subcutaneous, inject i.e. aseptic suspending agent, use preceding existing and the medium insoluble product of bonded aseptic drying and the aseptic and/or pyrogen-free Emulsion of usefulness.Solvent can be water or nonaqueous phase.

In some embodiments, the ejection preparation of unit dose is packaged in the syringe that an ampoule, an arm or has pin.This area is known, and the preparation of all drug administration by injection should be aseptic apyrogeneity.

In some embodiments, through being dissolved in certain appropriate solvent, antibody disclosed by the invention or its Fab can prepare aseptic freeze-dried powder.Said solvent can contain a kind of stability of the reorganization solution that improves powder or made by powder, or improves other pharmacology components of powder or reorganization solution.The adjuvant that is suitable for comprises, but is not limited to water, glucose, minashi sugar alcohol, fructose, corn syrup, xylitol, glycerol, glucose, sucrose or other materials that is suitable for.Solvent can contain buffer, and like citrate buffer, sodium phosphate or kaliumphosphate buffer or the known buffer of other present technique skilled person, in one embodiment, the pH of buffer is neutral.Carry out under the standard conditions known in the art filtration sterilization is subsequently carried out in said dissolving, lyophilizing makes ideal preparation then.In one embodiment, the solvent branch with gained is filled to lyophilizing in the tubule.Every tubule can hold said anti-hER antibody or its Fab or its compositions of single dose or multidose.It is required or multidose is required (for example 10% is excessive) that charge weight in every tubule can be slightly higher than each dosage, thus guarantee sampling accurately and administration accurate.Lyophilized powder can store under suitable condition, as arriving room temperature range at about 4 ℃.

The lyophilizing grain weight is dissolved the preparation that obtains being used for drug administration by injection with water for injection.In one embodiment, lyophilized powder can be added in the liquid carrier that aseptic apirogen water or other are suitable for heavily molten.Accurate amount can rule of thumb be worth decision by the therapy decision of selecting.

Antibody that provides among the present invention and antigen knot platform fragment can be used in multiple non-therapeutic use.In some embodiments, antibody or its Fab can be used as the affinity purification agent and are used for purification ER α 36 or its fragment.In these embodiments, can antibody or its Fab be fixed on the solid phase, on resin or filter paper by means commonly known in the art.Said antibody and Fab also can be used for sedimentation ER α 36 or its fragment from solution.In the embodiment of other non-treatments, said antibody or its Fab can be used for multiple external or in-vivo diagnostic or detection applications.In some such embodiment, said antibody or its Fab can combine with detectable label.In other embodiments, said antibody or its Fab can not combine with detectable label, but can use certain can with two anti-detections of the tape label of said antibodies.In some embodiments, antibody provided by the invention or its Fab can be used for detecting the expression of ER α 36.In some such embodiment, said antibody or its Fab can be used for diagnosing the state with ER α 36 increased activity or attenuation of correlation.For example, said antibody or its Fab can contact with the biological sample of certain object, thereby diagnose in this object the state with ER α 36 increased activity or attenuation of correlation, specifically, and the carrying out or the regression of the state relevant with ER α 36.Likewise, said antibody or its Fab can directly deliver medicine to said object, and detect and the combining of ER α 36 with method well known in the art.

In some embodiments, the invention provides the separated encoding said antibody or the nucleotide of its Fab, contain the carrier and the host cell of said nucleotide and prepare the recombination method of said antibody.

For the recombinant production of said antibody, the nucleotide of this antibody of encoding can be separated and be inserted and further clone (DNA cloning) in the reproducible carrier or express.In another embodiment, said antibody can make through the method for homologous recombination well known in the art.The DNA of the said monoclonal antibody of encoding can separate and order-checking (as can using oligonucleotide probe, but this probe specificity combines with the heavy chain of encoding said antibody and the gene of light chain) through conventional method.Variety carrier is available.Carrier component generally includes, but is not limited to, following one or more: signal sequence, replication origin, one or more marker gene, enhancement sequences, promoter and transcription terminator.

Be applicable among the present invention that the host cell of cloning or expressing the DNA in the said carrier is prokaryotic cell, yeast or above-mentioned senior eukaryotic cell.The prokaryotic cell that is applicable to purposes of the present invention comprise eubacteria as, gram negative bacteria or gram positive bacteria, for example, enterobacteriaceae; As, escherichia coli, Enterobacter, Erwinia; Klebsiella, Proteus, Salmonella, as; Mouse typhus sramana (family name) bacillus, Serratia, as; Serratia marcescens, and Shigella, and Bacillus as; Bacillus subtilis and Bacillus licheniformis, pseudomonas as, bacillus pyocyaneus and streptomycete.

Except prokaryotic cell, eukaryotic microorganisms such as filamentous fungi or yeast also can be made host cell clone or express the carrier of the anti-ER antibody of coding.Saccharomyces cerevisiae, or bakery yeast is the most frequently used eucaryon host microorganism such as low.But many other genus, kind and strain are all relatively more commonly used and suitable in the present invention, like schizosaccharomyces pombe; The Kluyveromyces host is like, Kluyveromyces lactis, and (ATCC 12 for Kluyveromyces fragilis; 424); Bulgaria's kluyveromyces (ATCC 16,045), (ATCC 24 for the Wei Shi kluyveromyces; 178); The male yeast (ATCC 56,500) of Crewe, (ATCC 36 for the fruit bat kluyveromyces; 906), heat-resisting kluyveromyces and yeast Kluyveromyces marxianus; Separate fat Ye Shi yeast (EP 402,226); Pichia pastoris phaff (EP 183,070); Candida mycoderma; Trichoderma reesei (EP 244,234); Neurospora; Prosperous yeast is permitted in the west, as: prosperous yeast is permitted in the west; And filamentous fungi, as: neurospora, penicillium, curved neck is mould, and aspergillosis, as: hook nest aspergillosis and aspergillus niger.

The host cell that is applicable to expression glycosylated antibodies or its Fab that provides among the present invention is derived by multicellular organism and is obtained.The instance of no vertebra cell comprises plant and insect cell.Multiple baculovirus strain (baculoviral strains) and variant thereof and corresponding permission property insect host cell (permissive insect host cells) have been found; Come from such as following host: fall army worm (caterpillar), Aedes Aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruit bat), and silkworm.The multiple Strain that is used for transfection is public Ke De, the for example Bm-5 mutation of autographa california nuclear polyhedrosis virus and bombyx mori nuclear polyhydrosis virus, and these viruses all can be used in the present invention, especially for transfection fall army worm cell.The culture plant cell of Cotton Gossypii, corn, Rhizoma Solani tuber osi, Semen sojae atricolor, petunia, Fructus Lycopersici esculenti and Nicotiana tabacum L. also can be used as the host.

But the research of vertebra cell is the hottest, and the cultivation of vertebra cell (tissue culture) has become routine operation.Available mammalian host cell instance has, the monkey-kidney cells CV1 system (COS-7, ATCC CRL 1651) that SV40 transforms; Human embryonic kidney cell system (293 or 293 cell sub-clones of suspension culture, Graham et al., J.Gen Virol.36:59 (1977)); Baby hamster kidney cell (BHK, ATCC CCL 10); Chinese hamster ovary cell/-DHFR (CHO, Urlaub et al., Proc.Natl.Acad.Sci.USA 77:4216 (1980)); Mouse testis sustenticular cell (TM4, Mather, Biol.Reprod.23:243-251 (1980)); Monkey-kidney cells (CV1 ATCC CCL70); African green monkey kidney cell (VERO-76, ATCC CRL-1587); Human cervical carcinoma cell (HELA, ATCC CCL2); Madin-Darby canine kidney(cell line) (MDCK, ATCC CCL34); Buffalo rat hepatocytes (BRL3A, ATCC CRL 1442); Human pneumonocyte (W138, ATCC CCL75); Human liver cell (Hep G2, HB 8065); Mice mastadenoma (MMT 060562, ATCC CCL51); TRI cell (Mather etc., Annals N.Y.Acad.Sci.383:44-68 (1982)); MRC 5 cells; The FS4 cell; And Bel7402 (Hep G2).

With above-mentioned expression that produces anti-ER antibody or cloning vehicle transformed host cell; And it is cultivated in the Nutrient medium of routine, said Nutrient medium is suitable for evoked promoter, selects the gene of transformant or amplification coding aim sequence after modifying.

The host cell that is used for producing said antibody or its Fab among the present invention can be cultivated in multiple culture medium.Commercially available culture medium such as Ham ' s F10 (Sigma), minimum basic training liquid (MEM, (Sigma)), RPMI-1640 (Sigma), ((DMEM) Sigma) can be used for cultivating said host cell to reach Dulbecco ' s Modified Eagle ' s Medium.In addition, any at Ham et al., Meth.Enz.58:44 (1979), Barnes et al., Anal.Biochem.102:255 (1980), U.S.Pat.No.4,767,704; 4,657,866; 4,927,762; 4,560,655; Or 5,122, and 469; WO 90/03430; WO 87/00195; Or U.S. Patent application Re.30, the culture medium of explanation can be as the culture medium of said host cell in 985.The energy source that these culture medium all can be added necessary hormone and/or other somatomedin (like insulin, transferrins or epidermal growth factor), salt (like sodium chloride, calcium chloride, magnesium chloride and phosphate), buffer (like HEPES), nucleotide (like adenylic acid and thymus pyrimidine), antibiotic (like gentamycin), trace element (being defined as final concentration usually at micro-molar range inorganic compound) and glucose or are equal to it.Said culture medium also can contain any other necessary additive of debita spissitudo well known in the art.The condition of said culture medium is like conditions of similarities such as temperature, pH value, for the employed before this condition of selecting to be used to express of host cell, by those of ordinary skill is known.

When using recombinant technique, said antibody can be in born of the same parents, wall film space generates, or direct secretion is in culture medium.If said antibody generates in born of the same parents, at first remove the pulsating granule remains of host cell or cracking, for example, can be through centrifugal or ultransonic method.Carter et al., Bio/Technology 10:163-167 (1992) have described and will be secreted into the isolating method of the spatial antibody of escherichia coli wall film.In brief, under the condition that sodium acetate (pH 3.5), EDTA and phenylmethylsulfonyl fluoride (PMSF) exist, melting cell, to stick with paste (cell paste) about more than 30 minutes.The centrifugal cell debris of removing.As as described in antibody-secreting in culture medium, then at first use commercially available protein concentration filter usually, like Amicon or Millipore Pellicon ultrafiltration unit, concentrate the supernatant of this expression system.In any aforesaid step, all protease inhibitor can be added such as PMSF degrades with Profilin, and antibiotic is to prevent the growth of accidental contamination thing.

The antibody that from said cell, makes can adopt purification process to carry out purification, for example hydroxyapatite chromatography, gel electrophoresis, dialysis and affinity chromatography, and wherein close platform chromatograph is preferred purification technique.Exist the Fc domain of any immunoglobulin to determine whether protein A is fit to as affinity ligand in the kind of said antibody and the said antibody.Protein A can be used for purification based on people γ 1, the antibody of γ 2 or γ 4 heavy chains (Lindmark et al., J.Immunol.Meth.62:1-13 (1983)).Protein G is applicable to all Mus source isomers and people γ 3 (Guss et al., EMBO J.5:1567 1575 (1986)).Agarose is the most frequently used affinity ligand attaching substratum, but also can select other substrate for use.Substrate that mechanical force is stable such as controlled pore glass or gather (styrene) benzene and can realize flow velocity and shorter processing time faster with comparing with agarose.Contain the C.sub.H3 domain like this antibody, then available Bakerbond ABX.TM resin carry out purification (J.T Baker, Phillipsburg, N.J.).Also the antibody that can obtain is as required confirmed the technology of other protein purifications, like the fractional distillation in the ion exchange column, ethanol precipitation, reversed-phase HPLC, silica gel chromatography, based on heparin sepharose chromatograph (like the poly-aspartate post), chromatofocusing, SDS-PAGE and the ammonium sulfate precipitation of anion or cation exchange resin.

After any preliminary purification step; The method of available low pH hydrophobic interaction chromatograph is handled the mixture that contains interested antibody and impurity; With the elution buffer of the about 2.5-4.5 of pH, preferably under low salt concn, carry out (for example, from about 0 to 0.25M salinity).

In some embodiments, the form that antibody among the present invention or Fab can test kits provides, as, the packaged agent combination that contains predetermined number, and have the diagnostic test operating instruction.As as described in antibody have enzyme labelling, then said test kit can comprise substrate that said enzyme is required and cofactor the substrate precursor of detectable pigment group or fluorophor (as provide).In addition, also can contain other additives, like stabilizing agent, buffer agent (like blocking-up buffer or lysis buffer) and analog thereof.The relative quantity of described plurality of reagents can have bigger difference, thereby the reagent solution that multiple concentration can be provided is with the sensitivity of optimization experiment in fact.Specifically, said plurality of reagents can be powder, is generally lyophilised state, comprises adjuvant, and it can obtain the reagent solution of suitable concentration after dissolving.

In some embodiments, the invention provides and contain the goods that to treat above-mentioned state.Said goods contain container and label.The container that is suitable for comprises, for example, and bottle, tubule, syringe or test tube.Said container can be made up of multiple material such as glass or plastics.Said container is equipped with the pharmaceutical composition (containing antibody disclosed by the invention or its Fab) that can effectively treat said state provided by the invention, and has aseptic outlet (for example said container can be the venous transfusion bag or have the bottle stopper that can be punctured by hypodermic needle).On the container or the relevant label of container indicate said composition and be used to treat selected state.Said goods can further contain second kind of container, and it contains the acceptable for pharmaceutical buffer, for example phosphate buffer, ringer's solution and glucose solution.It also can further comprise desirable other materials on commercial angle and the use angle, comprises other buffer, diluent, filter, pin, syringe and with the packing of operation instruction.

Following examples are intended to illustrate better the present invention, and should not be construed as restriction scope of the present invention.All following particular compositions, material and method, its in whole or in part, all within the scope of the invention.These specific combined things, material and method are not in order to limit the present invention, and just for the specific embodiment of explanation within the scope of the invention.Those skilled in the art can not add creative and not depart from the scope of the invention and develop compositions, material and the method that is equal to.Should be understood that in the multiple change that method of the present invention is made and still to be included in the scope of the present invention.The inventor is intended to such change is comprised within the scope of the invention.

Embodiment

Embodiment 1 screens the phage of expressing anti-ER α 36 scFv from people's phage display natural antibody storehouse.

Preparation ER α 36 and biotinylation ER α 36:

ER α 36 makes through the method for chemosynthesis, uses biotin labeling then, makes biotinylated ER α 36.

Phage display:

Method screening through phage display shows that anti-ER α 36 scFv are arranged, because it has tangible advantage with respect to the hybridoma technology of classics.For example, phage display can directly obtain people's antibody, avoids the antibody that produces through hybridoma technology is carried out humanization modified process.Phage display is known technology in the art, and concrete grammar can be referring to list of references (Phage antibodies:filamentous phage displaying antibody variable domains.Nature.1990 Dec 6; 348 (6301): 552-4).Method by following explanation is carried out phage display.

Prepare phage library:

The structure of phage library is selected the ScFv expression vector for use.With the lymphocyte separation and purification of healthy subjects, extract total cell RNA and be used for synthetic cDNA.Through polymerase chain reaction (PCR) amplification antibody variable gene and ScFv gene.Purification variable region of heavy chain V _HWith variable region of light chain V _LThe PCR product, and be assembled into the ScFv fragment, be used to make up the ScFv single-chain phage antibody library.Concrete grammar can be referring to list of references (Lennard S., Standard protocols for the construction of scFv libraries.Methods Mol Biol.2002; 178:59-71; Sheets MD, Efficient high-affinity human single-chain antibodies to protein antigens, Proc Natl Acad Sci U S is May 26 A.1998; 95 (11): 6157-62.)

The phage of anti-ER α 36 scFv is expressed in screening:

4 ℃ of magnetic beads (available from Promega) that screening pipe and Streptavidin encapsulate are with confining liquid (0.1M NaCO ₃, pH8.6,5mg/ml BSA, 0.02%NaN3,0.1 μ g/ml Streptavidin) seal and spend the night.With screening pipe and the magnetic bead after 0.1%PBST (phosphate buffered solution that contains 0.1%Tween 20 (v/v)) the washing sealing.In first round screening, with 4 * 10 ¹²The phage library of pfu mixes incubated at room temperature 60 minutes with isopyknic 4%PBSM (phosphate buffered solution that contains 4% milk).In phage mixture, adding final concentration is the biotinylated ER α 36 of 10 μ g/ml, incubated at room temperature 30 to 60 minutes.Magnetic bead/the antigen samples that in magnetic separating device, encapsulates with PBST washing Streptavidin.Sample is resuspended with 2%PBSM, equilibrium at room temperature 1 to 2 hour.From PBSM, separate the magnetic bead obtain after the balance, and be resuspended in the mixed liquor of phage and biotinylation ER α 36 incubated at room temperature 15 minutes.To screen pipe and be put on the magnetic separator, spin upside down 2 minutes.Remove the liquid in the screening pipe, wash magnetic bead with PBSMT (phosphate buffered solution that contains 2% milk and an amount of tween 20), reuse PBSMT washed magnetic bead after magnetic bead was transferred to new pipe, and reuse PBS washed magnetic bead after magnetic bead was transferred to new pipe then.Reuse adds acid eluent wash-out bacteriophage at room temperature after at last magnetic bead being transferred to new pipe.The phage of eluting is used for the next round screening.

Second takes turns screening:

The phage of the eluting that will obtain after will screening the first round infects the TG1 antibacterial of exponential phase again.After the amplification, with 4.0 * 10 ¹²The phage of pfu is used for second and takes turns screening, screening technique and first round screening basically identical, but replace 0.1%PBST with 0.5% PBST, and the adding final concentration is the biotinylated ER α 36 of 1 μ g/ml in the phage.

The third round screening:

The TG1 antibacterial that second phage of taking turns the eluting that obtains after the screening is used to infect exponential phase.After the amplification, with 3.9 * 10 ¹²The phage of pfu is used for the third round screening, and screening technique and second is taken turns the screening basically identical, is the biotinylated ER α 36 of 0.1 μ g/ml but in phage, add final concentration.

The four-wheel screening:

The TG1 antibacterial that the phage of the eluting that obtains after the third round screening is used to infect exponential phase.After the amplification, with 4.0 * 10 ¹²The phage of pfu is used for four-wheel screening, screening technique and third round screening basically identical, but with the acid eluent of the 1mg/mlER α 36 replacements eluting that is at war with.

The actual conditions and the The selection result of four-wheel screening are as shown in table 4.Progressively reduce with the concentration of the blended biotinylation ER of phage α 36 Functional Polypeptides, the percentage ratio of Tween-20 in cleaning mixture progressively raises, and this has significantly improved the strict degree of screening.Use acid eluent, to guarantee to be recovered to the multiple conjugate in the preceding three-wheel screening.In the end one take turns in the screening, combine the phage of expression ER α 36 antibody with abiotic elementization ER α 36 competitions of high concentration, thereby realize the specificity eluting.As shown in table 4, enrichment factor effectively reduces, and shows that the enrichment effect is obvious.

Table 4 screening process is summed up

Annotate: enrichment factor=throwing people/output

The phage positive colony that embodiment 2 identifies anti-ER α 36 scFv of expressing human

Select the phage monoclonal of expressing antibodies:

The phage monoclonal that four-wheel screening among the embodiment 1 is obtained is seeded to (2TY that contains 100 μ g/ml ampicillin and 1% (w/v) sucrose) in the 2TY-AG culture fluid, 37 ℃ of overnight incubation respectively.Get in bacterium liquid 100 μ l to the 20ml 2TY-AG culture fluid of overnight incubation, 37 ℃ are cultured to the OD600 value and reach 0.4～0.5.Add helper phage, 37 ℃ of cultivations make the phage-infect antibacterial.Centrifugal 10 minutes of 5000g collects infected antibacterial, and resuspended in the 2TY-AK culture fluid, cultivates 16 hours for 37 ℃.With phage precipitant deposition phage, the centrifugal bacterial debris of removing.The resuspended phage of PBS, the centrifugal again antibody fragment that does not combine phage of removing, reuse PBS is resuspended.

Phage E LISA experiment:

Wash the orifice plate (available from Pierce) that neutral Avidin (Neutravidin) encapsulates in advance with flushing liquor (PBS that contains 0.1%Tween-20), the hole that the confining liquid sealing is all is put 4 ℃ and was cultivated 1 to 2 hour.Discard confining liquid, cleaning mixture is washed to be inverted behind the plate 6 times and is dried orifice plate.Treat that every hole in the gaging hole adds the PBS solution of 100 μ l biotinylation ER α 36, incubated at room temperature is removed above-mentioned solution after 1～2 hour, wash plate once with flushing liquor.Add 100 μ l phage solutions in every hole, incubated at room temperature 1～2 hour, flushing liquor is washed plate 6 times.With the rabbit anti-M13 antibody (available from GEHealthcare) of confining liquid with 1: 5000 dilution proportion HRP connection, add the anti-M13 antibody of rabbit of the HRP connection of 100 μ l dilution in every hole, incubated at room temperature is after 1 hour, and flushing liquor is washed plate six times.

Each treats to add 100 μ l HRP substrate solutions in the gaging hole, and incubated at room temperature 30 minutes detects at the 490nm place with microplate reader then.The HRP substrate solution is prepared as follows: in the liquor sodii citratis of 100ml 50mM pH4.0, dissolve 22mgOPD (available from Sigma) and be made into OPD storage liquid, filtration sterilization.The OPD storage liquid is 4 ℃ of preservations.Before each the detection, in every 21mlOPD storage liquid, add the hydrogenperoxide steam generator of 36 μ l 30% at present.Experiment comprises positive control, negative control 1 and negative control 2.The version that positive control encapsulates for the M13 phage is with the anti-M13 antibody test of HRP connection.Do not contain biotinylation ER α 36 in the negative control 1, do not contain phage in the negative control 2.

As stated above, from the phage monoclonal that four-wheel filters out, identify the phage positive colony that obtains 40 the anti-ER α of expressing human 36scFv, the result is as shown in table 5.

The monoclonal ELISA experimental result of table 5 phage

Annotate: the positive contrast of P; The negative contrast 1 of N1; The negative contrast 2 of N2.

The nucleotide sequence that embodiment 3 measures anti-ER α 36 scFv of people that express in the phage positive colony.

40 positive bacteriophage positive colonies are carried out dna sequencing respectively, and sequencing primer is respectively:

5′-TGGAATTGTGAGCGGATAACAATT-3′，

5′-GTAAATGAATTTCTGTATGAGG-3′。In sequence analysis software Vector NTI (available from Invitrogen) analyzes with sequencing result; Draw 7 kinds of different nucleotide sequences (SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16; See description) and the aminoacid sequence of 7 kinds of predictions (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15 see description).7 kinds of anti-ER α 36 scFv of people are designated as ScFv1 respectively, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6 and ScFv7.Corresponding sequence is specifically referring to relevant portion in the preamble specific embodiment.According to 7 seed amino acid sequences of prediction, the phage clone of 40 order-checkings is divided into groups, the result is as shown in table 6.

Table 6 divides into groups to positive phage clones according to the anti-ER α 36 scFv aminoacid sequences of expressing

The aminoacid sequence numbering	The phage clone numbering
		ScFv1(SEQ?ID?NO：3)	2，5，6，9，13，19，20，29，31，33，36
ScFv2(SEQ?ID?NO：5)	1，7，11，15，17，25，28，34，38
		ScFv?3(SEQ?ID?NO：7)	4，8，14，22，23，37
ScFv?4(SEQ?ID?NO：9)	10，16，21，32，35
		ScFv?5(SEQ?ID?NO：11)	3，30，40，18
ScFv?6(SEQ?ID?NO：13)	27，39，26
		ScFv?7(SEQ?ID?NO：15)	12
ND	24

Annotate: ND is not for measuring.

Embodiment 4 expresses and anti-ER α 36 ScFv1-ScFv7 of purification people.

37 ℃ of cultivation amplifications the single bacterium colony of picking one HB2151 (available from GE Healthcare) to the 2TY training liquid from the LB flat board are to OD600 about 0.6～0.8.The phage clone of identifying the expression ScFv1～ScFv7 that obtains among the embodiment 3 is respectively got 1 μ l, be inoculated in respectively among the HB2151 of 200 μ l exponential phases, cultivated 30 minutes for 37 ℃.The culture that infects is used to be coated with LB-AG flat board (the LB culture medium that contains ampicillin and sucrose), 37 ℃ of overnight incubation.Get the bacterium liquid that 250 μ l cultivate and be seeded to 25ml 2TY training liquid, 37 ℃ of amplification culture are about 0.6 to OD600.In each culture, add 250 μ l 2TY and induce training liquid (2TY that contains 0.1mM IPTG derivant), 30 ℃ of overnight incubation.Centrifugal 10 minutes collecting cells of 3500g are resuspended among the PBS (1: 50v: v).The supersound process cell suspension makes it discharge solvable ScFv, at 9000g centrifugal 10 minutes, collects the supernatant that contains solvable ScFv.To contain ScFv1, ScFv2, ScFv3, ScFv4, ScFv5, ScFv6, the supernatant of ScFv7 is designated as S14 respectively, S24, S33, S41, S53, S66 and S72.Measure in the supernatant whether have 7 kinds of ScFv with SDS-PAGE (SDS-PAGE).7 kinds of ScFv mainly find in supernatant, and all with the formal representation of inclusion body.Fig. 2 has shown S14, S24, S33, S41, the electrophoresis photo example of S66 and six kinds of supernatant of S72.

Because 7 kinds of solvable ScFv are the formal representations with inclusion body, so adopt 7 kinds of scFv of Ni post affinity column purification under the degeneration condition.With supernatant S14, S24, S33, S41, S53, S66 and S72 are at 20mM Tris.HCl, and pH 8.0,8M carbamide, Ni post affinity purification is carried out in degeneration under the degeneration condition of 50mM beta-ME again.7 kinds of inclusion body solution after the degeneration are gone up Ni post (available from GE Healthcare) respectively.Flushing liquor (20mM Tris.Cl, pH 8.0,8M carbamide, 10mM imidazoles, 25mM NaCl) flushing pillar, balance liquid (same flushing liquor) balance pillar to baseline is steady, uses eluent (balance liquid adds the imidazoles that gradient increases progressively) to carry out gradient elution then.Collect eluent, and carry out the SDS-PAGE electrophoretic analysis.Fig. 3 a-3c is respectively S14, the eluent electrophoresis photo example of S41 and S66.The result shows that purpose band concentration is high in eluent, and assorted band is few, illustrates that the purity of destination protein is higher in the eluent, and purification effect is good.

With Ni post elution samples according to 1: 10 ratio dialyse to dialysis buffer liquid (the 50mM borate buffer that contains 8M carbamide, pH8.9).Dialyse after 17 hours, change dialysis solution, continue dialysis 7 hours.Dialyzed sample is diluted to 300 μ g/ml with borate buffer (50mM, pH8.9 contain 8M carbamide), with 1: 10 ratio dialysis renaturation.It is following that each goes on foot the buffer composition:

The 50mM borate buffer, 1% glycine, 4M carbamide, pH8.9;

The 50mM borate buffer, 1% glycine, 2M carbamide, pH8.9;

The 50mM borate buffer, 1% glycine, 1M carbamide, pH8.9;

The 50mM borate buffer, 1% glycine, 0.5M carbamide, pH8.9;

The 50mM borate buffer, 1% glycine, pH8.7;

The 50mM borate buffer, 1% glycine, pH8.7;

The 50mM borate buffer, 1% glycine, pH8.7.

Wherein, replace 1% glycine with 0.4M L-arginine in the S24 sample segment renaturation.

7 kinds of supernatant that contain inclusion body obtain the renaturation sample of a plurality of ScFv after renaturation.Sample lot number, concentration and total protein concentration are as shown in table 7.The result shows that the protein concentration of most of renaturation sample is higher, and the total protein yield nearly all more than 10mg, can be used for follow-up study.Renaturation samples using reduction SDS-PAGE electrophoresis is analyzed.S14, S24, S33, S41, S53, reduction electrophoresis exemplary plot such as Fig. 4 a-c and shown in Figure 5 of S66 and S72 renaturation sample.Among Fig. 4 a-c, with the preceding S14 of renaturation, the electrophoretic band position of S41 and S66 does not have significant change after the renaturation, shows that renaturation does not obviously change proteic molecular weight.Fig. 5 shows that in SDS-PAGE, each in the renaturation sample of 7 kinds of ScFv all only has a tangible purpose band, shows that the purity of recombinant protein is still very high.Add the 0.15M trehalose in 7 kinds of ScFv solution that renaturation is obtained, store for future use after the lyophilizing.

Output after the renaturation of the anti-ER α 36 ScFv 1-ScFv 7 of table 7

Western Blot verifies anti-ER α 36 ScFv1～ScFv7:

ScFv1～the ScFv7 of purification renaturation gained is verified through the method for Western Blot.But the HEK293 cell of artificial constructed express recombinant ER α 36.The HEK293 cell of cultivating people's breast cancer cell SK-BR-3 and express recombinant ER α 36, harvesting adds the lysate cracking respectively, obtains crack protein.Albumen with appearance on the 20 μ g/ holes, is carried out the SDS-PAGE gel electrophoresis, and with the protein sample behind the electrophoresis respectively electrotransfer to ScFv1～ScFv7 polyvinylidene fluoride (PVDF) film of crossing of labelling respectively.Film is sealed with skim milk, add anti-His-HRP, obtain result (Figure 16) with development.

Western Blot experimental result shows that ScFv1～ScFv7 resists as one can detect recombinant expressed ER α 36 specifically, proves that ScFv1～ScFv7 can combine with ER α 36 specifically.

Embodiment 5 identifies anti-ER α 36 ScFv1-ScFv7 and antigenic binding ability.

The ELISA experiment of ScFv:

96 orifice plates that Streptavidin encapsulates are washed twice with PBS, and each treats that it is the biotinylation ER α 36 of 20 μ g/ml that gaging hole adds final concentration, and room temperature was placed 2 hours, and PBST washes plate three times.In treating gaging hole, add renaturation ScFv sample (100ul, S14A1r1, S24A2r2, S33A2r1, S41A3r3, S53A1r1, S66A1r1 and S72A2r1) respectively, 5 gradients of 5 times of dilutions of each sample, each gradient is parallel does two multiple holes.Cultivated 1 hour for 37 ℃.PBST washes plate three times, and every hole adds 100 μ l mouse anti His-6 monoclonal antibodies (dilution in 1: 2000), cultivates 1 hour for 37 ℃.PBST washes plate three times, and every hole adds 100 μ l goat-anti mice-HRP (dilution in 1: 2500), cultivates 1 hour for 37 ℃.PBST washes plate six times, and every hole adds 100 μ lOPD colour developing liquid, the lucifuge colour developing, and every hole adds 50 μ l 2M H ₂SO ₄Cessation reaction, microplate reader 490nM place reading.

Experiment is a parallel positive control and three negative controls done simultaneously.Positive control is to replace each ScFv renaturation sample with the anti-ER polyvalent antibody of rabbit, replaces goat-anti mice-HRP with goat-anti rabbit-HRP.Negative control 1 (N1) does not contain ScFv renaturation sample; Negative control 2 (N2) uses 200 μ g/ml ScFv renaturation samples, does not add the His-6 monoclonal antibody.Negative control 3 (N3) does not contain ScFv renaturation sample and His-6 monoclonal antibody.Experimental result is as shown in table 8.7 kinds of ScFv are concentration-OD490 figure respectively, as shown in Figure 6.The result shows, scFv1～scFv7 under the concentration of being tested, with antigen ER α 36 combine to be the significant concentration dependency, prompting scFv1～scFv7 can combine with antigen ER α 36 specifically.

The anti-ER α of table 8 36ScFv S1-ScFv S7 and ER α 36 bonded ELISA experimental datas

Annotate: the positive contrast of P, the negative contrast 1 of N1, the negative contrast 2 of N2, the negative contrast 3 of N3.

Anti-ER α 36 ScFv-1 of embodiment 6 people, ScFv-3, ScFv-4, ScFv-7 and anti-ER α 36 rabbit polyclonal antibodies are to the tumor inhibition effect of tumor bearing nude mice.

Laboratory animal:

Adopt 49 female BALB/c-nu nude mices (providing) by the department of the Chinese Academy of Sciences of Department Of Medicine, Peking University's laboratory animal section.

Experiment is divided into groups:

Laboratory animal is divided into 7 groups, establishes 7 nude mices for every group.7 groups are respectively: with the negative control group of human IgG antibody (available from Beijing Bo Aosen Bioisystech Co., Ltd) treatment; Positive controls with the Trastuzumab treatment; Polyclonal antibody testing group with anti-ER-36 rabbit source polyclonal antibody (providing) by Creighton University Wang Zhao-Yi group; And anti-ER α 36 ScFv-1 that choose respectively; ScFv-3, the monoclonal antibody testing group of ScFv-4 and ScFv-7 Antybody therapy.

Administration:

Testing group is the anti-ER-36 rabbit polyclonal antibody of the same dosage of administration respectively, anti-ER-36 human monoclonal ScFv-1, ScFv-3, ScFv-4 and ScFv-7 antibody (5mg/kg, 100 μ g/ dosage).Positive controls administration 5mg/kg Trastuzumab (100 μ g/ dosage).Negative control group administration 5mg/kg human IgG antibody (100 μ g/ dosage).

Experimental technique and data analysis:

Human breast carcinoma BCAP-37 (estrogen receptor positive is provided by medicine institute of Chinese Academy of Medical Sciences pharmacology department) is transplanted in the right fore oxter of every experiment nude mice.After the transplanting, per os is irritated the stomach diethylstilbestrol, 7 μ g/ days/only, successive administration 9 days.Mice was divided into 7 groups in the 10th day, through intravenous injection corresponding be subjected to the reagent thing, dosing interval is 3-4 days, successive administration 6 times.Measured tumor bearing nude mice body weight and the transplantation tumor volume of growing in every 3-4 days, and with following formula calculating parameter:

Each treated animal gross tumor volume (VT): $\mathrm{Vt}=\frac{1}{2}\&times;a\&times;{\mathrm{<figure-callout\; id="2"\; label="b"\; filenames="HPA00001420564400041.png,HPA00001420564400081.png"\; state="\{\{state\}\}">b</figure-callout>}}^2,$ (formula 1)

A wherein, b representes the tumor length and width respectively;

Relative volume (RVT): $\mathrm{RTV}=\frac{\mathrm{<figure-callout\; id="0"\; label="Vt\; V"\; filenames="HPA00001420564400071.png,HPA00001420564400081.png"\; state="\{\{state\}\}">Vt</figure-callout>}}{V_{}},$ (formula 2)

V wherein ₀Measure the gained gross tumor volume before the administration during for grouping, the gross tumor volume when Vt is each measurement the, V ₀The same Vt of computing formula;

Tumor proliferation rate T/C (%): $\mathrm{TC}\%=\frac{\mathrm{TRTV}}{\mathrm{CRTV}}\&times;100\%,$ (formula 3)

Wherein TRTV is the RTV arithmetic mean of instantaneous value of treatment group, the RTV arithmetic mean of instantaneous value of the negative matched group of CRTV.

The observation administration is put to death after 21 days and is respectively organized tumor bearing nude mice continuously, peels off tumor tissue, takes a picture, and weighs with 1/10000 analytical balance.Calculate average tumor weight and respectively organize inhibition rate of tumor growth with calculating:

(equation 4).

All experimental data adopts mean+SD to represent.Adopt the t check respectively to organize data.

Experimental result:

Five kinds are tried antibody and are all dissolved the formation settled solution with sterile water for injection.Respectively organize tumor bearing nude mice during the administration and all do not have death.The body weight of mice in testing group and the negative control group is not seen significant difference (seeing table 9, table 10).Gross tumor volume (TV) according to observed tumor-bearing mice (is seen table 11; Table 12), relative tumour volume (RTV) (is seen table 13, table 14; Fig. 7); The relative rate of increase T/C of tumor, tumor actual measurement weight (is seen table 15, Fig. 8); And inhibition rate of tumor growth (is seen table 16; Find that Fig. 9) five kinds are tried antibody the tumor growth of tumor-bearing mice is all had the obvious suppression effect, wherein the ScFv-3 group is organized the strongest to the tumor growth inhibitory action with ScFv-7.Five kinds tried antibody to the tumor growth inhibitory action a little less than positive drug Trastuzumab matched group.To the pathological examination (see figure 10) demonstration as a result of seven groups of mices, the gross tumor volume of negative control group significantly greater than the gross tumor volume of positive controls, is also obviously tried the gross tumor volume of antibody group greater than all.In the testing group, the gross tumor volume of polyclonal antibody group is slightly larger than the monoclonal antibody group, but is significantly less than negative control group.In the monoclonal antibody group, the gross tumor volume of ScFv-3 group and ScFv-7 group is minimum, and tumor killing effect is near the positive control Trastuzumab.It is obviously less that ScFv-1 group and the gross tumor volume that ScFv-4 organizes are compared with negative control, and to compare effect suitable with the polyclone group, but gross tumor volume is more bigger than positive control Trastuzumab.

Table 9 tumor-bearing mice grouping situation, dosage and body weight when dividing into groups

Group	Size of animal (only)	Body weight during grouping	Dosage
				Negative medicine matched group	7	19.82±0.44	5mg/kg
The positive drug matched group	7	19.87±0.44	5mg/kg
				The polyclonal antibody group	7	19.88±0.57	5mg/kg
Monoclonal ScFv-1 antibody group	7	19.91±0.49	5mg/kg
				Monoclonal ScFv-3 antibody group	7	19.94±0.81	5mg/kg
Monoclonal ScFv-4 antibody group	7	19.67±0.57	5mg/kg
				Monoclonal ScFv-7 antibody group	7	19.67±0.67	5mg/kg

Body weight (g) changes relatively during each experimental group tumor bearing nude mice administration of table 10

Group

Before the administration

Administration

4 days

Administration

7 days

Administration 11 days

Administration

14 days

Administration 18 days

Administration 21 days

Negative medicine matched group

19.82±0.44

20.08±0.42

20.45±0.35

21.64±0.63

22.21±0.52

23.41±0.49

23.88±0.27

The positive drug matched group

19.87±0.44

20.27±0.39

20.74±0.33

21.34±0.42

21.98±0.41

22.97±0.44

23.62±0.46

The polyclonal antibody group

19.88±0.57

20.28±0.39

20.65±0.38

21.34±0.42

22.01±0.36

23.35±0.65

23.70±0.59

ScFv-1 antibody group

19.91±0.49

20.25±0.40

20.74±0.32

21.32±0.41

22.05±0.35

23.62±0.43

23.84±0.41

ScFv-3 antibody group

19.94±0.81

20.28±0.54

20.75±0.31

21.24±0.55

22.04±0.59

23.38±0.46

23.62±0.36

ScFv-4 antibody group

19.67±0.57

20.07±0.48

20.72±0.28

21.44±0.51

22.01±0.46

23.47±0.39

23.64±0.25

ScFv-7 antibody group

19.67±0.67

20.02±0.51

20.65±0.24

21.34±0.51

22.01±0.52

23.15±0.58

23.52±0.47

Annotate: respectively with the relatively more equal unknown significance difference of negative control group.

Gross tumor volume (mm during each experimental group tumor bearing nude mice administration of table 11 ³) change relatively

Group

Before the administration

Administration

4 days

Administration

7 days

Administration 11 days

Administration

14 days

Administration 18 days

Administration 21 days

Negative medicine matched group

50.48±11.72

350.70±85.00

663.67±196.02

3159.09±593.30 b

4501.79±530.09

6281.90±732.53

7287.01±889.55 b

The positive drug matched group

50.95±15.31

89.08±25.89 b

186.80±58.36 b

1049.69±251.43 b

1394.53±201.24 b

2141.61±276.39 b

2586.37±233.62 b

The polyclonal antibody group

50.45±12.48

228.78±44.33 b

387.25±66.52 b

1693.71±389.00 b

2346.03±506.84 b

3317.76±713.86 b

3919.27±642.95 b

ScFv-1 antibody group

50.83±16.51

184.31±81.10 b

344.75±135.70 b

1493.66±517.68 b

2174.87±514.19 b

3208.12±595.60 b

3792.10±639.19 b

ScFv-3 antibody group

50.51±10.12

171.91±73.68 b

302.93±100.01 b

1442.70±406.32 b

1993.02±405.84 b

2859.65±427.16 b

3324.97±460.89 b

ScFv-4 antibody group

50.25±13.96

222.27±104.89 b

427.50±136.98 a

1930.04±390.85 b

2666.60±464.32 b

3644.40±414.64 b

4098.31±557.11 b

ScFv-7 antibody group

50.62±13.32

186.11±71.13 a

308.85±117.52 b

1521.45±366.24 b

2136.49±479.95 b

2944.61±526.75 b

3358.43±445.13 b

Annotate: a representes to compare p＜0.05 with negative control group; B representes to compare p＜0.01 with negative control group.

Table 12 statistics (P value) is gross tumor volume (mm between each administration group group relatively ³)

Statistical comparisons	Positive controls	The multi-resistance group	The ScFv-1 group	The ScFv-3 group	The ScFv-4 group	The ScFv-7 group
							Compare with negative control group	1.3E-08	3.2E-06	2.2E-06	2.2E-07	3.6E-06	2.2E-07
Compare with positive controls	——	0.00024	0.00053	0.00261	2.5E-0.5	0.00157
							Compare with the multi-resistance group	——	——	0.71702	0.07016	0.5879	0.08208
Compare with the ScFv-1 group	——	——	——	0.1427	0.35819	0.16648
							Compare with the ScFv-3 group	——	——	——	——	0.01518	0.89242
Compare with the ScFv-4 group	——	——	——	——	——	0.01776

Relative tumour volume (RTV) changes relatively during each experimental group tumor bearing nude mice administration of table 13.

Annotate: a representes to compare p＜0.05 with negative control group; B representes to compare p＜0.01 with negative control group.

Table 14. administration gross tumor volume (RTV) statistical comparisons (P value) between each administration group group after 21 days

Table 15 administration tumor weight (g) statistical comparisons (P value) between each administration group group after 21 days

Statistical comparisons	Positive controls	The multi-resistance group	The ScFv-1 group	The ScFv-3 group	The ScFv-4 group	The ScFv-7 group
							Compare with negative control group	8.759E-10	1.641E-08	7.685E-08	4.645E-10	2.113E-08	3.713E-08
Compare with positive controls	——	7.789E-05	0.00102	0.00902	0.00011	0.0207
							Compare with the multi-resistance group	——	——	0.491	0.0023	0.902	0.047
Compare with the ScFv-1 group	——	——	——	0.047	0.564	0.202
							Compare with the ScFv-3 group	——	——	——	——	0.004	0.686
Compare with the ScFv-4 group	——	——	——	——	——	0.061

Each experimental group tumor bearing nude mice tumor weight (g) of table 16. and inhibition rate of tumor growth (%) change relatively

Group	The example number	Tumor weight (g)	The p value	Inhibition rate of tumor growth (%)
					Negative control group	7	6.805±0.487	——	——
Positive controls	7	1.952±0.572	＜0.001	71.31
					The multi-resistance group	7	3.544±0.434	＜0.001	47.92
The ScFv-1 group	7	3.338±0.631	＜0.001	50.94
					The ScFv-3 group	7	2.738±0.344	＜0.001	59.76
The ScFv-4 group	7	3.514±0.465	＜0.001	48.36
					The ScFv-7 group	7	2.860±0.696	＜0.001	57.97

Annotate: the p value is carried out statistical comparisons by each administration group and negative control group and is calculated.

Embodiment 7 more anti-ER α 36ScFv-7 and tamoxifen are to the tumor inhibition effect of tumor bearing nude mice.

Laboratory animal and grouping:

21 female BALB/c-nu nude mices are divided into 3 groups, establish 7 nude mices for every group.

Dosage:

With the dosed administration of anti-ER α 36 human monoclonal ScFv-7 with the 0.1mg/20g body weight/day.The positive controls tamoxifen is with the dosed administration negative control group administration human IgG of 0.33mg/20g body weight/day.

Experimental technique and data analysis:

Every 3-4 days to tumor bearing nude mice measurement body weight and transplantation tumor volume.Calculate relative tumour volume and relative tumor proliferation rate with formula 2 with formula 4 respectively.To animals administer 18 days, drug withdrawal was put to death animal after 24 hours, peeled off tumor tissue and weighed, and calculated average tumor weight and inhibition rate of tumor growth with formula 4.

Experimental result:

After the administration 18 days, the gross tumor volume VT of testing group, relative volume RVT (seeing Figure 11) and relative tumor proliferation rate T/C% (seeing Figure 12) all are starkly lower than parallel negative control group level.Compare with negative control group, there were significant differences for the average weight of testing group and positive controls, and the p value is lower than 0.01 (seeing Figure 13).The inhibition rate of tumor growth of given the test agent group and positive controls is similar, all near 60% (seeing Figure 14).Three groups of tumor-bearing mice tumor tissue pathology check results (seeing Figure 15) show, the gross tumor volume of negative control group is significantly greater than the gross tumor volume of positive controls.The gross tumor volume of testing group is compared obviously less with negative control, with more approaching with the positive control of tamoxifen treatment.

Claims (66)

1. an antibody or its Fab, its bonded epitope is substantially the same in ScFv 1 (SEQ ID NO 3), ScFv 2 (SEQ ID NO 5), ScFv 3 (SEQ ID NO 7), ScFv 4 (SEQ ID NO 9), ScFv 5 (SEQ ID NO 11), ScFv 6 (SEQ ID NO 13) or ScFv 7 (SEQ ID NO 15) the bonded epi-position of specificity.

2. an antibody or its Fab, it contains one or more members that are selected from like next group: ScFv 1HCDR1; ScFv 2 HCDR1; ScFv 3 HCDR1; ScFv 4 HCDR1; ScFv 5 HCDR1; ScFv 6 HCDR1; ScFv 7 HCDR1; ScFv 1 HCDR2; ScFv 2 HCDR2; ScFv 3 HCDR2; ScFv 4 HCDR2; ScFv 5HCDR2; ScFv 6 HCDR2; ScFv 7 HCDR2; ScFv 1 HCDR3; ScFv 2 HCDR3; ScFv 3 HCDR3; ScFv 4 HCDR3; ScFv 5 HCDR3; ScFv 6 HCDR3; ScFv 7 HCDR3; ScFv 1 LCDR1; ScFv 2LCDR1; ScFv 3 LCDR1; ScFv 4 LCDR1; ScFv 5 LCDR1; ScFv 6 LCDR1; ScFv 7 LCDR1; ScFv 1 LCDR2; ScFv 2 LCDR2; ScFv 3 LCDR2; ScFv 4 LCDR2; ScFv 5 LCDR2; ScFv 6LCDR2; ScFv 7 LCDR2; ScFv 1 LCDR3; ScFv 2 LCDR3; ScFv 3 LCDR3; ScFv 4 LCDR3; ScFv 5 LCDR3; ScFv 6 LCDR3; With ScFv 7 LCDR3.

3. an antibody or its Fab, it contains one or more members that are selected from like next group:

A) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 1;

B) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 2;

C) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 3;

D) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 4; And

E) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 5;

F) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 6;

G) variable region of heavy chain that contains HCDR3, HCDR1 and/or the HCDR2 sequence of ScFv 7.

4. an antibody or its Fab, it contains one or more members that are selected from like next group:

A) LCDR1 who contains ScFv 1, LCDR2, and/or the variable region of light chain of LCDR3 sequence;

B) LCDR1 who contains ScFv 2, LCDR2, and/or the variable region of light chain of LCDR3 sequence;

C) LCDR1 who contains ScFv 3, LCDR2, and/or the variable region of light chain of LCDR3 sequence;

D) LCDR1 who contains ScFv 4, LCDR2, and/or the variable region of light chain of LCDR3 sequence;

E) LCDR1 who contains ScFv 5, LCDR2, and/or the variable region of light chain of LCDR3 sequence;

F) LCDR1 who contains ScFv 6, LCDR2, and/or the variable region of light chain of LCDR3 sequence; And

G) LCDR1 who contains ScFv 7, LCDR2, and/or the variable region of light chain of LCDR3 sequence.

5. an antibody or its Fab, it contains:

A) the arbitrary variable region of heavy chain in the claim 3; And

B) the arbitrary variable region of light chain in the claim 4.

6. an antibody or its Fab, it contains a variable region of heavy chain and contains:

A) a heavy chain CDR1 is selected from like next group: ScFv 1 HCDR1, ScFv 2 HCDR1, ScFv 3 HCDR1, ScFv 4 HCDR1, ScFv 5 HCDR1, ScFv 6 HCDR1, Sc Fv 7 HCDR1;

B) a heavy chain CDR2 is selected from like next group: ScFv 1 HCDR2, ScFv 2 HCDR2, ScFv 3 HCDR2, ScFv 4 HCDR2, ScFv 5 HCDR2, ScFv 6 HCDR2, Sc Fv 7 HCDR2; And

C) a heavy chain CDR3 is selected from like next group: ScFv 1 HCDR3, ScFv 2 HCDR3, ScFv 3 HCDR3, ScFv 4 HCDR3, ScFv 5 HCDR3, ScFv 6 HCDR3, Sc Fv 7 HCDR3;

7. an antibody or its Fab, it contains a variable region of light chain and contains:

A) a light chain CDR1 is selected from like next group: ScFv 1 LCDR1, ScFv 2 LCDR1, ScFv 3 LCDR1, ScFv 4 LCDR1, ScFv 5 LCDR1, ScFv 6 LCDR1, Sc Fv 7 LCDR1;

B) a light chain CDR2 is selected from like next group: ScFv 1 LCDR2, ScFv 2 LCDR2, ScFv 3 LCDR2, ScFv 4 LCDR2, ScFv 5 LCDR2, ScFv 6 LCDR2, Sc Fv 7 LCDR2; And

C) a light chain CDR3 is selected from like next group: ScFv 1 LCDR3, ScFv 2 LCDR3, ScFv 3 LCDR3, ScFv 4 LCDR3, ScFv 5 LCDR3, ScFv 6 LCDR3, Sc Fv 7 LCDR3.

8. an antibody or its Fab, it contains:

A) the arbitrary variable region of heavy chain in the claim 6; And

B) the arbitrary variable region of light chain in the claim 7.

9. an antibody or its Fab, it contains the monoamino-acid sequence and is selected from like next group: SEQ ID NO:17; SEQ ID NO:18; SEQ ID NO:19; SEQ ID NO:20; SEQ ID NO:21; SEQ ID NO:22; SEQ ID NO:23; SEQ ID NO:24; SEQ ID NO:25; SEQ ID NO:26; SEQ ID NO:27; SEQ ID NO:28; SEQ ID NO:32; SEQ ID NO:33; SEQ ID NO:34; SEQ ID NO:35; SEQ ID NO:36; SEQ ID NO:37; SEQ ID NO:38; SEQ ID NO:39; SEQ ID NO:40; SEQ ID NO:43; SEQ ID NO:44; SEQ ID NO:45; SEQ ID NO:46; SEQ ID NO:47; SEQ ID NO:48; SEQ ID NO:49; SEQ ID NO:52; SEQ ID NO:53; SEQ ID NO:54; SEQ ID NO:55; With SEQ ID NO:58.

10. an antibody or its Fab, it contains a variable region of heavy chain and is selected from like next group:

A) variable region of heavy chain that contains SEQ ID NO:20, SEQ ID NO:21 and/or SEQ ID NO:22;

B) variable region of heavy chain that contains SEQ ID NO:26, SEQ ID NO:27 and/or SEQ ID NO:28;

C) variable region of heavy chain that contains SEQ ID NO:32, SEQ ID NO:33 and/or SEQ ID NO:34;

D) variable region of heavy chain that contains SEQ ID NO:38, SEQ ID NO:39 and/or SEQ ID NO:40;

E) variable region of heavy chain that contains SEQ ID NO:44, SEQ ID NO:45 and/or SEQ ID NO:46;

F) variable region of heavy chain that contains SEQ ID NO:50, SEQ ID NO:51 and/or SEQ ID NO:52; And

G) variable region of heavy chain that contains SEQ ID NO:56, SEQ ID NO:57 and/or SEQ ID NO:58.

11. antibody according to claim 10 or its Fab, it contains a variable region of heavy chain and is selected from like next group:

A) contain the variable region of heavy chain of SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22;

B) contain the variable region of heavy chain of SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28;

C) contain the variable region of heavy chain of SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34;

D) contain the variable region of heavy chain of SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40;

E) contain the variable region of heavy chain of SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46;

F) contain the variable region of heavy chain of SEQ ID NO:50, SEQ ID NO:51 and SEQ ID NO:52; And

G) contain the variable region of heavy chain of SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58.

12. antibody according to claim 11 or its Fab, wherein said variable region of heavy chain are selected from like next group:

A) contain the variable region of heavy chain of SEQ ID NO:60;

B) contain the variable region of heavy chain of SEQ ID NO:62;

C) contain the variable region of heavy chain of SEQ ID NO:64;

D) contain the variable region of heavy chain of SEQ ID NO:66;

E) contain the variable region of heavy chain of SEQ ID NO:68;

F) contain the variable region of heavy chain of SEQ ID NO:70; And

G) contain the variable region of heavy chain of SEQ ID NO:72.

13. according to the described antibody of claim 10-12 or its Fab, it further contains a variable region of light chain and is selected from like next group:

A) variable region of light chain that contains SEQ ID NO:17, SEQ ID NO:18 and/or SEQ ID NO:19;

B) variable region of light chain that contains SEQ ID NO:23, SEQ ID NO:24 and/or SEQ ID NO:25;

C) variable region of light chain that contains SEQ ID NO:29, SEQ ID NO:30 and/or SEQ ID NO:31;

D) variable region of light chain that contains SEQ ID NO:35, SEQ ID NO:36 and/or SEQ ID NO:37;

E) variable region of light chain that contains SEQ ID NO:41, SEQ ID NO:42 and/or SEQ ID NO:43;

F) variable region of light chain that contains SEQ ID NO:47, SEQ ID NO:48 and/or SEQ ID NO:49; And

G) variable region of light chain that contains SEQ ID NO:53, SEQ ID NO:54 and/or SEQ ID NO:55.

14. antibody according to claim 13 or its Fab, it contains a variable region of light chain and is selected from like next group:

A) contain the variable region of light chain of SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19;

B) contain the variable region of light chain of SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO:25;

C) contain the variable region of light chain of SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:31;

D) contain the variable region of light chain of SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37;

E) contain the variable region of light chain of SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43;

F) contain the variable region of light chain of SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49; And

G) contain the variable region of light chain of SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.

15. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19; And said variable region of heavy chain contains SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22.

16. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO:25; And said variable region of heavy chain contains SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28.

17. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:31; And said variable region of heavy chain contains SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34.

18. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37; And said variable region of heavy chain contains SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40.

19. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQID NO:41, SEQ ID NO:42 and SEQ ID NO:43; And said variable region of heavy chain contains SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46.

20. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49; And said variable region of heavy chain contains SEQ ID NO:50, SEQ ID NO:51 and SEQ ID NO:52.

21. antibody according to claim 14 or its Fab, wherein said variable region of light chain contain SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55; And said variable region of heavy chain contains SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58.

22. antibody according to claim 14 or its Fab, wherein said variable region of light chain are selected from like next group:

A) said variable region of light chain contains SEQ ID NO:59,

B) said variable region of light chain contains SEQ ID NO:61,

C) said variable region of light chain contains SEQ ID NO:63,

D) said variable region of light chain contains SEQ ID NO:65,

E) said variable region of light chain contains SEQ ID NO:67,

F) said variable region of light chain contains SEQ ID NO:69, and

G) said variable region of light chain contains SEQ ID NO:71.

23. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:59 and said variable region of heavy chain contains SEQ ID NO:60.

24. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:61 and said variable region of heavy chain contains SEQ ID NO:62.

25. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:63 and said variable region of heavy chain contains SEQ ID NO:64.

26. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:65 and said variable region of heavy chain contains SEQ ID NO:66.

27. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:67 and said variable region of heavy chain contains SEQ ID NO:68.

28. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:69 and said variable region of heavy chain contains SEQ ID NO:70.

29. antibody according to claim 22 or its Fab, wherein said variable region of light chain contain SEQ ID NO:71 and said variable region of heavy chain contains SEQ ID NO:72.

30. an antibody or its Fab, it contains a variable region of heavy chain and contains:

A) a heavy chain CDR1 is selected from like next group: SED ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38 and SEQ ID NO:44;

B) a heavy chain CDR2 is selected from like next group: SED ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39 and SEQ ID NO:45; And

C) a heavy chain CDR3 is selected from like next group: SED ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52 and SEQ ID NO:58.

31. antibody according to claim 30 or its Fab, wherein said variable region of heavy chain are selected from like next group:

A) contain the variable region of heavy chain of SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22;

B) contain the variable region of heavy chain of SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28;

C) contain the variable region of heavy chain of SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34;

D) contain the variable region of heavy chain of SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40;

E) contain the variable region of heavy chain of SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46;

F) contain the variable region of heavy chain of SEQ ID NO:50, SEQ ID NO:51 and SEQ ID NO:52; And

G) contain the variable region of heavy chain of SEQ ID NO:56, SEQ ID NO:57 and SEQ ID NO:58.

32. antibody according to claim 31 or its Fab, wherein said variable region of heavy chain are selected from like next group:

A) contain the variable region of heavy chain of SEQ ID NO:60;

B) contain the variable region of heavy chain of SEQ ID NO:62;

C) contain the variable region of heavy chain of SEQ ID NO:64;

D) contain the variable region of heavy chain of SEQ ID NO:66;

E) contain the variable region of heavy chain of SEQ ID NO:68;

F) contain the variable region of heavy chain of SEQ ID NO:70; And

G) contain the variable region of heavy chain of SEQ ID NO:72.

33. according to the described antibody of claim 30-32 or its Fab, it further contains a variable region of light chain and contains:

A) variable region of light chain is selected from like next group: SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:47 and SEQ ID NO:53;

B) variable region of light chain is selected from like next group: SEQ ID NO:18, SEQ ID NO:24, SEQ ID NO:36, SEQ ID NO:48 and SEQ ID NO:54;

C) variable region of light chain is selected from like next group: SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49 and SEQ ID NO:55.

34. antibody according to claim 33 or its Fab, wherein said variable region of light chain are selected from next group:

A) contain the variable region of light chain of SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19;

B) contain the variable region of light chain of SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO:25;

C) contain the variable region of light chain of SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:31;

D) contain the variable region of light chain of SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37;

E) contain the variable region of light chain of SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43;

F) contain the variable region of light chain of SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49; And

G) contain the variable region of light chain of SEQ ID NO:53, SEQ ID NO:54 and SEQ ID NO:55.

35. antibody according to claim 34 or its Fab, wherein said variable region of light chain are selected from next group:

A) contain the variable region of light chain of SEQ ID NO:59;

B) contain the variable region of light chain of SEQ ID NO:61;

C) contain the variable region of light chain of SEQ ID NO:63;

D) contain the variable region of light chain of SEQ ID NO:65;

E) contain the variable region of light chain of SEQ ID NO:67;

F) contain the variable region of light chain of SEQ ID NO:69; And

G) contain the variable region of light chain of SEQ ID NO:71.

36. according to the arbitrary described antibody of claim 1-35 or its Fab, wherein said antibody or its Fab are monoclonal antibody, polyclonal antibody, bi-specific antibody, chimeric antibody, humanized antibody, recombinant antibodies, people's antibody, traget antibody, bivalent antibody or anti-idiotype antibody.

37. according to the arbitrary described antibody of claim 1-35 or its Fab, wherein said antibody or its Fab are single domain antibody (camelized single domain antibody), bifunctional antibody (diabody), scFv, scFv dimer, BsFv, dsFv, (dsFv) of camelization ₂, dsFv-dsFv ', Fv fragment, Fab, Fab ', a F (ab ') ₂, ds bifunctional antibody (ds diabody), nano antibody, domain antibodies or two valency domain antibodies.

38., wherein further contain constant region for immunoglobulin according to the arbitrary described antibody of claim 1-35 or its Fab.

39. according to the described antibody of claim 38 or its Fab, wherein said constant region for immunoglobulin is lambda light chain, κ light chain, γ 1 heavy chain, γ 2 heavy chains, γ 3 heavy chains or γ 4 CH.

40. a complex that contains just like the arbitrary described antibody of claim 1-39 or its Fab, this complex can combine with hER-α 36 shown in the SEQ ID NO:1 or the fragment of hER-α 36.

41. a separated polypeptide, it contains one or more aminoacid sequences like arbitrary described antibody or its Fab among the claim 1-39.

42. separated polynucleotide, the described polypeptide of its coding claim 41.

43. a separated carrier, it contains the described polynucleotide of claim 42.

44. a separated host cell, it contains the described carrier of claim 43.

45. an express polypeptide method, said polypeptide contains the aminoacid sequence in one or more claim 41, and said method is included in the separated host cell of cultivating under the condition that the polynucleotide in the claim 42 can be expressed in the claim 44.

46. a pharmaceutical composition, it contains just like the arbitrary described antibody of claim 1-39 or its Fab and one or more acceptable for pharmaceutical supporting agents.

47. according to the described pharmaceutical composition of claim 46, wherein said one or more acceptable for pharmaceutical supporting agents are selected from following one group: acceptable for pharmaceutical liquid, gel, solid carriers, aqueous media, non-aqueous phase medium, antimicrobial material, etc. ooze material, buffer, antioxidant, anesthetis, suspending agent/dispersant, chelating agen, diluent, adjuvant, adjuvant or nontoxic auxiliary substance.

48. a pharmaceutical composition that contains just like the arbitrary described antibody of claim 1-39 or its Fab, wherein said antibody or its Fab link to each other with one or more chemotherapy materials or make up.

49. contain the pharmaceutical composition of antibody as claimed in claim 48 or its Fab; Wherein said one or more chemotherapy materials are selected from following one group: amrubicin, atrasentan; Calcitriol; Cilengitide; Dasatinib; Moral card Brittany (decatanib); Yi Duotekalin (edotecarin); Grace is pricked appropriate woods (enzastaurin); Hydrochloric acid Erlotinib sheet; Everolimus; Gefitinib; Gossypol she in monoclonal antibody (gossypol ipilimumab); Luo Nafani (lonafarnib); Lucanthone; Niu Laidi (neuradiab); Nola Qu Te; Ao Limosen (oblimersen); Ou Fatumu monoclonal antibody (ofatumumab); Ou Gewo monoclonal antibody (oregovomab); Handkerchief Buddhist nun monoclonal antibody; Pa Zuo dissolves Buddhist nun (pazopanibrubitecan); Talampanel; Te Musiluoli (temsirolimus); Te Simili (tesmilifene); Tetrandrine; Carry James Slim monoclonal antibody (ticilimumab); Te La doubly specific (trabectedin); ZD6474; Wei Tesipan (vitespan); Zha Nuolimu monoclonal antibody (zanolimumab); Azoles logical sequence diphosphate; Histrelin; Azacitidine; Dexrazoxane; Alemtuzumab; Lenalidomide; Gemtuzumab; Ketoconazole; Chlormethine; Ibritumomab tiuxetan; Decitabine; Hexamethylmelamine; Bexarotene; Tositumomab; Arsenic trioxide; She is ground Tuo Naite (editronate); Ciclosporin; The Edwina-asparaginase; And strontium 89.

50. a pharmaceutical composition that contains just like the arbitrary described antibody of claim 1-39 or its Fab, wherein said antibody or its Fab and the combination of one or more therapeutants.

51. pharmaceutical composition as claimed in claim 50; Wherein one or more therapeutants are selected from following one group: Herba Epimedii, tamoxifen, 17 β-estrogen; ICI 182; 780; U.S. Patent application 11/877; Disclosed chemical compound, U.S. Patent application 60/046 in 575; Disclosed chemical compound, cytokine, VEGF antibody are (for example in 255; Bevacizumab or A Wasiting), Anti-HER 2 (for example: Trastuzumab or Herceptin); And anti-egfr antibodies, tyrosine acceptor inhibitor (for example Gapatinib, Lapatinib).

52. pharmaceutical composition as claimed in claim 50, wherein one or more therapeutants are selected from following one group: lymphocyte factor; Monokine; The human growth hormone; Bovine growth hormone; Parathyroid hormone; Thyroxine; Insulin; Proinsulin; Relaxin; Relaxin is former; Follicule-stimulating hormone (FSH); Thyrotropin; Lutropin; Liver growth factor; Fibre protogrowth factor; Prolactin antagonist; Human placental lactogen; Tumor necrosis factor; Miu Le (family name) manages inhibiting substances; Mice promoting sexual gland hormone related peptides; Inhibin; Activin; Integrin; Thrombopoietin; Nerve growth factor; Like NGF-β; PDGF; Transforming growth factor such as TGF-α and TGF-β; Insulin-like growth factor I and II; Erythropoietin; Osteogenic factor; Interferon; As: interferon-' alpha ';-β; With-γ; Colony stimulating factor, like macrophage-CSF, granular leukocyte macrophage CSF and granulocyte-CSF, interleukin, like IL-1, IL-1 α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 and IL-12, tumor necrosis factor; As: TNF-α and TNF-β, and other polypeptide factors.

53. a pharmaceutical composition that contains just like the arbitrary described antibody of claim 1-39 or its Fab, wherein said antibody or its Fab link to each other with one or more conjugates.

54. compositions as claimed in claim 53, wherein said conjugate are selected from following one group: be selected from following radiosiotope: ¹²³I, ¹²⁴I, ¹²⁵I, ¹³¹I, ³⁵S, ³H, ¹¹¹In, ¹¹²In, ¹⁴C, ⁶⁴Cu, ⁶⁷Cu, ⁸⁶Y, ⁸⁸Y, ⁹⁰Y, ¹⁷⁷Lu, ²¹¹At, ¹⁸⁶Re, ¹⁸⁸Re, ¹⁵³Sm, ²¹²Bi with ³²P; Lanthanide series, chemiluminescent labels, be selected from fluorescent marker: fluorescein, rhodamine, red yellow acyl (dansyl), rhodophyll or Texas red (Texas Red), and enzyme-substrate label for example horseradish peroxidase, alkali phosphatase or beta-D-galactosidase like next group.

55. regulation and control ER-α 36 active methods in cell, said method comprises the cells contacting like the arbitrary described antibody of claim 1-35 and its Fab and expression ER-α 36.

56. one kind is detected the method that ER-α 36 exists in sample, said method comprises and will contact and detect the existence of ER-α 36 with sample like the arbitrary described antibody of claim 1-35 and its Fab.

57. the method for the state that treatment or prevention and ER-α 36 are relevant in object; Said method comprises the pharmaceutical composition that said object is used treatment valid density, and said pharmaceutical composition contains just like the arbitrary described antibody of claim 1-35 or its Fab.

58. according to the described method of claim 57, wherein said state is selected from following one group: bone loss; Fracture; Osteoporosis; Metastatic bone lesions; Handkerchief Zhe Shi is sick; Periodontal disease; Cartilage degeneration; Endometriosis; Hysteromyoma; Hot flush; The LDL cholesterol levels raises; Cardiovascular disease; The cognitive function damage; The brain degenerative disease; Postoperative restenosis; Gynecomasty; The pipeline smooth muscle cell proliferation; Fat; Incontinence; Anxiety; The depression that estrogen receptor causes; Menopausal depression; Postpartum depression; Premenstrual syndrome; Manic depression; Anxiety; Dull-witted; Obsession; Attention deficit disorder; Sleep disorder; Excitation; Impulsion; Immune deficiency; Autoimmune disease; The indignation management; Multiple sclerosis and parkinson (family name) disease; Inflammation; Inflammatory conditions; Inflammatory bowel; Respiratory system disease; Sexual dysfunction; Hypertension; Retinal degeneration; Asthma and cancer state.

59. according to the described method of claim 57, wherein said state comprises depression, menopausal depression, postpartum depression, immune deficiency, autoimmune disease, inflammation, inflammatory conditions, asthma and the cancer state that bone loss, fracture, osteoporosis, menopause, premenstrual syndrome, endometriosis, hysteropathy, sexual impotence, sexual dysfunction, the rising of LDL cholesterol levels, cardiovascular disease, pipeline smooth muscle proliferation, estrogen receptor cause.

60. according to the described method of claim 59, wherein said state is selected from following one group: bone loss, endometriosis, sexual impotence, cardiovascular disease, atherosclerosis, immune deficiency, inflammation, inflammatory conditions, asthma and cancer state.

61. according to the described method of claim 59, wherein said inflammatory conditions is selected from following one group: rheumatoid arthritis, Corii Bovis seu Bubali moss, scleroderma, chronic obstructive pulmonary disease, and asthma.

62. according to the described method of claim 59, wherein said cancer state is selected from following one group: the malignant tumor of malignant tumor, blastoma, sarcoma, germinoma or blood or lymph, for example: leukemia, lymphoma or boniness myeloma.More specifically; Can use the cancer state and the tumor kind of the treatment of antibody provided by the invention or its Fab to include but not limited to; Squamous cell carcinoma; Pulmonary carcinoma (as; Small cell lung cancer; Nonsmall-cell lung cancer (NSCLC); Pulmonary's adenocarcinoma; Or pulmonary's squamous cell carcinoma); Peritoneal cancer; Hepatocarcinoma (like hepatoma); Gastric cancer (like human primary gastrointestinal cancers); Cancer of pancreas; The brain cancer (as; Glioblast cerebroma/glioblastoma multiforme (GBM); Non-glioblast cerebroma; Or meningioma); Glioma (as; Ependymoma; Astrocytoma; Between the modification astrocytoma; Oligodendroglioma; Or mixed type glioma such as spider cell mixed tumor); Cervical cancer; Uterus carcinoma; Hepatocarcinoma (as; Hepatoblastoma; Hepatoma or hepatocarcinoma); Bladder cancer (as; The urothelium cancer); Breast carcinoma; Colon cancer; Intestinal cancer; Rectal cancer; Endometrium or cervical cancer; Salivary gland carcinoma; Renal carcinoma (as: kidney striped muscle appearance tumor); Carcinoma of prostate; Carcinoma vulvae; Carcinoma of penis; Anus cancer (as; Squamous cell Carcinoma of Anal Canal); Thyroid carcinoma; The incidence cancer (as; Nasopharyngeal carcinoma); Skin carcinoma (as; Melanotic cancer or squamous cell carcinoma); Osteosarcoma; Ewing's sarcoma; Chondrosarcoma; Soft tissue sarcoma (as; Rhabdomyosarcoma; Fibrosarcoma; Kaposi sarcoma); Carcinoid; Cancer eye (as: retinoblastoma); Mesothelioma; Lymphocytic leukemia (as; The acute lymphoblastic leukemia of T cell and B cell precursor pedigree (ALL); Chronic lymphocytic leukemia (CLL); Acute myeloid leukemia (AML); Comprise mast cell leukemia; Chronic granulocytic leukemia (CML); Hairy cell leukemia (HCL); Hodgkin lymphoma; Non-Hodgkin lymphoma; Chronic myelomonocytic leukemia (CMML); Follicular lymphoma (FL); Diffuse large B cell lymphoma (DLCL); Lymphoma mantle cell (MCL); Lymphoma (BL); Cutaneous T cell lymphoma; The Sezary syndrome; Cutaneous T cell lymphoma; Mastocytoma; Medulloblastoma; Nephroblastoma; Solitary plasmacytoma; Myelodysplastic syndrome; Chronic and non-chronic myeloproliferative disorder; Central nervous system's tumor; The hypophysis cerebri tumor; Vestibular nerve sheath tumor; Neuroectodermal tumors; Ependymoma; Papilloma of choroid plexus; Polycythemia vera; Thrombocytosis; Primary myelofibrosis; And child's cancer; As, children's's sarcoma (as: neuroblastoma; Rhabdomyosarcoma and osteosarcoma).

63. according to the described method of claim 57; Wherein said pharmaceutical composition is through injection administration; Comprise subcutaneous injection, lumbar injection, intravenous injection, intramuscular injection or intradermal injection; Or non-injection administration, comprise percutaneous drug delivery, oral administration, nasal-cavity administration, eye drops, sublingual administration, rectally or topical administration.

64. according to the described method of claim 57, wherein said treatment effective dose arrives about 100mg/kg for about 0.01mg/kg.

65. according to the described method of claim 64, wherein said treatment effective dose is selected from following one group: about 0.01mg/kg, about 0.5mg/kg; About 1mg/kg, about 2mg/kg, about 5mg/kg; About 10mg/kg, about 15mg/kg, about 20mg/kg; About 25mg/kg, about 30mg/kg, about 35mg/kg; About 40mg/kg, about 45mg/kg, about 50mg/kg; About 55mg/kg; About 60mg/kg, about 65mg/kg, about 70mg/kg; About 75mg/kg; About 80mg/kg, about 85mg/kg, about 90mg/kg; About 95mg/kg, and about 100mg/kg.

66. with the method for the situation of ER-α 36 correlation behaviors, said method comprises to be used as the level of the described antibody of claim 1-35 or its Fab mensuration ER-α 36 in the definite object.

Images