CN102250229B - Soybean OFP transcription factor, and encoding gene and application thereof - Google Patents
Soybean OFP transcription factor, and encoding gene and application thereof Download PDFInfo
- Publication number
- CN102250229B CN102250229B CN 201110181600 CN201110181600A CN102250229B CN 102250229 B CN102250229 B CN 102250229B CN 201110181600 CN201110181600 CN 201110181600 CN 201110181600 A CN201110181600 A CN 201110181600A CN 102250229 B CN102250229 B CN 102250229B
- Authority
- CN
- China
- Prior art keywords
- gmofp1
- soybean
- ofp
- transcription factor
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of biotechnology and discloses a soybean OFP transcription factor, and an encoding gene and application thereof. The soybean OFP transcription factor is named GmOFP1 and has protein in an amino acid sequence shown as SEQ ID NO.2 in a sequence table. The gene for encoding the GmOFP1 has the sequence shown as SEQ ID NO.1. The soybean OFP transcription factor and the encoding gene thereof can be used in the aspects such as plant flower organ transformation and the like; and the gene is specifically expressed in flower organs. Compared with wild tobacco, transgenic tobacco with overexpressed GmOFP1 has the advantage that petal organs have homeotic mutation character. The GmOFP1 can control the specialization and development of petals in four flower organs of plants.
Description
Technical field
The invention belongs to plant genetic engineering field, relate to a kind of soybean OFP transcription factor and encoding gene thereof and application, be specifically related to derive from the OFP class transcription factor GmOFP1 relevant with development of floral organs and encoding gene and its application in changing the plant flower organ transformation of soybean.
Background technology
Generally can be divided into vegetative growth phase (V phase) and reproductive stage (R phase) life history of higher plant.Bloom is by excessive important symbol to the R phase of V phase.Floral organ is critical function organ and the obvious characteristic in the plant reproductive process, and whether whether floral organ complete or can educate and will directly affect formation and quality, offspring's procreation, Population Diffusion and the agriculture production of fruit and the seed of plant.The growth of flower is the important symbol that plant reproductive begins vegetative period.The plant complete floral organ of rear formation of must guaranteeing to bloom could successfully realize being fertilized and the formation of seed, finishes the offspring and breeds.
Flowering of plant can be divided into Flowering determination (flowering determination) or floral induction, the sequential processes such as formation of Flower evocation (flower evocation) and floral organ, this process are subject to external environment and induce strict control with the native gene network.The Flowering determination process is mainly carried out floral genes and is started and the follow-up network regulation of blooming, it is the basis that Flower evocation and floral organ form, plant enters the reproductive growth after date, the nutrition meristematic tissue successively forms inflorescence meristem, floral meristem, the former base of floral organ etc. and finally is divided into various floral organs, forms a complete flower.
Found that at present many gene families and development of floral organs regulation and control are closely related, OFP class transcription factor is the peculiar transcription factor of newfound plant in recent years, and in Arabidopis thaliana, the AtOFP1 gene participates in the merismatic regulation and control of growing such as mediation floral organ.
Summary of the invention
The purpose of this invention is to provide a kind of soybean OFP transcription factor.
Another object of the present invention provides the gene of this soybean OFP transcription factor of coding.
Another purpose of the present invention provides the application of this transcription factor.
Purpose of the present invention is achieved through the following technical solutions:
A kind of soybean OFP transcription factor GmOFP1 has the described aminoacid sequence of SEQ ID NO.2.
The gene GmOFP1 of described soybean OFP transcription factor GmOFP1 encodes.
The open reading frame of this gene has the dna sequence dna shown in the SEQ ID NO.1.
The expression vector that contains described soybean OFP transcription factor gene GmOFP1.
Described expression vector preferably utilizes the soybean OFP transcription factor gene GmOFP1 open reading frame shown in the SEQ ID NO.1 gateway technology to insert the plant Overexpression vector pMDC83-GmOFP1 that plant expression vector pMDC83 obtains.
When using GmOFP1 to make up plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter.For the ease of transgenic plant cells or plant being identified and screening, can process used plant expression vector, as adding the selected marker's (gus gene, GFP gene etc.) that in plant, to express or the resistant gene of antibiotic marker thing (gentamicin marker, kantlex marker, Totomycin marker etc.).From the security consideration of transgenic plant, can not add any selected marker, directly with phenotypic character screening transformed plant.
The engineering bacteria that contains described soybean OFP transcription factor gene GmOFP1.
Described engineering bacteria preferably changes described GmOFP1 gene over to agrobacterium tumefaciens EHA105 gained.
The primer of amplification soybean OFP transcription factor gene GmOFP1 open reading frame, forward primer and reverse primer sequence are as follows:
Forward primer sequence: 5 ' ATGAAAGGGAAAGCATTGGGTGT3 ' (SEQ ID NO.3);
Reverse primer sequence: 5 ' TCACTTGGAACTGTCACCTTCCTCACTA3 ' (SEQ ID NO.4).
The application of described soybean OFP transcription factor GmOFP1 in plant flower organ is transformed.
The application of described soybean OFP transcription factor gene GmOFP1 in plant flower organ is transformed.
Carry GmOFP1 of the present invention plant expression vector can Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity be led, conventional biological method transformed plant cells or the tissue such as agriculture bacillus mediated by using, and the plant tissue that transforms is cultivated into plant.The plant host that is converted both can be the monocotyledonss such as paddy rice, wheat, corn, also can be the dicotyledonss such as tobacco, soybean, cucumber, tomato, willow, turfgrass, clover.
Beneficial effect
Soybean OFP transcription factor gene GmOFP1 provided by the invention mainly expresses in floral organ.This transcription factor may participate in the merismatic developmental regulations such as floral organ of soybean.The GmOFP1 transgene tobacco is compared with wild-type tobacco, petal homeotic mutation phenomenon occurred.The result shows that GmOFP1 can affect the petal formation of plant.This gene of overexpression can change the plant petals organ, and this can solve the low difficult problem of self-pollinated plant natural outcrossing, realizes heterotic effective utilization, accelerates the breeding paces.
Soybean OFP transcription factor of the present invention and encoding gene thereof are to the plant flower organ transformation, and it is significant particularly to cultivate the cross-pollination soybean, are with a wide range of applications aspect crop breeding.
Description of drawings
The present invention will be further described below in conjunction with drawings and Examples.
Fig. 1 is the tissue expression figure of GmOFP1 in soybean.
Fig. 2 is the part-structure synoptic diagram that contains the plant Overexpression vector of GmOFP1.
Fig. 3 is that the PCR of transgene tobacco identifies.
A. utilize ORF forward primer (SEQ ID NO.3) and reverse primer (the SEQ ID NO.4) combination of GmOFP1 gene that transgenic tobacco plant is detected; B. utilize the combination of 35S promoter upstream primer (SEQ ID NO.10) and ORF reverse primer (SEQ ID NO.4) that transgenic tobacco plant is detected.M is that molecular weight is the DNA marker (Takara) of DL2000; 1-7 is the different GmOFP1 gene strains that turn; WT and H
2O is respectively wild-type tobacco and sterilized water (negative control).
Fig. 4 is that the qRT-PCR of transgene tobacco identifies.
WT is wild-type tobacco (negative control); 1-7 is different transgenic line.
Fig. 5 is that floral aberrance appears in the 35S::GmOFP1 transgene tobacco.
A is the petal of the normal development of wild-type tobacco, contains 5 shallow corolla eaves that split; G is the coniform cyme of the normal development of wild-type tobacco.B-H (except G) is the petal heteroplasia of 35S::GmOFP1 transgene tobacco, the homeotic mutation phenomenon occurs.
Embodiment
Employed term unless other explanation is arranged, has the implication that those of ordinary skills understand usually in the present invention.
Below in conjunction with concrete Preparation Example and Application Example, and comparable data is described the present invention in further detail.Should be understood that these embodiment just in order to demonstrate the invention, but not limit the scope of the invention by any way.
In following embodiment, various processes and the method do not described in detail are ordinary methods as known in the art.Used primer is all indicated when occurring first, and used same primers as is all identical with the content of indicating first thereafter.
The cloning and identification of embodiment 1 soybean GmOFP1 and encoding gene thereof
Experiment material is the cultivated soybean kind " Nan Nong 86-4 ", is provided by research of fruit germplasm resource chamber, Agricultural University Of Nanjing country modified soybeans center.Sequence information and soybean gene group database (http://www.phytozome.net/soybean) with reference to Arabidopis thaliana OFP gene (accession number in the GeneBank database is AT2G30395), utilize the method for information biology to analyze, the design primer, carry out soybean OFP gene cloning, unnamed gene is GmOFP1.Concrete grammar is as follows:
Get the flower of soybean, place liquid nitrogen to grind, adopt plant total RNA extraction reagent box (TIANGEN DP404) to carry out total RNA and extract.Get the total RNA of 5 μ g and carry out reverse transcription with reverse transcription test kit (TOYOBO company) by the method for test kit, take the cDNA fragment that obtains as template, utilize the primer of the amplification GmOFP1 open reading frame shown in SEQ ID NO.3 and the SEQ ID NO.4 to carry out the PCR reaction.50 μ l PCR reaction systems are: 2 μ lcDNA (0.05 μ g), forward, each 2 μ l (10 μ M) of reverse primer (SEQ ID NO.3 and SEQ ID NO.4), 5 μ l, 10 * PCR damping fluid, 1 μ l dNTP (10mM) and 2U Taq archaeal dna polymerase, supply 50 μ l with ultrapure water.Reaction is carried out at Bio-RAD PTC200 type PCR instrument, and its program is 95 ℃ of denaturation 5min; 94 ℃ of sex change 40s, 58 ℃ of annealing 40s, 72 ℃ are extended 40s, totally 35 circulations; Then 72 ℃ are extended 10min, 4 ℃ of preservations.The PCR product carries out sequential analysis after reclaiming, checking order, the result shows that the open reading frame of this GmOFP1 has the nucleotide sequence of SEQ ID NO.1 in the sequence table, and total length is 558bp, 185 amino acid shown in the coding SEQ ID NO.2.
The expression characteristic of embodiment 2GmOFP1 in soybean different tissues organ
Utilize Real-Time Fluorescent Quantitative PCR Technique, the expression of GmOFP1 in each organ of soybean is studied.The soybean experiment material is seeded in Agricultural University Of Nanjing solarium, conventional field management mid-June.Get root, stem, leaf and Sheng flower when the 3rd compound leaf launches, after containing flower and taking off under aseptic condition rapidly separation respectively take turns floral organ: calyx, petal, stamen and gynoecium, respectively behind the liquid nitrogen flash freezer-80 ℃ save backup.
The extraction of total RNA is with embodiment 1.Take the cDNA of soybean different tissues or organ as template, carry out the real-time fluorescence quantitative PCR analysis.PCR adopts SYBR Green Real-time PCR Master Mix QPK201 (TOYOBO) dye method, its reaction system be 20 μ l:SYBRMIX, 10 μ l, cDNA (0.02 μ g) 0.8 μ l, forward, oppositely and each 0.5 μ l (10 μ M) of probe primer (SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7), ultrapure water complement to 20 μ l.Reaction is carried out at ABI 7500 (ABI7500Real-time PCR System) type PCR instrument, and response procedures is 95 ℃ of denaturation 10min; 95 ℃ of sex change 20s, 60s, totally 40 circulations are extended in 60 ℃ of annealing.GmOFP1-qPCR forward primer sequence: 5 ' AATGTGCATGAAACTCCGTTCTT 3 ' (SEQ ID NO.5) wherein, GmOFP1-qPCR reverse primer sequence: 5 ' GCCCCGTGAGCCATCAC 3 ' (SEQ ID NO.6), GmOFP1-qPCR probe primer sequence: 5 ' CCTTCGCCACTTACCCCGGCTTG 3 ' (SEQ ID NO.7).Take soybean constitutive expression gene Tubulin (the GenBank number of logging in as: AY907703) as reference gene, its amplimer is: Tubulin forward primer sequence: 5 ' GGAGTTCACAGAGGCAGAG 3 ' (SEQ ID NO.8), Tubulin reverse primer sequence: 5 ' CACTTACGCATCACATAGCA 3 ' (SEQ ID NO.9).
Result (Fig. 1) the analysis showed that, GmOFP1 expression amount in root, stem and leaf is very low or do not express.In the four-wheel floral organ, GmOFP1 expresses in petal, gynoecium and stamen, and expression amount is higher in the petal.
The Function Identification of embodiment 3GmOFP1 transcription factor
Utilize Invitrogen company
Technology with Clonase
TMThe II test kit is with GmOFP1 recombinate plant expression vector pMDC83 (Curtis et al, 2003, Plant Physiology.133,462-469), transform bacillus coli DH 5 alpha, conversion fluid is coated screening positive clone on the LB solid medium that contains the 50mg/L Totomycin.After sequence verification, extract plasmid, obtain pMDC83-GmOFP1 plant Overexpression vector (Fig. 2), with freeze-thaw method (Dityatkin, S.Ya., Lisovskaya, K.V., Panzhava, N.N., Iliashenko, B.N.:Frozen-thawed bacteria as recipients of isolated coliphage DNA.Biochim.biophys.Acta, 1972 (281) 319-323.) pMDC83-GmOFP1 is changed among the agrobacterium tumefaciens bacterial strain EHA105 (Biovector Co., LTD).With the mediated transformation tobacco of pMDC83-GmOFP1 by Agrobacterium strain EHA105, to cultivate at the MS substratum that contains the 50mg/L Totomycin, preliminary screening obtains having the transfer-gen plant of hygromycin resistance.
Extract the genomic dna that preliminary screening obtains having the transgene tobacco of hygromycin resistance, use gene specific ORF reverse primer SEQ ID NO.4 to be combined into performing PCR with forward primer SEQ ID NO.3 and 35S promoter upstream primer SEQ ID NO.10 respectively and identify.The pcr amplification reaction system is 25 μ L, comprising 10 * Taq damping fluid, 2 μ L, and soy bean DNA 1 μ L, Taq polysaccharase 0.5 μ L, dNTPs (10mM) 0.5 μ L, MgCl
2(25mM) 1.2 μ L, forward, reverse and each 1 μ L (10 μ M) of 35S promoter upstream primer (SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.10) add at last ultrapure water and mend to 25 μ L.Its response procedures is: 95 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 58 ℃ of annealing 50s, 72 ℃ are extended 50s, totally 35 circulations, 72 ℃ of constant temperature 10min then, 4 ℃ of preservations.Can amplify respectively the positive transgene tobacco that is about 558bp and 958bp size strip with two pairs of primers, the negative plant (Fig. 3) of can not increasing and being about 558bp and 958bp size strip.Select PCR to be accredited as positive plant, identify take transgene tobacco qPCR and use forward primer (SEQID NO.5), reverse primer (SEQ ID NO.6) and probe primer (SEQ ID NO.7) as primer, carry out qRT-PCR and detect.The result shows that GmOFP1 can express (Fig. 4) in transgene tobacco.PCR, qRT-PCR are detected all positive transfer-gen plant called after 35S::GmOFP1 transgene tobacco.
The 35S::GmOFP1 transgene tobacco is carried out Phenotypic Observation.Under 25 ℃, the growth conditions of long day, compare with wild-type tobacco, the floral organ homeotic mutation proterties (Fig. 5) such as petal cracking, petal inwardly fold, the increase of corolla eaves number have appearred in the 35S::GmOFP1 transgene tobacco, illustrate that the heterogenous expression of GmOFP1 can affect the normal development of petal in the floral organ.
Claims (10)
1. a soybean OFP transcription factor GmOFP1 is characterized in that aminoacid sequence is shown in SEQ ID NO.2.
2. the encode gene of soybean OFP transcription factor GmOFP1 claimed in claim 1.
3. the gene of soybean OFP transcription factor GmOFP1 according to claim 2 is characterized in that the dna sequence dna of open reading frame of this gene is shown in SEQ ID NO.1.
4. the expression vector that contains the gene of claim 2 or 3 described soybean OFP transcription factor GmOFP1.
5. expression vector according to claim 4 is characterized in that described expression vector is with the soybean OFP transcription factor gene shown in the SEQ ID NO.1
GmOFP1Open reading frame utilizes the gateway technology to insert the plant Overexpression vector pMDC83-GmOFP1 that plant expression vector pMDC83 obtains.
6. the engineering bacteria that contains claim 2 or 3 described genes.
7. engineering bacteria according to claim 6 is characterized in that described engineering bacteria is that gene with described soybean OFP transcription factor GmOFP1 changes agrobacterium tumefaciens EHA105 gained over to.
8. the primer of the gene open reading frame of amplification soybean OFP transcription factor GmOFP1 is characterized in that the forward primer sequence is SEQ ID NO.3, and the reverse primer sequence is SEQ ID NO.4.
9. the application of OFP class transcription factor GmOFP1 claimed in claim 1 in plant flower organ is transformed.
10. the application of the gene of claim 2 or 3 described soybean OFP transcription factor GmOFP1 in plant flower organ is transformed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110181600 CN102250229B (en) | 2011-06-30 | 2011-06-30 | Soybean OFP transcription factor, and encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110181600 CN102250229B (en) | 2011-06-30 | 2011-06-30 | Soybean OFP transcription factor, and encoding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102250229A CN102250229A (en) | 2011-11-23 |
| CN102250229B true CN102250229B (en) | 2013-04-10 |
Family
ID=44977828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110181600 Expired - Fee Related CN102250229B (en) | 2011-06-30 | 2011-06-30 | Soybean OFP transcription factor, and encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102250229B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105753955B (en) * | 2016-04-07 | 2020-10-20 | 江苏省农业科学院 | Soybean bHLH transcription factor and coding gene and application thereof |
-
2011
- 2011-06-30 CN CN 201110181600 patent/CN102250229B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102250229A (en) | 2011-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Over‐expression of sly‐miR156a in tomato results in multiple vegetative and reproductive trait alterations and partial phenocopy of the sft mutant | |
| Yang et al. | Control of rice embryo development, shoot apical meristem maintenance, and grain yield by a novel cytochrome p450 | |
| Ren et al. | MULTI-FLORET SPIKELET1, which encodes an AP2/ERF protein, determines spikelet meristem fate and sterile lemma identity in rice | |
| CN102816243B (en) | Application of rice transcription factor Os06g08400 genes | |
| Hisanaga et al. | Deep evolutionary origin of gamete-directed zygote activation by KNOX/BELL transcription factors in green plants | |
| US20220298526A1 (en) | Stsci protein for changing self-incompatibility of diploid potato materials | |
| EP3091076A1 (en) | Polynucleotide responsible of haploid induction in maize plants and related processes | |
| BR112013033972B1 (en) | RECOMBINANT DNA CONSTRUCTIONS, METHODS FOR ITS PRODUCTION AND USES, AND METHOD FOR HYBRID SEED PRODUCTION | |
| WO2013023623A1 (en) | Isolation, cloning and application of pms3, a gene for photoperiod-sensitive genic male-sterility in rice | |
| CN110777153B (en) | Populus deltoides androgenesis gene MmS and application thereof | |
| Liu et al. | Genomic characterization of miR156 and SQUAMOSA promoter binding protein-like genes in sweet orange (Citrus sinensis) | |
| Cao et al. | Molecular characterization of a transcriptionally active Ty1/copia-like retrotransposon in Gossypium | |
| CN102432679A (en) | Rice extensin OsPEX1 and application thereof | |
| Shivaraj et al. | Highly preserved roles of Brassica MIR172 in polyploid Brassicas: ectopic expression of variants of Brassica MIR172 accelerates floral transition | |
| Šimášková et al. | KIL1 terminates fertility in maize by controlling silk senescence | |
| Zhao et al. | MutS HOMOLOG1 mediates fertility reversion from cytoplasmic male sterile Brassica juncea in response to environment | |
| CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
| CN101307099A (en) | Protein related to iron deficiency resistance of plants, encoding gene thereof and use | |
| CN103667317B (en) | The application of a kind of soybean MYB class transcription factor GmMYB181 | |
| Li et al. | An AGAMOUS intron‐driven cytotoxin leads to flowerless tobacco and produces no detrimental effects on vegetative growth of either tobacco or poplar | |
| AU2014333405A1 (en) | A method for production of transgenic cotton plants | |
| CN102206262B (en) | Soybean activating protein-1(AP1) transcription factor and coding gene and use thereof | |
| CN102250229B (en) | Soybean OFP transcription factor, and encoding gene and application thereof | |
| Wang et al. | Isolation and functional analysis of LiYAB1, a YABBY family gene, from lily (Lilium longiflorum) | |
| CN102153637B (en) | Wild soybean LEAFY transcription factor and coding gene and application of wild soybean LEAFY transcription factor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130410 Termination date: 20170630 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |