CN102191237A - Method for strengthening anabolism pathway of L-phenylalanine - Google Patents
Method for strengthening anabolism pathway of L-phenylalanine Download PDFInfo
- Publication number
- CN102191237A CN102191237A CN 201110073090 CN201110073090A CN102191237A CN 102191237 A CN102191237 A CN 102191237A CN 201110073090 CN201110073090 CN 201110073090 CN 201110073090 A CN201110073090 A CN 201110073090A CN 102191237 A CN102191237 A CN 102191237A
- Authority
- CN
- China
- Prior art keywords
- gene
- ptsg
- host bacterium
- engineering
- pyka
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
- C12P13/222—Phenylalanine
Landscapes
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a method for strengthening the anabolism pathway of L-phenylalanine. In the method, a Red system is used to knock out a ptsG gene, a pykA gene and a pykF gene in an L-phenylalanine gene engineering host bacterium in turn; then an engineering plasmid Mdphe-2 is implanted into the engineering host bacterium of which the ptsG gene, pykA gene and pykF gene are knocked out to construct a new L-phenylalanine gene engineering bacterium; and finally, the genetic stability and acid productivity of the new L-phenylalanine gene engineering bacterium are verified. The method has the advantages of lowering the glucose absorption rate of the engineering host bacterium to a great extent, lowering the accumulation of acetic acid, promoting the growth of the bacteria, improving the access to enolphosphopyruvate (PEP) which is one of the precursors of aromatic amino acid (lowering the consumption of metabolic sub-pathway of PEP pyroracemic acid), further strengthening the anabolism pathway of L-phenylalanine and improving the L-phenylalanine fermenting capacity of the engineering bacterium.
Description
[technical field]
The present invention relates to bioengineering field, be specifically related to a kind of method of the L-of enhancing phenylalanine metabolic pathway of synthesizing.
[background technology]
L-phenylalanine (L-phenylalanine) is one of necessary amino acid of human body, be widely used in fields such as food, feed, medicine and makeup, it is increasingly extensive that the dipeptide sweetener aspartame (Aspaname) of especially low in calories, high sugariness is used, and increases sharply as the market demand of the L-phenylalanine of one of synthetic two kinds of raw materials of aspartame.In addition, the L-phenylalanine also is the essential raw material of antitumor drug and amino acid transfusion preparation, along with its continually developing of field of medicaments, demand also will constantly increase.
The production method of L-phenylalanine mainly contains these 4 kinds of hydrolysis extraction process, chemical synthesis, enzyme process and fermentation methods both at home and abroad.Because the L-phenylalanine content is lower in the native protein, the hydrolysis extraction process seldom uses; The complex process of chemical synthesis, cost is higher, is replaced by enzyme process and fermentation method basically abroad; But because the price of substrate and enzyme is higher and originate limitedly, enzyme process is used and also is restricted; Because the microorganism direct fermentation can utilize cheapness and the raw material that is easy to get can carry out again at normal temperatures and pressures, be the main stream approach of producing the L-phenylalanine at present both at home and abroad, have bigger competitive edge.But because of end products such as L-phenylalanine have the intensive feedback inhibition to the key enzyme on the intravital aromatic amino acid metabolic pathway of synthesizing of wild strain, make its cell can not accumulate phenylalanine in a large number, therefore if will carry out real attenuation production, just must transform wild strain, remove its metabolic regulation, make that metabolic end product can excessive accumulating.
Traditional strain selection is from occurring in nature screening the bacterial strain of acid producing ability to be arranged, and sets up that its culture condition begins.But the amino acid kind that this method can accumulate is limited, establishing mutating technology and illustrating the seed selection that develops into auxotrophy variant, drug-fast strain on the basis of amino acid synthesis system regulation mechanism afterwards, but adopt the method for conventional selection by mutation, blindness is big, workload is heavy, can not increase the quantity of gene, and mutant strain generally all carries auxotrophy, output further improves and is restricted.
The mid-80, development along with genetic engineering techniques such as the structure of carrier and receptor system and gene recombination, the method of beginning using gene engineering is regulated the metabolism network of biochemical reaction, the enzyme of pair cell, transhipment and adjustment and control system are modified, mainly comprise and eliminate the enzyme that causes the side reaction product to produce, releasing is to the regulation and control of allosteric enzyme, increases or suppresses the expression of specific gene on the pathways metabolism and import methods such as foreign gene.
Carry out abroad extensively by the research of intestinal bacteria L-phenylalanine pathways metabolism being regulated and control to make up L-phenylalanine production bacterial strain, and obtain many achievements.
Sugimoto etc. are put into the gene of L-phenylalanine biosynthetic enzyme system on the plasmid of temperature control promotor, import intestinal bacteria, regulate metabolism by temperature variation and produce acid.1985, people such as Ozaki will resist on the Corynebacterium glutamicum of phenylalanine analogues the gene clone of coding CM and PD to advance the Pce53 plasmid, lead back the parent again, find its acid yield raising 50%; The Monsanto company of the U.S. produces the L-phenylalanine by genetic engineering technique improvement Escherichia coli fermentation, produces acid up to 45g/L, and scale operation, is maximum in the world L-phenylalanine manufacturing enterprise.And domestic starting late, the Shi Yandong of Chinese Medical Sciences University's biotechnology center in 1994 etc. import different host bacterium with the tyrB gene clone plasmid, obtain producing the bacterial strain that the acid amount improves; 1999, the long victory of Fudan University's model waits and makes up the production bacterial strain by key gene aroG, pheA being carried out tandem expression, has also improved the fermentation yield of engineering bacteria significantly, but at the bottom of the domestic fermentation and acid rate, all do not reach the industrialization desired level, treat further to improve phenylalanine and produce bacterium.
The intestinal bacteria direct fermentation synthesizes the L-phenylalanine, and biosynthetic pathway is divided into common pathway and branch's approach, and common pathway provides precursor substance for branch's approach.With glucose is that initiator is through E4P (Erythrose-4-phosphate, E4P, the intermediate product of five-carbon sugar phosphoric acid approach) and the intermediate product of glycolytic cycle---phosphoenolpyruvic acid (Phophoenol pyruvate, PEP) the two condensation forms one seven carbon ketose open chain phosphate cpd, be called 3-deoxidation-α-Arabic heptanone saccharic acid-7-phosphoric acid (3-deoxy-α-arobinoheptulosonate-7-phosphate, DAHP).This is the biosynthetic common metabolic approach of die aromatischen Aminosaeuren, also is the committed step of its productive rate of decision and output.Therefore, in the biosynthesizing of intestinal bacteria L-phenylalanine, DAHP is that first also is most important metabolic intermediate in the L-phenylalanine biosynthetic process, and can flow the synthetic of the DAHP that leads effectively to the center metabolism be the determinative of the fragrant L-phenylalanine biosynthesizing output height of decision.The enzyme of this committed step of catalysis is referred to as deoxy-arabinose type ketoheptose phosphate synthase (DS), be respectively by three isozyme of aroF, aroG and three genes encodings of aroH, be subjected to the feedback inhibition of dead drunk propylhomoserin, phenylalanine and tryptophane respectively, the DAHP synthetic enzyme also is subjected to the collaborative inhibition of phenylalanine and tyrosine simultaneously.
After the common pathway, chorismic acid is the tapping point of die aromatischen Aminosaeuren route of synthesis, is divided into two approach later on again at chorismic acid, and wherein one forms phenylalanine and tyrosine, and another bar shaped becomes tryptophane.
Chorismic acid is under the chorismate mutase effect, change prephenic acid into, form phenyl-pyruvic acid after dewatering, taking off shuttle, the latter is under the transaminase effect, change ammonia with L-glutamic acid and form phenylalanine, the chorismic acid approach is that people early improve the important step of carrying out genetic manipulation to the L-phenylalanine.Chorismate mutase (CM) is the bifunctional enzyme that forms with prephenate dehydratase (PD), and its activated state is that the size of two pheA genes encodings is the homodimer of the subunit formation of 43000D; The CM/PD enzyme forms dimer and tetrameric mixture when Phe concentration is higher, enzymic activity is reduced or completely lose, so it is subjected to the feedback inhibition of product P he, Tyr also has collaborative the inhibition to this enzyme.
The stoichiometry analysis revealed: the absorption of glucose needs sugar-phosphate transfer system, a part glucose needs a part PEP, the chorismic acid of synthetic a part needs bimolecular PEP, so PEP becomes the restricted substrate of DAHP theoretical yield, how many supplys of PEP has determined the biosynthesizing of Phe; And PEP is the competitive substrate of PEP carboxylase, pyruvate kinase, sugar-phosphate transferring enzyme and DAHP synthetic enzyme.1mol glucose enters cell will be transformed into pyruvic acid with the PEP of 1mol, and PEP can generate pyruvic acid and careless phthalein acetate respectively again under the effect of pyruvate kinase and PEP shuttle enzyme simultaneously.Pyruvic acid can not spontaneously transform back into PEP because of high energy barrier in vivo, makes a large amount of carbon stream just generate the content of organic acid, carbonic acid gas and cell through pyruvic acid.In order to make metabolism stream flow to the direction that Phe generates, often take following several strategy: the 1) gene of clonal expression PEP synthetic enzyme (PpsA) and transketolase (tktA) and PEP carboxylation kinases (pckA) in Phe production bacterium; 2) the consumption whereabouts enzyme of passivation PEP such as pyruvate kinase (Pyk); 3) transformation of phosphotransferase system (PTS).
Intestinal bacteria produce metabolism by products such as acetate in the process of high density fermentation, the acetate accumulation suppresses the expression of thalli growth and foreign protein.It is generally acknowledged, the generation of acetate be since thalline to due to the carbon metabolic rate imbalance of the uptake rate of glucose and cell.Intestinal bacteria are mainly finished by phosphotransferase system the picked-up of glucose, wherein by the enzyme IICB of ptsG genes encoding
GlcIn the transmembrane transport of glucose, has vital role.Utilize the metabolic engineering technology, make up the strain of ptsG genetic flaw, can reduce the uptake rate of glucose largely, can reduce the accumulation of acetate thus, promote thalli growth.Pyruvate kinase (pykA, but passivation pykF) also can cause the PEP attainment degree to improve, and strengthens L-phenylalanine metabolic pathway of synthesizing.
Gene knockout also claims gene targeting, gene substitution technique, is the technology that the eighties grows up latter half, mainly is to utilize the character of homologous sequence generation homologous recombination of viable cell chromosomal DNA and foreign DNA to reach the purpose that fixed point knocks out modification.
The principle of Red homologous recombination technique is one section to be carried with the target gene both wings respectively have the PCR fragment of 40-60bp homologous sequence to import host's mycetocyte, utilize the effect of lambda particles phage Red recombinase, make the linear DNA fragment of transfered cell and the particular target sequence of karyomit(e) (or carrier) carry out homologous recombination, target gene is labeled gene substitution and gets off, thus the purpose of the gene knockout that achieves the goal.This recombinant technology is the new technology that can carry out genetic manipulation on the karyomit(e) level that latest developments are got up, only need short homologous sequence, and do not need specific restriction enzyme site, and can finish regrouping process in vivo, saved steps such as external DNA enzyme is cut, connection.Experiment showed, that this gene targeting is the strong instrument of gene functional research and new strain construction.
In addition, the applicant on April 28th, 2010 disclosed Chinese patent 200910111381.X number, be called a kind of in-vitro directed collaborative coevolution and transform and disclosed the process that makes up recombinant expression plasmid pBV-aroG-pheA in the method for L-phenylalanine gene engineering bacteria, set forth for convenience, the application is with this recombinant expression plasmid pBV-aroG-pheA called after engineering plasmid Mdphe-2.
[summary of the invention]
Technical problem to be solved by this invention is to provide a kind of method of the L-of enhancing phenylalanine metabolic pathway of synthesizing, not only can reduce the uptake rate of engineering host bacterium to glucose largely, thereby can reduce the growth of the accumulation of acetate with the promotion thalline; And can improve the attainment degree of the PEP of one of die aromatischen Aminosaeuren precursor, and then strengthened L-phenylalanine metabolic pathway of synthesizing, improve the ability of engineering bacterium fermentation L-phenylalanine.
The present invention solves the problems of the technologies described above by the following technical programs: a kind of method that strengthens L-phenylalanine metabolic pathway of synthesizing, adopt the Red system successively ptsG gene, pykA gene and pykF gene in the L-phenylalanine gene engineering host bacterium to be knocked out; Then engineering plasmid Mdphe-2 is implanted in the engineering host bacterium that ptsG gene, pykA gene and pykF gene all knocked out to make up new L-phenylalanine gene engineering bacteria; At last the genetic stability and the product acid of this new L-phenylalanine gene engineering bacteria are verified.
This method comprises following step:
Step 1: the ptsG gene in the L-phenylalanine gene engineering host bacterium is knocked out: the assembly that knocks out that at first makes up ptsG gene in the L-phenylalanine gene engineering host bacterium, concrete operations are to get the pKD13 plasmid as template, and the synthetic a pair of short homologous fragment sequence that contains the ptsG gene is right as the primer of PCR, then carry out pcr amplification, after pcr amplification finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, the enzyme processing in ice, places 5min again, carrying out electrophoresis afterwards reclaims, and will reclaim fragment and carry out sequence verification, sequence results shows that it conforms to theory, and promptly the ptsG gene knocks out component construction successfully; After then coding in the Red system being had the pKD46 plasmid implantation engineering host bacterium of Red recombinase, this project host bacterium is prepared into high efficiency electric transformed competence colibacillus cell; The assembly that knocks out with the ptsG gene imports the operation that knocks out of carrying out engineering host bacterium behind this competent cell mixing then, and it is induced to lose the pKD46 plasmid; Afterwards ptsG genetically deficient in the engineering host bacterium is verified and the elimination of resistant gene, finally obtained the engineering host bacterium of ptsG genetically deficient, and called after MD-ptsG
-
Step 2: to the engineering host bacterium MD-ptsG of step 1 acquisition
-In the pykA gene knock out: at first make up engineering host bacterium MD-ptsG
-In the pykA gene knock out assembly, concrete operations are to get the pKD13 plasmid as template, and the synthetic a pair of short homologous fragment sequence that contains the pykA gene is right as the primer of PCR, then carry out pcr amplification, after pcr amplification finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, the enzyme processing in ice, places 5min again, carrying out electrophoresis afterwards reclaims, and will reclaim fragment and carry out sequence verification, sequence results shows that it conforms to theory, promptly the pykA gene knocks out component construction successfully; Then coding in the Red system there is the pKD46 plasmid of Red recombinase to implant engineering host bacterium MD-ptsG
-After, this project host bacterium is prepared into high efficiency electric transformed competence colibacillus cell; The assembly that knocks out with the pykA gene imports the operation that knocks out of carrying out engineering host bacterium behind this competent cell mixing then, and it is induced to lose the pKD46 plasmid; Afterwards to engineering host bacterium MD-ptsG
-In pykA genetically deficient verify and the elimination of resistant gene, finally obtain the engineering host bacterium that ptsG gene and pykA gene all lack, called after MD-ptsG
-+ pykA
-
Step 3: to engineering host bacterium MD-ptsG
-+ pykA
-In the pykF gene knock out: at first make up engineering host bacterium MD-ptsG
-+ pykA
--In the pykF gene knock out assembly, concrete operations are to get the pKD13 plasmid as template, and the synthetic a pair of short homologous fragment sequence that contains the pykF gene is right as the primer of PCR, then carry out pcr amplification, after pcr amplification finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, the enzyme processing in ice, places 5min again, carrying out electrophoresis afterwards reclaims, and will reclaim fragment and carry out sequence verification, sequence results shows that it conforms to theory, promptly the pykF gene knocks out component construction successfully; Then coding in the Red system there is the pKD46 plasmid of Red recombinase to implant engineering host bacterium MD-ptsG
-+ pykA
--After, this project host bacterium is prepared into high efficiency electric transformed competence colibacillus cell; The assembly that knocks out with the pykF gene imports the operation that knocks out of carrying out engineering host bacterium behind this competent cell mixing then, and it is induced to lose the pKD46 plasmid; Afterwards to engineering host bacterium MD-ptsG
-+ pykA
--In pykF genetically deficient verify and the elimination of resistant gene, finally obtain the engineering host bacterium that ptsG gene, pykA gene and pykF gene all lack, called after MD-ptsG
-+ pykA
-+ pykF
-
Step 4: engineering plasmid Mdphe-2 is implanted engineering host bacterium MD-ptsG
-+ pykA
-+ pykF
-In the middle of express, to finish the structure of new L-phenylalanine gene engineering bacteria; And to the genetic stability of this new L-phenylalanine gene engineering bacteria and produce acid and verify.
Further, described engineering host bacterium is intestinal bacteria.
The beneficial effect of the method for a kind of L-of enhancing phenylalanine of body of the present invention metabolic pathway of synthesizing is: utilize the homologous recombination gene of Red mediation successively the ptsG gene in the engineering host bacterium, pykA gene and pykF gene to be knocked out, wherein, the disappearance of ptsG gene can reduce the uptake rate of engineering host bacterium to glucose largely, thereby the accumulation that can reduce acetate also can strengthen the attainment degree of the PEP of one of die aromatischen Aminosaeuren precursor simultaneously to promote the growth of thalline; The disappearance of pykA gene and pykF gene can improve the attainment degree of PEP, and then has strengthened L-phenylalanine metabolic pathway of synthesizing, improves the ability of engineering bacterium fermentation L-phenylalanine, thereby brings bigger benefit for suitability for industrialized production.
[embodiment]
The absorption of glucose needs sugar-phosphate transfer system, a part glucose needs a part PEP, the chorismic acid of synthetic a part needs bimolecular PEP, so PEP becomes the restricted substrate of DAHP theoretical yield, how many supplys of PEP has determined the biosynthesizing of Phe; And PEP is the competitive substrate of PEP carboxylase, pyruvate kinase, sugar-phosphate transferring enzyme and DAHP synthetic enzyme.1mol glucose enters cell will be transformed into pyruvic acid with the PEP of 1mol, PEP can generate pyruvic acid and careless phthalein acetate respectively again under the effect of pyruvate kinase and PEP shuttle enzyme simultaneously, pyruvic acid can not spontaneously transform back into PEP because of high energy barrier in vivo, makes a large amount of carbon stream just generate the content of organic acid, carbonic acid gas and cell through pyruvic acid.The present invention flows to the direction that Phe generates in order to make metabolism stream, and engineering host bacterial classification and the metabolic genes involved ptsG of pyruvic acid, pykA and pykF are knocked out, and it specifically comprises following step:
Step 1, the ptsG gene in the L-phenylalanine gene engineering host bacterium is knocked out concrete grammar following (is L-phenylalanine gene engineering host bacterium with intestinal bacteria):
(1) structure that knocks out assembly of ptsG gene
Announce colibacillary genome sequence according to NCBI, the primer that designs a pair of short homologous fragment sequence that contains ptsG is as follows, and entrusts biotechnology (Shanghai) Co., Ltd. to utilize dna synthesizer synthetic:
RED-ptsG-F：GATGCCCTGTACACGGCGAGGCTCTCCCCCCTTGCCACGC
GTGTAGGCTGGAGCTGCTT
RED-ptsG-R：GCAGCCATCTGGCTGCCTTAGTCTCCCCAACGTCTTACGG
ATTCCGGGGATCCGTCGAC
With the pKD13 plasmid is template, above-mentioned primer (RED-ptsG-F/R) for primer to carrying out pcr amplification, amplification reaction system (50 μ l system) is as follows:
Reaction conditions is as follows:
After pcr amplification reaction finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, reaction in ice, places 5min again, then carry out electrophoresis and reclaim, utilize the pillar dna gel to reclaim test kit and carry out the dna fragmentation that the required 1300bp of being about is reclaimed in the electrophoresis rubber tapping respectively.Simultaneously, will reclaim fragment and carry out sequence verification, sequence results shows that PCR result conforms to theory.What confirm the ptsG gene knocks out component construction successfully.
For the follow-up checking that knocks out, the synthetic a pair of checking primer that knocks out, the primer template is the ORF fragment of the Kana resistant gene of pKD13 plasmid, and this also is the ORF sequence that knocks out the resistant gene in the assembly, and the PCR product length of checking is about 850bp.Sequence is as follows:
pKD13kan-F：5-ATGATTGAACAAGATGGATTGCAC-3
pKD13kan-R：5-TTAGAAGAACTCGTCAAGAAGGCG-3
(2) Red system recombination function induces preparation and conversion with high efficiency electric transformed competence colibacillus cell
PKD46 plasmid in the RED system contains the replication orgin oriR101 of responsive to temperature type, the pKD46 plasmid can normal replication when 30 ℃ are cultivated, and when temperature is higher than 37 ℃, just can lose automatically, on the pKD46 plasmid, also contain exo, the bet, the gam gene that are subjected to the ParaB promoter regulation, they can pass through the L-arabinose abduction delivering, and carry ampicillin resistance gene as selection markers.
The pKD46 plasmid that will contain coding Red recombinase plant to engineering host bacterium be in the middle of the intestinal bacteria after, place the LB substratum that contains 100 μ g/ml penbritins and 30 ℃ of following incubated overnight, the cultured culture of 0.5ml is joined in the 250ml Erlenmeyer flask that fills the 50mlLB substratum, and this Erlenmeyer flask placed under 30 ℃, 250rpm condition be cultured to OD
600=0.15-0.20, the L-arabinose that then adds concentration and be 10mol/L continues to be cultured to the dense OD of cell bacterium
600=0.65～0.7, place the sterilization centrifuge tube of transferring to the 50ml of precooling behind the ice-water bath cooling 30min with obtaining the cell bacterium this moment, then this centrifuge tube being placed 4 ℃ and rotating speed is centrifugal 20min under the 5000rpm condition, remove supernatant after the centrifugal end, and the ice-cold aseptic high purity water washing of precipitation 2 times, again the precipitation of last gained is sub-packed in after resuspended in the sterilization EP pipe of precooling standby with the aseptic high purity water of 1ml precooling, and every pipe packing 50 μ l, this is the high efficiency electricity of engineering host bacterium changes competent cell.
(3) importing of ptsG gene knockout assembly and inducing of recombinant plasmid pKD46 are lost
The about 100ng of linearizing ptsG gene knockout assembly fragment is joined the engineering host bacterium electricity that fills prepared fresh changes mixing formation mixed liquor A in the competent cell, and Yu Bingzhong places 15min.
Earlier electroporation is transferred to 2.5KV, 2.5 μ F, pulse manipulator is transferred to 200-400 Ω, then mixed liquor A is transferred in the electric revolving cup, and the sample cell of putting into electroporation then directly carries out electricity and transforms; After transforming and finish, takes out electricity electric revolving cup rapidly, mixed liquor A after then electricity being changeed is drawn onto behind 900 μ lSOC substratum mixings in the middle of the EP pipe of 1.5ml, again the EP pipe is placed 37 ℃, 150rpm down concussion cultivate 60min to allow the recovery of engineering host bacterium, simultaneously, induce gradually and lose the pKD46 plasmid.
The engineering host bacterium bacterium liquid 200 μ l that get recovery are coated with screening on the LB resistant panel that contains 50 μ g/ml Kana, and with this LB resistant panel inversion cultivation 16h under 37 ℃, and when carrying out the resistant panel screening, further induce and lose the pKD46 plasmid, after treating that mono-clonal grows, choose mono-clonal and draw short-term respectively on Kana, Amp resistant panel, and Kana, Amp resistant panel respectively at 37 ℃ cultivate down observe behind the 12h mono-clonal growing state: the normal growth on Kana resistance plate; What can not grow on the Amp resistant panel is to confirm substantially that the pKD46 plasmid loses.
(4) checking of ptsG gene knockout and the elimination of resistant gene in the engineering host bacterium
Be further complete the knocking out of checking ptsG gene, adopt the method for bacterium colony PCR to verify, according to the genome sequence of announcing, select primer right to the cross primer of selecting genome ptsG both sides primer and the segmental primer of Kana resistant gene and two pairs of primer compositions respectively for use.Simultaneously not knock out the negative control group of host's bacterium colony of ptsG gene.Reaction system is as follows:
Reaction conditions:
The result shows, truly has the fragment of the Kana gene fragment size that is about 850bp, and cross primer also has and is about 1100bp simultaneously, confirms that knocking out assembly has successfully carried out the replacement of Kana resistant gene fragment to the ptsG gene, and ptsG genetically deficient makes up initial success.
Because there is interference in the resistant gene fragment that has of engineering host cingula pair with the screening of plasmid, and the segmental existence of external source also has certain influence to engineering host bacterium, eliminates so be necessary the resistance fragment of carrying out knocking in the chromogene.
The pCP20 plasmid contains the replication orgin of responsive to temperature type, have penbritin and chlorampenicol resistant simultaneously, in addition, contain a Flippases recombinase (flipase recombinationenzyme on the pCP20 plasmid, FLP) gene, the FLP recombinase can combine with the FRT site, under the effect of FLP recombinase, homologous recombination takes place in FRT site self, thereby eliminates a FRT site and resistant gene.Recombinase FLP is abduction delivering in the time of 42 ℃, and plasmid also fades away simultaneously.
The electricity of preparation ptsG gene knockout engineering host bacterium changes competent cell, making method is with aforementioned, the pCP20 plasmid electricity of getting 5 μ l changes cell over to, then electricity being changeed mixed solution after finishing and 900 μ l SOC substratum is mixed together to be placed on and allows engineering host bacterium recovery 2h under 30 ℃, the bacterial strain of getting then after 200 μ l recover is applied on the Amp resistant panel, and it is sub to obtain the clone to cultivate 16h down in 30 ℃; Several clone sons of picking are inoculated in 3ml and contain among the liquid LB of Amp resistance then, and after shaking table is cultivated 8h under 30 ℃, 250rpm condition, temperature is adjusted to 42 ℃ continues to cultivate 4～5h, the bacterium liquid that takes a morsel after cultivation finishes is coated on the sky LB flat board, and with this LB flat board in 37 ℃ of following incubated overnight, then mono-clonal that grows on this LB flat board is lined on Kana, Amp resistant panel and the empty LB flat board respectively, and each flat board is cultivated down respectively at 37 ℃, and cultivation results shows: mono-clonal on Kana plate, the Amp resistance plate all can not be grown; And on empty LB plate can normal growth, this is the engineering host bacterium that ptsG gene knockout and resistant gene are eliminated, called after MD-ptsG
-
Step 2, the engineering host bacterium MD-ptsG that step 1 is obtained
-In the pykA gene knock out, concrete grammar is as follows:
(1) structure that knocks out assembly of pykA gene
Announce colibacillary genome sequence according to NCBI, it is as follows to design a pair of primer that contains its short homologous fragment sequence of pykA tandem gene, and entrusts biotechnology (Shanghai) Co., Ltd. to utilize dna synthesizer synthetic:
RED-pykA-F：ATGTCCAGAAGGCTTCGCAGAACAAAAATCGTTACCACGTGTGTAGGCTGGAGCTGCTT
RED-pykA-R：TTACTCTACCGTTAAAATACGCGTGGTATTAGTAGAACCCATTCCGGGGATCCGTCGAC
With the pKD13 plasmid is template, above-mentioned primer (RED-pykA-F/R) for primer to carrying out pcr amplification, amplification reaction system and condition are with the system and the term harmonization of ptsG gene knockout assembly pcr amplification.
Equally, after pcr amplification reaction finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with the DpnI enzyme down in 37 ℃, after finishing, reaction in ice, places 5min again, then carry out electrophoresis and reclaim, utilize the pillar dna gel to reclaim test kit and carry out the dna fragmentation that the required 1300bp of being about is reclaimed in the electrophoresis rubber tapping respectively.Simultaneously, will reclaim fragment and carry out sequence verification, sequence results shows that PCR result conforms to theory.What confirm the pykA gene knocks out component construction successfully.
(2) Red system recombination function induces preparation and conversion with high efficiency electric transformed competence colibacillus cell
The pKD46 plasmid that will contain coding Red recombinase is planted to engineering host bacterium MD-ptsG
-After central, place the LB substratum that contains 100 μ g/ml penbritins and 30 ℃ of following incubated overnight, the cultured culture of 0.5ml is joined in the 250ml Erlenmeyer flask that fills the 50mlLB substratum, and this Erlenmeyer flask placed under 30 ℃, 250rpm condition be cultured to OD
600=0.15-0.20, the L-arabinose that then adds concentration and be 10mol/L continues to be cultured to the dense OD of cell bacterium
600=0.65～0.7, place the sterilization centrifuge tube of transferring to the 50ml of precooling behind the ice-water bath cooling 30min with obtaining the cell bacterium this moment, then this centrifuge tube being placed 4 ℃ and rotating speed is centrifugal 20min under the 5000rpm condition, remove supernatant after the centrifugal end, and the ice-cold aseptic high purity water washing of precipitation 2 times, again the precipitation of last gained is sub-packed in after resuspended with the aseptic high purity water of 1ml precooling in the sterilization EP pipe of precooling standby, and every pipe packing 50 μ l, this is engineering host bacterium MD-ptsG
-High efficiency electricity changes competent cell.
(3) importing of pykA gene knockout assembly and inducing of recombinant plasmid pKD46 are lost
About 100ng joins the engineering host bacterium MD-ptsG that fills prepared fresh with linearizing pykA gene knockout assembly fragment
-Electricity changes mixing formation mixed liquid B in the competent cell, and Yu Bingzhong places 15min.
Earlier electroporation is transferred to 2.5KV, 2.5 μ F, pulse manipulator is transferred to 200-400 Ω, then mixed liquid B is transferred in the electric revolving cup, and the sample cell of putting into electroporation then directly carries out electricity and transforms; After transforming and finish, takes out electricity electric revolving cup rapidly, mixed liquid B after then electricity being changeed is drawn onto behind 900 μ lSOC substratum mixings in the middle of the EP pipe of 1.5ml, again this EP pipe is placed 37 ℃, 150rpm down concussion cultivate 60min to allow the recovery of engineering host bacterium, simultaneously, induce gradually and lose the pKD46 plasmid.
The engineering host bacterium bacterium liquid 200 μ l that get this recovery are coated with screening on the LB resistant panel that contains 50 μ g/ml Kana, and with this LB resistant panel inversion cultivation 16h under 37 ℃, and when carrying out the resistant panel screening, further induce and lose the pKD46 plasmid, after treating that mono-clonal grows, choose mono-clonal and draw short-term respectively on Kana, Amp resistant panel, and Kana, Amp resistant panel respectively at 37 ℃ cultivate down observe behind the 12h mono-clonal growing state: the normal growth on Kana resistance plate; What can not grow on the Amp resistant panel is to confirm substantially that the pKD46 plasmid loses.
(4) to engineering host bacterium MD-ptsG
-In the gene site-directed checking that knocks out of pykA and the elimination of resistant gene, basic identical with in the ptsG gene knockout operation of its method and operation, unique is different as follows:
Be further complete the knocking out of checking pykA gene, adopt the method for bacterium colony PCR to verify, according to the genome sequence of announcing, select primer right, and the engineering host bacterium of being mentioned in this operation is engineering host bacterium MD-ptsG to the cross primer of selecting pykA genome both sides primer and the segmental primer of Kana resistant gene and two pairs of primer compositions respectively for use
-Host's bacterium colony that will knock out the ptsG gene simultaneously but not lack the pykA gene is established as negative control group, and ptsG gene that will finally obtain and the pykA gene all knocks out and resistant gene is eliminated engineering host bacterium called after MD-ptsG
-+ pykA
-
Step 3, with the engineering host bacterium MD-ptsG that obtains
-+ pykA
-In the pykF gene knock out, concrete grammar is as follows:
(1) structure that knocks out assembly of pykF gene
Announce colibacillary genome sequence according to NCBI, a pair of primer that contains the short homologous fragment sequence of pykF gene of synthetic, design of primers is as follows:
RED-pykF-F：ATGAAAAAGACCAAAATTGTTTGCACCATCGGACCGAAAAGTGTAGGCTGGAGCTGCTT
RED-pykF-R：TTACAGGACGTGAACAGATGCGGTGTTAGTAGTGCCGCTCATTCCGGGGATCCGTCGAC
With the pKD13 plasmid is template, above-mentioned primer (RED-pykF-F/R) for primer to carrying out pcr amplification, amplification reaction system and condition are with the system and the term harmonization of ptsG gene knockout assembly pcr amplification.
Equally, after pcr amplification reaction finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with the DpnI enzyme down in 37 ℃, in ice, place 5min again after reaction finishes, then carry out electrophoresis and reclaim.Utilize the pillar dna gel to reclaim test kit and carry out the dna fragmentation that the required 1300bp of being about is reclaimed in the electrophoresis rubber tapping respectively.Simultaneously, will reclaim fragment and carry out sequence verification, sequence results shows that PCR result conforms to theory.What confirm the pykF gene knocks out component construction successfully.
(2) Red system recombination function induces preparation and conversion with high efficiency electric transformed competence colibacillus cell
The pKD46 plasmid that will contain coding Red recombinase is planted to engineering host bacterium MD-ptsG
-+ PykA
-After central, place the LB substratum that contains 100 μ g/ml penbritins and 30 ℃ of following incubated overnight, the cultured culture of 0.5ml is joined in the 250ml Erlenmeyer flask that fills the 50mlLB substratum, and this Erlenmeyer flask placed under 30 ℃, 250rpm condition be cultured to OD
600=0.15-0.20, the L-arabinose that then adds concentration and be 10mol/L continues to be cultured to the dense OD of cell bacterium
600=0.65～0.7, place the sterilization centrifuge tube of transferring to the 50ml of precooling behind the ice-water bath cooling 30min with obtaining the cell bacterium this moment, then this centrifuge tube being placed 4 ℃ and rotating speed is centrifugal 20min under the 5000rpm condition, remove supernatant after the centrifugal end, and the ice-cold aseptic high purity water washing of precipitation 2 times, again the precipitation of last gained is sub-packed in after resuspended with the aseptic high purity water of 1ml precooling in the sterilization EP pipe of precooling standby, and every pipe packing 50 μ l, this is engineering host bacterium MD-ptsG
-+ pykA
-High efficiency electricity changes competent cell.
(3) importing of pykF gene knockout assembly and inducing of recombinant plasmid pKD46 are lost
About 100ng joins the engineering host bacterium MD-ptsG that fills prepared fresh with linearizing pykF gene knockout assembly fragment
-+ pykA
-Electricity changes mixing formation mixed solution C in the competent cell, and Yu Bingzhong places 15min.
Earlier electroporation is transferred to 2.5KV, 2.5 μ F, pulse manipulator is transferred to 200-400 Ω, then mixed solution C is transferred in the electric revolving cup, and the sample cell of putting into electroporation then directly carries out electricity and transforms; After transforming and finish, takes out electricity electric revolving cup rapidly, mixed solution C after then electricity being changeed is drawn onto behind 900 μ lSOC substratum mixings in the middle of the EP pipe of 1.5ml, again this EP pipe is placed 37 ℃, 150rpm down concussion cultivate 60min to allow the recovery of engineering host bacterium, simultaneously, induce gradually and lose the pKD46 plasmid.
The engineering host bacterium bacterium liquid 200 μ l that get this recovery are coated with screening on the LB resistant panel that contains 50 μ g/ml Kana, and with this LB resistant panel inversion cultivation 16h under 37 ℃, and when carrying out the resistant panel screening, further induce and lose the pKD46 plasmid, after treating that mono-clonal grows, choose mono-clonal and draw short-term respectively on Kana, Amp resistant panel, and Kana, Amp resistant panel respectively at 37 ℃ cultivate down observe behind the 12h mono-clonal growing state: the normal growth on Kana resistance plate; What can not grow on the Amp resistant panel is to confirm substantially that the pKD46 plasmid loses.
(4) to engineering host bacterium MD-ptsG
-+ pykA
-In the gene site-directed checking that knocks out of pykF and the elimination of resistant gene, basic identical with in the ptsG gene knockout operation of its method and operation, unique is different as follows:
Be further complete the knocking out of checking pykF gene, adopt the method for bacterium colony PCR to verify, according to the genome sequence of announcing, select primer right, and the engineering host bacterium of being mentioned in this operation is engineering host bacterium MD-ptsG to the cross primer of selecting pykF genome both sides primer and the segmental primer of Kana resistant gene and two pairs of primer compositions respectively for use
-Host's bacterium colony that will knock out ptsG gene and pykA gene simultaneously but not lack the pykF gene is established as negative control group, and the engineering host bacterium called after MD-ptsG that the ptsG gene that will finally obtain, pykA gene and pykF gene all knock out and resistant gene is eliminated
-+ pykA
-+ pykF
-
The structure of step 4, novel L-phenylalanine gene engineering bacteria and genetic stability and fermentation and acid checking
(1) engineering plasmid Mdphe-2 changes called after MD-ptsG over to
-+ pykA
-+ pykF
-Engineering host bacterium in
Wherein engineering host bacterium is for modifying the defective type through engineering approaches host bacterium that ptsG gene, pykA gene and pykF gene all lack through the Red system, adopt conventional molecule manipulation method that the positive colony of engineering plasmid Mdphe-2 is imported in the engineering host bacterium that this ptsG gene, pykA gene and pykF gene all lack then, and cultivate to obtain single bacterium colony of engineering plasmid Mdphe-2.
(2) engineering plasmid Mdphe-2 is at engineering host bacterium MD-ptsG
-+ pykA
-+ pykF
-In stability checking
The plasmid stability of engineering plasmid Mdphe-2 in former engineering host bacterium is through checking, has quite high plasmid stability (97%), and in process of high-density fermentation (lab scale, Chinese style and big formula), keeping high stability equally, for guaranteeing that recombinant plasmid has the stability of plasmid equally in new engineering host bacterium (being the engineering host bacterium that ptsG gene, pykA gene and pykF gene all lack), this chamber personnel have done following experiment:
Single bacterium colony of the engineering plasmid Mdphe-2 that this step of picking (1) is obtained, and it is received 2mL contain Kan
+(in the LB substratum of 50 μ/ml), and this LB substratum placed 30 ℃ of following incubated overnight, get 20 μ l then and add to and do not contain Kan
+The LB substratum in, 35 ℃ of cultivations, make bacterial strain before thermal induction in the substratum of no Kan continuous growth 48h, breed more than 50 generations, when bacterial strain is growing into OD
600Changed under 37 ℃ in=0.3 o'clock and induce, resampling is applied on the LB flat board that does not contain Kan, and next day, 100 points of picking colony contained Kan at random
+Flat board on, containing Kan at last
+The percentage ratio of growth bacterium colony is about 97% on the flat board.
Carry out the bacterium colony PCR checking of deletion mycopremna after respectively the new engineering host bacterium that contains engineering plasmid Mdphe-2 being gone down to posterity simultaneously again, the PCR qualification result shows that the engineering strain deletion fragment is the fragment for being designed to knock out really, and can genetic stability.
Experimental result proves: engineering plasmid Mdphe-2 has higher plasmid genetic stability equally in new engineering host bacterium.
(3) fermentation and acid of novel L-phenylalanine gene engineering bacteria checking
To contain novel L-phenylalanine gene engineering bacteria that engineering plasmid Mdphe-2 and new engineering host bacterium make up after shake flask fermentation is cultivated 48 hours, get fermented liquid supernatant and carry out the mensuration of L-phenylalanine content, simultaneously the negative control group of L-phenylalanine gene engineering bacteria that makes up with engineering plasmid Mdphe-2 and former engineering host bacterium; The shake flask fermentation experiment is triplicate under same processing condition, and the result shows: novel L-phenylalanine gene engineering bacteria is compared with the bacterial strain of negative control group, and its glucose acid invert ratio has clear improvement, produces acid number and also is significantly improved, and wherein produces acid number and has improved 10%; The heteroacid content of fermented liquid obviously reduces in the novel L-phenylalanine gene engineering bacteria fermenting process.
In addition, the nucleotide sequence of related ptsG gene, pykA gene and pykF gene sees Nucleotide or aminoacid sequence table for details among the present invention.
Claims (3)
1. a method that strengthens L-phenylalanine metabolic pathway of synthesizing is characterized in that: adopt the Red system successively ptsG gene, pykA gene and pykF gene in the L-phenylalanine gene engineering host bacterium to be knocked out; Then engineering plasmid Mdphe-2 is implanted in this project host bacterium that ptsG gene, pykA gene and pykF gene all knocked out to make up new L-phenylalanine gene engineering bacteria; At last the genetic stability and the product acid of this new L-phenylalanine gene engineering bacteria are verified.
2. a kind of method that strengthens L-phenylalanine metabolic pathway of synthesizing as claimed in claim 1 is characterized in that: comprise following step:
Step 1: the ptsG gene in the L-phenylalanine gene engineering host bacterium is knocked out: the assembly that knocks out that at first makes up the ptsG gene, concrete operations are to get the pKD13 plasmid as template, and the synthetic a pair of short homologous fragment sequence that contains the ptsG gene is right as the primer of PCR, then carry out pcr amplification, after pcr amplification finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, the enzyme processing in ice, places 5min again, carrying out electrophoresis afterwards reclaims, and will reclaim fragment and carry out sequence verification, sequence results shows that it conforms to theory, promptly the ptsG gene knocks out component construction successfully; After then coding in the Red system being had the pKD46 plasmid implantation engineering host bacterium of Red recombinase, this project host bacterium is prepared into high efficiency electric transformed competence colibacillus cell; The assembly that knocks out with the ptsG gene imports the operation that knocks out of carrying out engineering host bacterium behind this competent cell mixing then, and it is induced to lose the pKD46 plasmid; Afterwards ptsG genetically deficient in the engineering host bacterium is verified and the elimination of resistant gene, finally obtained the engineering host bacterium of ptsG genetically deficient, and called after MD-ptsG
-
Step 2: to the engineering host bacterium MD-ptsG of step 1 acquisition
-In the pykA gene knock out: at first make up engineering host bacterium MD-ptsG
-In the pykA gene knock out assembly, concrete operations are to get the pKD13 plasmid as template, and the synthetic a pair of short homologous fragment sequence that contains the pykA gene is right as the primer of PCR, then carry out pcr amplification, after pcr amplification finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, the enzyme processing in ice, places 5min again, carrying out electrophoresis afterwards reclaims, and will reclaim fragment and carry out sequence verification, sequence results shows that it conforms to theory, promptly the pykA gene knocks out component construction successfully; Then coding in the Red system there is the pKD46 plasmid of Red recombinase to implant engineering host bacterium MD-ptsG
-After, this project host bacterium is prepared into high efficiency electric transformed competence colibacillus cell; The assembly that knocks out with the pykA gene imports the operation that knocks out of carrying out engineering host bacterium behind this competent cell mixing then, and it is induced to lose the pKD46 plasmid; Afterwards to engineering host bacterium MD-ptsG
-In pykA genetically deficient verify and the elimination of resistant gene, finally obtain the engineering host bacterium that ptsG gene and pykA gene all lack, called after MD-ptsG
-+ pykA
-
Step 3: to engineering host bacterium MD-ptsG
-+ pykA
-In the pykF gene knock out: at first make up engineering host bacterium MD-ptsG
-+ pykA
--In the pykF gene knock out assembly, concrete operations are to get the pKD13 plasmid as template, and the synthetic a pair of short homologous fragment sequence that contains the pykF gene is right as the primer of PCR, then carry out pcr amplification, after pcr amplification finishes, after Yu Bingzhong places 15min, amplified production is handled 1h with Dpn I enzyme down in 37 ℃, after finishing, the enzyme processing in ice, places 5min again, carrying out electrophoresis afterwards reclaims, and will reclaim fragment and carry out sequence verification, sequence results shows that it conforms to theory, promptly the pykF gene knocks out component construction successfully; Then coding in the Red system there is the pKD46 plasmid of Red recombinase to implant engineering host bacterium MD-ptsG
-+ pykA
--After, this project host bacterium is prepared into high efficiency electric transformed competence colibacillus cell; The assembly that knocks out with the pykF gene imports the operation that knocks out of carrying out engineering host bacterium behind this competent cell mixing then, and it is induced to lose the pKD46 plasmid; Afterwards to engineering host bacterium MD-ptsG
-+ pykA
--In pykF genetically deficient verify and the elimination of resistant gene, finally obtain the engineering host bacterium that ptsG gene, pykA gene and pykF gene all lack, called after MD-ptsG
-+ pykA
-+ pykF
-
Step 4: engineering plasmid Mdphe-2 is implanted engineering host bacterium MD-ptsG
-+ pykA
-+ pykF
-In the middle of express, to finish the structure of new L-phenylalanine gene engineering bacteria; And to the genetic stability of this new L-phenylalanine gene engineering bacteria and produce acid and verify.
3. a kind of method that strengthens L-phenylalanine metabolic pathway of synthesizing as claimed in claim 1 or 2 is characterized in that: described engineering host bacterium is intestinal bacteria.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110073090 CN102191237A (en) | 2011-03-25 | 2011-03-25 | Method for strengthening anabolism pathway of L-phenylalanine |
| PCT/CN2011/074420 WO2012129831A1 (en) | 2011-03-25 | 2011-05-20 | Method for enhancing anabolism pathways of l-phenylalanine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110073090 CN102191237A (en) | 2011-03-25 | 2011-03-25 | Method for strengthening anabolism pathway of L-phenylalanine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102191237A true CN102191237A (en) | 2011-09-21 |
Family
ID=44600109
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110073090 Pending CN102191237A (en) | 2011-03-25 | 2011-03-25 | Method for strengthening anabolism pathway of L-phenylalanine |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102191237A (en) |
| WO (1) | WO2012129831A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698853A (en) * | 2009-03-31 | 2010-04-28 | 福建省麦丹生物集团有限公司 | In-vitro directed coevolution method for modifying L-phenylalanine gene engineering strains |
| CN101717769A (en) * | 2009-12-08 | 2010-06-02 | 福建省麦丹生物集团有限公司 | Method for improving acid production rate of L-phenylalanine gene engineering bacteria |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100656590B1 (en) * | 2004-07-30 | 2006-12-11 | 한국과학기술원 | Bacteria Variant and Method for Preparing Succinate and Amino Acids |
| KR101042242B1 (en) * | 2007-09-07 | 2011-06-17 | 한국과학기술원 | Mutants having a producing ability of 1,4-butanediol and method for preparing 1,4-butanediol using the same |
-
2011
- 2011-03-25 CN CN 201110073090 patent/CN102191237A/en active Pending
- 2011-05-20 WO PCT/CN2011/074420 patent/WO2012129831A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101698853A (en) * | 2009-03-31 | 2010-04-28 | 福建省麦丹生物集团有限公司 | In-vitro directed coevolution method for modifying L-phenylalanine gene engineering strains |
| CN101717769A (en) * | 2009-12-08 | 2010-06-02 | 福建省麦丹生物集团有限公司 | Method for improving acid production rate of L-phenylalanine gene engineering bacteria |
Non-Patent Citations (1)
| Title |
|---|
| 《氨基酸和生物资源》 20060630 李冀新等 L-苯丙氨酸生产及应用研究进展 第28卷, 第2期 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2012129831A1 (en) | 2012-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110468092A (en) | The genetic engineering bacterium and its construction method of one plant height production Valine and application | |
| CN114717172B (en) | Escherichia coli for synthesizing L-valine and construction method and application thereof | |
| CN101307301A (en) | L-tryptophan genetic engineering bacterium and process for producing L-tryptophan | |
| CN109852572A (en) | A method of it knocking out Escherichia coli PTS system and improves L-threonine yield | |
| CN107022515B (en) | Genetically engineered bacterium for producing L-aspartic acid by utilizing anaerobic fermentation of lignocellulose hydrolysate and construction method and application thereof | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN104560852B (en) | The Corynebacterium glutamicum recombinant bacterium that a kind of L phenylalanines saccharic acid conversion ratio is improved | |
| CN105385646A (en) | Precursor-directed biosynthesis of 5-hydroxytryptophan | |
| CN109402034A (en) | Only produce recombinant bacterium and its application of a kind of branched-chain amino acid | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN104480058A (en) | High yield L-leucine engineering bacterium and application thereof | |
| CN115074376B (en) | Method for efficiently synthesizing D-psicose by utilizing recombinant escherichia coli fermentation | |
| CN103114069B (en) | Bacterium for fermenting L-tryptophan from mixed saccharum and fermentation method thereof | |
| CN117866867B (en) | Caffeic acid production strain, construction method and application thereof | |
| CN101717769A (en) | Method for improving acid production rate of L-phenylalanine gene engineering bacteria | |
| CN103215198B (en) | Recombinant corynebacterium crematum is utilized to take glucose as the method for substrate one-step synthesis method γ-aminobutyric acid | |
| CN111057672B (en) | Recombinant strain and application thereof | |
| CN104974946B (en) | Recombination bacillus coli resistant to high osmotic pressure and its application | |
| CN102041284A (en) | Method for improving acid production rate of L-phenylalanine genetic engineering bacterial | |
| CN110387344B (en) | Recombinant bacterium for producing L-leucine, construction method thereof and production method of L-leucine | |
| CN108373985A (en) | The bacillus amyloliquefaciens engineering bacteria of one high-efficiency degradation caffeine and application | |
| CN103642766A (en) | Protein, DNA molecule, conversion host containing DNA and method for production of L-valine by utilization of conversion host | |
| CN102021209A (en) | Method for improving acid yield of L-phenylalanine gene engineering bacteria | |
| CN102191237A (en) | Method for strengthening anabolism pathway of L-phenylalanine | |
| CN103509747A (en) | Corynebacterium glutamicum engineering bacterium for highly producing succinic acid and building method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110921 |