CN102146388B - BgIosP569 promoter, preparation method and application - Google Patents
BgIosP569 promoter, preparation method and application Download PDFInfo
- Publication number
- CN102146388B CN102146388B CN 201010614893 CN201010614893A CN102146388B CN 102146388 B CN102146388 B CN 102146388B CN 201010614893 CN201010614893 CN 201010614893 CN 201010614893 A CN201010614893 A CN 201010614893A CN 102146388 B CN102146388 B CN 102146388B
- Authority
- CN
- China
- Prior art keywords
- plant
- promotor
- seq
- nucleotide sequence
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to a BgIosP569 promoter, a preparation method and application. The promoter contains a nucleotide sequence selected from any one of the following groups and with promoter function: a, a nucleotide sequence shown as Seq ID No.1; b, a nucleotide sequence complementary with the Seq ID No.1; c, a nucleotide sequence capable of being hybridized with the nucleotide sequence of the a or the b under a high strict condition; d, a nucleotide sequence for substitution, deletion and adding modification of one or more bases for the nucleotide sequence shown in the a or the b; and e, a nucleotide sequence with at least 90 percent of identity as the nucleotide sequence shown in the a or the b. The promoter can regulate and control the gene expression in monocotyledonous and dicotyledonous plants so as to provide a new tool and a new choice for researching the expression of target genes in the plants.
Description
Technical field
The present invention relates to gene engineering technology field, particularly relate to a kind of promotor BgIosP569, the nucleic acid construct, carrier, reconstitution cell, the plant callus that contain this promotor, the preparation method of this promotor and utilize this promotor to come the method for genetic expression in the regulating plant.
Background technology
Promotor is an integral part of gene, is usually located at structure gene 5 ' end upstream, is the section of DNA sequence of RNA polymerase identification, combination and transcriptional start.Promotor can instruct holoenzyme (holoenzyme) with the template correct combination, the activation RNA polymerase, and promotor gene is transcribed, thus controlling gene is expressed the time of origin of (transcribing) and the degree of expression.In transgenic plant, promotor is one of important factor that affects transgene expression efficient, and selecting high efficiency promotor is the key of high-efficient expression foreign gene.
Transcriptional profile according to promotor can be divided into it 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter.So-called constitutive promoter refers to that the genetic expression of different tissues organ and etap does not have notable difference, thereby is referred to as constitutive promoter under the constitutive promoter regulation and control.In the dicotyledons the constitutive promoter of normal use be cauliflower mosaic virus (CaMV) 35S promoter.Another kind of efficiently constitutive promoter CsVMV separates from cassava vein mosaic virus (cassava vein mosaic virus).
People pay much attention to the constitutive promoter from plant clone itself.For example Actin muscle (actin) and the isogenic promotor of ubiquitin (ubiquitin) are cloned.Replace the CaMV 35S promoter with these promotors, can more effectively in monocotyledons, drive transcribing of foreign gene.The Naomi philosophy has been cloned corresponding promotor from the tryptophan synthase subunit gene of Arabidopis thaliana and phytochrome gene, replace the CaMV 35S promoter with it, in transgene tobacco, also obtained good expression effect (Plant biotechnology, 2002,19 (1): 19-26).
Promotor common in the monocotyledons gene has: Ubi promotor (Plant ubiquitin promoter), Actin promotor (Plant Actin promoter) and Adh-1 promotor (Maize alcohol dehydrogenasel promoter).
The Ubi promotor gains great popularity with the factor such as its starting efficiency is high, methylation is low, stabilization characteristics of genetics.At present, from a lot of ubiquitin genes, separated and obtained promoter sequence, comprise Ubi-1 promotor, paddy rice ubiquitin RUBQ2 promotor, Arabidopis thaliana ubiquitin promoter, Sunflower Receptacle ubiquitin UbB1 promotor, tobacco ubiquitin Ubi.U4 promotor, potato ubiquitin Ubi7 promotor, tomato ubiquitin Ubi1-1 promotor in the Maize genome, barley ubiquitin Mub1 promotor.Corn ubiquitin Ubi-1 promotor has been widely used in the monocotyledonss such as corn, wheat, paddy rice, and paddy rice ubiquitin RUBQ2 promotor also has more application in paddy rice and sugarcane.
Actin promotor nineteen ninety is found in paddy rice first by McElroy of Cornell University etc., belongs to strong constitutive promoter.The Actin promotor acts in the unifacial leaf Gramineae significantly, but the gene regulating function in the plant that contiguous section belongs to is but very undesirable.Therefore, many correlative studys are sought the Actin promotor by other monocotyledonss, and success is found in banana, muskmelon, corn and Arabidopis thaliana successively.The Actin promotor has obtained using more and more widely in the transgenosis of monocotyledons good character owing to the control effect of emphasizing to genetic expression.
Adh-1 promoter regulation ethanol dehydrogenase (alcohol dehydrogenase) gene, most important to the expression of plant ethanol dehydrogenase under anaerobic environment.The Adh-1 promotor is to monocotyledons particularly cereal grass such as paddy rice, oat and barley, and small part dicotyledons such as tobacco, and the adjusting function of gene improves 10-50 doubly than cauliflower mosaic virus CaMV 35S promoter.The Adh-1 promotor is mainly used in monocotyledons, and is all very limited to the regulating effect that most dicotyledon genes are expressed.
Monocotyledons is angiospermous main monoid, and the Gramineae in the monocotyledons, Liliaceae, Palmae and Rhizoma Arisaematis etc. are very important agricultural crops.The potent promotor of monocotyledons gene can the regulating plant high-efficient expression has the foreign gene of specialized character, and is great to the molecular breeding Research Significance of good crop.
In potent promotor Related Research Domain, find and verified many monocotyledonous promotors.In addition, the efficient promotor such as the potent promotor of some in the dicotyledons such as CsVMV promotor, tomato E8 promotor, Resveratrol synthase gene Vst1 promotor also has very strong gene regulating effect in monocotyledons.
Summary of the invention
The purpose of this invention is to provide a kind of new promotor, can be in plant the expression of regulatory gene.
Another object of the present invention is to provide the nucleic acid construct, carrier, reconstitution cell, plant callus, plant explants and the plant that contain above-mentioned promotor.
A further object of the present invention is to provide a kind of primer, method for preparing above-mentioned promotor, and a kind of method of utilizing this promotor to come genetic expression in the regulating plant.
A further object of the present invention is to provide a kind of method for preparing transgenic plant, and above-mentioned promotor purposes in destination gene expression or the plant breeding in regulating plant.
For achieving the above object, the present invention has adopted following technical scheme:
The invention discloses a kind of promotor, described promotor contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in a, the Seq ID No.1;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringent condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
D, nucleotide sequence shown in above-mentioned a or the b is carried out the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified;
E, the nucleotide sequence that has at least 90% identity with nucleotide sequence shown in above-mentioned a or the b.
The invention also discloses a kind of nucleic acid construct, comprise above-mentioned promotor, and the gene order that is operatively connected with promotor, wherein said promotor is identical or different from described gene order source.
The invention also discloses a kind of carrier, described carrier contains above-mentioned promotor or above-mentioned nucleic acid construct, and is preferred, and described carrier is the recombinant vectors that above-mentioned promotor and pMD18-T or p8 plasmid obtain through restructuring.
The present invention further discloses a kind of reconstitution cell, described cell contains above-mentioned promotor, above-mentioned nucleic acid construct or above-mentioned carrier, and is preferred, and described reconstitution cell is recombinant Bacillus coli cells or restructuring agrobatcerium cell.
The present invention further discloses the plant callus, plant explants or the plant that contain above-mentioned promotor, nucleic acid construct, carrier or reconstitution cell, preferably, described plant is monocotyledons or dicotyledons, preferred again, described plant is Oryza or Nicotiana, and is preferred, and described plant is paddy rice or tobacco, further preferred, described plant is the fine or tobacco NC89 of paddy rice Japan.
The present invention further discloses one group of primer pair; be used for amplification and obtain above-mentioned promotor; two right primers of described primer contain respectively the sequence shown in Seq ID No:2 and the Seq ID No:3; preferably; two right primers of described primer also are connected with respectively restriction enzyme site and/or protection base at 5 ' end; preferred, two right primers of described primer have respectively the sequence shown in Seq ID No:4 and the Seq ID No:5.
The invention also discloses the method for preparing promotor shown in the SEQ ID No:1, comprise: take the fine genomic dna of paddy rice Japan as template, use the pair for amplification primer to increase, described amplimer designs for head and the tail respectively according to the sequence of SEQ ID NO:1 in the fine gDNA of paddy rice Japan, preferably above-mentioned primer pair.
The present invention further discloses the method for genetic expression in a kind of regulating plant, described method comprises, above-mentioned promotor, nucleic acid construct, carrier or reconstitution cell are imported vegetable cell.The preferred plant callus that imports.Further preferred, it is to utilize the Agrobacterium-mediated Transformation plant callus that promotor or nucleic acid construct import vegetable cell, described plant optimization is monocotyledons or dicotyledons, described plant is preferably Oryza or Nicotiana again, described plant is paddy rice or tobacco more preferably, and described plant is the fine or tobacco NC89 of paddy rice Japan more preferably.The invention also discloses a kind of method for preparing transgenic plant, be included under the condition of effective generation plant and cultivate above-mentioned reconstitution cell or plant callus or plant explants or plant.
The invention also discloses above-mentioned promotor, nucleic acid construct, carrier, reconstitution cell or plant callus or plant explants or the plant purposes in destination gene expression or the plant breeding in regulating plant, preferred plant is monocotyledons or dicotyledons, preferred plant is Oryza or Nicotiana again, more preferably plant is paddy rice or tobacco, and further preferred plant is the fine or tobacco NC89 of paddy rice Japan.
Owing to adopted above technical scheme, the beneficial effect that the present invention is possessed is:
New promotor provided by the invention can be in plant regulate gene expression, and, root and Ye Zhongjun monocotyledons such as paddy rice and dicotyledons such as model plant-tobacco have promoter function, can regulate and control the expression of foreign gene, thereby be that the expression of studying goal gene in the plant (comprising monocotyledons and dicotyledons) provides a kind of new instrument and selection.
Preservation information
Culture title: tobacco NC89 seed
Preservation date: on November 12nd, 2010
Depositary institution: Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center, i.e. Chinese Typical Representative culture collection center (CCTCC)
Deposit number: CCTCC No:P201017
Description of drawings
Fig. 1 is for being used for making up the pCAMBIA-1301 plasmid synoptic diagram of p8 plasmid.
Fig. 2 is p8 plasmid synoptic diagram.
Fig. 3 is the GUS coloration result of the Rice Callus through transforming.Wherein, the Rice Callus (right side) that is transformed by the restructuring agrobacterium tumefaciens p8+P569 with promotor P569 sequence of the present invention presents blueness after GUS dyeing; Rice Callus (contrast, a left side) color after GUS dyeing without the restructuring agrobacterium tumefaciens p8 plasmid of promoter sequence of the present invention does not change.
Fig. 4 A, 4B and Fig. 5 are respectively through the tobacco shoot root of conversion and the GUS coloration result of leaf, amplify 3 times of lower shootings at opticmicroscope.Present blueness after the root of the tobacco seedling of the restructuring Agrobacterium-Mediated Transformation of the p8+P569 recombinant vectors through containing promotor (Fig. 5 is right) and leaf (Fig. 4 B) are dyed, the root (in contrast, Fig. 5 is left) of the tobacco seedling of the p8 plasmid restructuring Agrobacterium-Mediated Transformation through not containing promotor and leaf (Fig. 4 A) color after GUS dyeing do not change.
Embodiment
The present invention relates to a kind of can be in plant the promoter sequence of regulate gene expression, promotor of the present invention contains and is selected from following any one group and have the nucleotide sequence of promoter function:
Nucleotide sequence shown in the Seq ID No.1 in a, the sequence table;
B, with the nucleotide sequence of Seq ID No.1 complementation;
C, under high stringent condition can with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b;
D, nucleotide sequence shown in above-mentioned a or the b is carried out the nucleotide sequence that the replacement, disappearance, interpolation of one or more bases are modified;
E, the nucleotide sequence that has at least 90% identity with nucleotide sequence shown in above-mentioned a or the b.
In concrete embodiment of the present invention, promotor of the present invention preferably has the nucleotide sequence shown in the Seq ID No.1, and is called as in the present invention promotor BgIosP569, perhaps referred to as the P569 promotor.
In the present invention, typically, " stringency " degree of used condition was classified when " hybridization conditions " hybridized according to measurement.The stringency degree can be take nucleic acid for example in conjunction with the melting temperature(Tm) (Tm) of mixture or probe as foundation.For example, " maximum stringency " typically occurs in about Tm-5 ℃ (being lower than 5 ℃ of probe Tm); " high stringency " occurs in following about 5-10 ℃ of Tm; " medium stringency " occurs in following about 10-20 ℃ of probe Tm; " low stringency " occurs in following about 20-25 ℃ of Tm.As an alternative, perhaps further, hybridization conditions can take the salt of hybridization or ionic strength conditions and/or one or the washing of repeatedly stringency as foundation.For example, the extremely low stringency of 6 * SSC=; 3 * SSC=is low to moderate medium stringency; The medium stringency of 1 * SSC=; 0.5 the high stringency that waits of * SSC=.On function, can adopt maximum stringency condition to determine and the tight same or near tight same nucleotide sequence of hybridization probe; Or adopt high stringency condition to determine to have an appointment 80% or the nucleotide sequence of multisequencing identity more with this probe.
For the application that requires highly selective, typically expectation adopts relatively restricted condition to form crossbred, for example selects relatively low salt and/or hot conditions.Sambrook etc. (Sambrook, J. etc. (1989) molecular cloning, laboratory manual, Cold Spring Harbor Press, Plainview, N.Y.) provide the hybridization conditions that comprises medium stringency and high stringency.
For convenience of explanation, the suitable medium stringent condition for detection of hybridization of the present invention comprises: with 5 * SSC, 0.5%SDS, the prewashing of 1.0mM EDTA (pH8.0) solution; Under 50-65 ℃, in 5 * SSC, hybridize and spend the night; Subsequently with contain 2 of 0.1%SDS *, 0.5 * and 0.2 * SSC 65 ℃ of lower each washed twice 20 minutes.It will be appreciated by those skilled in the art that easily to operate the hybridization stringency, as changing saltiness and/or the hybridization temperature of hybridization solution.For example, suitable high tight hybridization conditions comprises above-mentioned condition, and difference is that hybridization temperature is elevated to for example 60-65 ℃ or 65-70 ℃.
In the present invention, described under high stringent condition with shown in the Seq ID No.1 or the nucleotide sequence of the nucleotide sequence hybridization complementary with it, it has and the same or analogous promoter activity of nucleotide sequence shown in the Seq ID No.1.
In the present invention, described Seq ID No.1 or the nucleotide sequence complementary with it are carried out the nucleotide sequence that replacement, disappearance, the interpolation of one or more bases are modified, refer to hold at the 5 ' end and/or 3 ' of described nucleotide sequence respectively or simultaneously, and/or sequence inside for example is no more than 2-45, perhaps be no more than 3-20, perhaps be no more than 3-20, perhaps be no more than 4-15, perhaps be no more than 5-10, the replacement, disappearance, the interpolation that perhaps are no more than 6-8 the base that represents with continuous integral number are one by one respectively modified.
In the present invention, described Seq ID No.1 or the nucleotide sequence complementary with it are carried out the nucleotide sequence that replacement, disappearance, interpolation such as above-mentioned one or more bases are modified, have and the same or analogous promoter activity of nucleotide sequence shown in the Seq ID No.1.
Describe by a kind of polynucleotide, its nucleotide sequence that has for example refers to the reference nucleotide sequence 90% " identity " of Seq ID No.1 at least: in per 100 Nucleotide of the reference nucleotide sequence of Seq ID No.1, the nucleotide sequence of these polynucleotide is except containing the difference that reaches 10 Nucleotide, and the nucleotide sequence of these polynucleotide is identical with reference sequences.In other words, in order to obtain the identical polynucleotide of nucleotide sequence and reference nucleotide sequence at least 90%, nearly 10% Nucleotide can be deleted or by another nucleotide substitution in the reference sequences; Maybe some Nucleotide can be inserted in reference sequences, the Nucleotide that wherein inserts can reach reference sequences total nucleotide 10%; Or in some Nucleotide, the combination of have deletion, inserting and replacing, wherein said Nucleotide reach reference sequences total nucleotide 10%.These sudden changes of reference sequences can occur in 5 ' or 3 ' terminal position of reference nucleotide sequence, or any place between these terminal positions, they or be dispersed in separately in the Nucleotide of reference sequences, or be present in the reference sequences with one or more adjacent groups.
In the present invention, algorithm that be used for to determine sequence identity and sequence similarity percentage ratio is for example BLAST and BLAST2.0 algorithm, and they are described in respectively (1990) J.Mol.Bio.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 such as Altschul and Altschul.For example adopt described in the document or default parameters, BlAST and BLAST 2.0 can be used for determining nucleotide sequence homology percentage ratio of the present invention.Carrying out software that BLAST analyzes can be obtained by the public by state-run biotechnology information center.
In the present invention, the nucleotide sequence that nucleotide sequence shown in described and the SEQ ID NO:1 has at least 90% sequence identity comprises the polynucleotide sequence substantially same with the disclosed sequence of SEQ ID NO:1, for example when adopting methods described herein (for example adopting the BLAST of canonical parameter to analyze), compare with polynucleotide sequence of the present invention and to contain at least 90% sequence identity, preferred at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or those sequences of higher sequence identity.In the present invention, nucleotide sequence with sequence identity of at least 90% of described and SEQ ID No.1 or its complementary nucleotide sequence has and the same or analogous promoter activity of nucleotide sequence shown in the Seq ID No.1.
The invention still further relates to a kind of nucleic acid construct, comprise gene and the above-mentioned promotor that is operably connected with this gene.In the present invention, " be operably connected " and refer to functional spatial disposition of two or more Nucleotide zone or nucleotide sequence.In nucleic acid construct of the present invention, for example, promotor is placed in the specific position of the nucleotide sequence of described gene, for example promotor is positioned at the upstream position of described gene nucleic acid sequence, so that nucleotide sequence transcribe the guiding that is subject to this promoter region, thereby promoter region is " operably connected " on the nucleotide sequence of this gene.Described gene generally is any nucleotide sequence that needs to improve transcriptional level, perhaps, can design promotor of the present invention and gene so that the downward modulation specific nucleic acid sequence.Namely by promotor is linked to each other to realize with the gene of antisense orientation.In concrete embodiment of the present invention, described gene is preferably gus gene.
The invention still further relates to a kind of carrier that contains above-mentioned promotor or above-mentioned nucleic acid construct.Carrier of the present invention can be by above-mentioned promotor or above-mentioned nucleic acid construct being inserted into the recombinant vectors that cloning vector or expression vector obtain.The cloning vector that is suitable for making up recombinant vectors of the present invention includes but not limited to, such as: pUC18, pUC19, pUC118, pUC119, pMD19-T, pMD20-T, pMD18-T Simple Vecter, pMD19-T Simple Vecter etc.The expression vector that is suitable for making up recombinant vectors of the present invention includes but not limited to, such as: pMI121, p13W4, pGEM etc.In the concrete embodiment of the present invention, the carrier that the present invention contains described promotor is the recombinant vectors that above-mentioned promotor and pMD18-T or p8 plasmid obtain through restructuring, preferably, recombinant vectors of the present invention is pMD18-T+P569 recombinant vectors or p8+P569 recombinant vectors.
Another aspect of the present invention also relates to the reconstitution cell that contains promotor of the present invention.Reconstitution cell of the present invention can be by obtaining the above-mentioned recombinant vectors transformed host cell that contains promotor of the present invention.The host cell that is suitable for making up reconstitution cell of the present invention includes but not limited to, for example: Bacillus coli cells DH5 α, agrobacterium tumefaciens cell LBA4404, EHA105, GV3101 etc.In concrete embodiment of the present invention, described reconstitution cell is restructuring agrobacterium tumefaciens EHA105-P569.
Again one side of the present invention also relates to a kind of plant callus or plant explants or plant, and described callus, plant explants or plant contain above-mentioned promotor of the present invention.Plant callus of the present invention can be for example Rice Callus of monocotyledons callus, perhaps dicotyledons callus tobacco healing tissue for example.
Of the present inventionly also relate to the one group of primer pair that obtains promotor of the present invention for pcr amplification more on the one hand, this group primer is to containing the sequence shown in the Seq ID No.2 and Seq No.3 in the ordered list.For the ease of operation; usually preferably hold to contain to design at 5 ' of primer and be connected with restriction enzyme site and/or protection base; in the concrete embodiment of the present invention, two right primers of described primer have respectively the sequence shown in Seq ID No:4 and the Seq ID No:5.
Adopt above-mentioned primer, carry out pcr amplification take the fine genomic dna of paddy rice Japan as template, can prepare promotor of the present invention.
The present invention further discloses the method for genetic expression in a kind of regulating plant, described method comprises, above-mentioned promotor is imported vegetable cell.Preferably import the purpose that vegetable cell reaches regulate gene expression by the nucleic acid construct that foreign gene and promotor of the present invention will be contained simultaneously.In the described nucleic acid construct, foreign gene is operably connected with promotor of the present invention.In the preferred embodiment of the present invention, can utilize the recombinant vectors that contains purpose foreign gene and promotor of the present invention to transform Agrobacterium, the restructuring Agrobacterium-mediated Transformation plant callus that will obtain again, thus realize described foreign gene is imported the purpose of vegetable cell with promotor of the present invention.In concrete embodiment of the present invention, foreign gene is preferably gus gene.Plant of the present invention can be monocotyledons, and such as paddy rice, wheat, corn, millet, sugarcane, Chinese sorghum, barley etc. also can be dicotyledons, tobacco for example, soybean, potato, broad bean, radish, peanut etc.
Tobacco is typical genetically engineered model plant.So the present invention selects tobacco to carry out transgenic research, to study the effect of promotor of the present invention in dicotyledons.Experimental result shows that this promotor can work in transgene tobacco.
In the present invention, can adopt the plant gene transformation technology that goal gene and described promotor are inserted in the Plant Genome, comprise agrobacterium mediation converted, virus-mediated conversion, microinjection, particle bombardment, via Particle Bombardment Transformation and electroporation etc.This area is known, and agriculture bacillus mediated gene transformation often is used to the gene transformation of monocotyledons and dicotyledons, but other transformation technology also can be used for the importing of promotor of the present invention and foreign gene.Certainly, being suitable for the another kind of method that promotor of the present invention and foreign gene import is particle bombardment (micro-gold or tungsten particle attached bag are covered the DNA of conversion) embryo callus or embryo's exploitation.The method of the transformed plant cells that can also adopt in addition, is protoplast transformation.After the gene transformation, adopt general method to screen and regenerate and be integrated with the plant of expressing the unit.
For realizing the purpose of above-mentioned regulate gene expression, promotor of the present invention can be used with the form of single copy and/or multiple copied, can with promotor coupling well known in the prior art.
The method of genetic expression in promotor of the present invention and the regulating plant can be applied to the seed selection of plant variety.Such as, can be used for the breeding of paddy rice or tobacco.Described paddy rice can finely for Japan, middle spend 9, middlely spend 10, middlely spend 11, the Taibei 309, No. 8, Danjiang River, cloud rice No. 2, Shanyou 63, Shan are excellent 608, Feng You 22, Guizhou Province are excellent 88, II is excellent 416, II is excellent 107, II is excellent 128, II is excellent 718, Zhunliangyou 527, No. 1, river farming, assorted 0152, Anhui rice 88, Anhui rice 90, Anhui rice 92, Anhui rice 94, Anhui rice 96, Anhui rice 185, Anhui rice 187, Anhui rice 189, Anhui rice 191, Anhui rice 193, Anhui rice 195, Anhui rice 197, Anhui rice 199, Anhui rice 201, Anhui rice 203, Anhui rice 205, Anhui rice 207, and Tianjin former 101 etc.In concrete embodiment of the present invention, described paddy rice is that Japan is fine.Described tobacco can be K326, K346, K394, NC82, NC89, G140, G28, G80, middle cigarette 90, Coker176, and CV87 etc.In another concrete embodiment of the present invention, described tobacco is tobacco NC89.
Promotor of the present invention can become a kind of new promotor, (comprise monocotyledons and dicotyledons as plant, especially paddy rice and tobacco) genetically modified instrument start-up, low expressing gene transformation seedlings screens in order to carry out, the breeding research of plant flower organ abortion equimolecular facilitates, thereby greatly shortens the seed selection time of improved seeds.Promotor of the present invention can be widely used in cultivates paddy rice, tobacco, wheat, corn, millet, sugarcane, Chinese sorghum, barley, soybean, potato, broad bean, radish, peanut etc.
In the present invention, term " monocotyledons ", particularly, can be grass, more specifically, can be oryza plant paddy rice for example, include but not limited to that Japan is fine, in spend 9, in spend 10, in spend 11, the Taibei 309, No. 8, Danjiang River, cloud rice No. 2, Shanyou 63, Shan excellent 608, Feng You 22, Guizhou Province excellent 88, II excellent 416, II excellent 107, II excellent 128, II excellent 718, Zhunliangyou 527, No. 1, river farming, assorted 0152, Anhui rice 88, Anhui rice 90, Anhui rice 92, Anhui rice 94, Anhui rice 96, Anhui rice 185, Anhui rice 187, Anhui rice 189, Anhui rice 191, Anhui rice 193, Anhui rice 195, Anhui rice 197, Anhui rice 199, Anhui rice 201, Anhui rice 203, Anhui rice 205, Anhui rice 207, and Tianjin former 101 etc.
In the present invention, term " dicotyledons ", particularly, can be plant of Solanaceae, more specifically, can be Nicotiana plant (tobacco), include but not limited to tobacco K326, K346, K394, NC82, NC89, G140, G28, G80, middle cigarette 90, Coker176, and CV87 etc.
By reference to the accompanying drawings the present invention is described in further detail below by embodiment.But it will be understood to those of skill in the art that the following example only is used for explanation the present invention, and should not be considered as limiting scope of the present invention.Unreceipted concrete technology or condition person among the embodiment, according to the described technology of the document in this area or condition (such as works such as reference J. Pehanorm Brookers, " the molecular cloning experiment guide " that Huang Peitang etc. translate, the third edition, Science Press) or carry out according to product description.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.
The pcr amplification of embodiment 1:P569 promoter fragment and the structure of pMD18-T+P569 recombinant vectors
Pcr amplification
Use plant genome DNA to extract test kit (TIANGEN plant genes group DNA extraction test kit; catalog number (Cat.No.): DP320-02) extracting paddy rice Japan fine (has been 200910238992.0 at application number; denomination of invention is preservation in the patent application of " a kind of promotor BgIosP587; Preparation Method And The Use "; and open on September 22nd, 2010; deposit number is CCTCC NO:P200910) genomic dna; according to the sequence of this promotor in the fine gDNA of paddy rice Japan; design one couple of PCR specificity amplification primer (upstream primer F1 at head and the tail respectively; add restriction enzyme site Hind III and protection base; downstream primer R1 adds restriction enzyme site SbfI and protection base).Take the fine gDNA of the paddy rice of said extracted Japan as template, use high-fidelity Ex Taq (TaKaRa, DRR100B) polysaccharase to carry out pcr amplification.As shown in table 1.
The PCR system of table 1 gene promoter amplification
The pcr amplification program is: 94 ℃ of denaturation 5min, and then with 94 ℃ of sex change 45s, 55 ℃ of annealing 50s, 72 ℃ are extended 90s, carry out 35 reaction cycle, and last 72 ℃ are extended 7min.
Wherein, upstream primer F1 (SEQ ID NO:4): CC
AAGCTT 
Wherein underscore represents the HindIII restriction enzyme site, is SEQ ID No:2 in the square frame.
Downstream primer R1 (SEQ ID NO:5): TG
CCTGCAGG Wherein underscore represents the SbfI restriction enzyme site, is SEQ ID No:3 in the square frame.
Pcr amplification product separates through 1.0% agarose gel electrophoresis, obtains size and is about band about 2900bp, uses TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) carry out purifying and reclaim.
The structure of pMD18-T+P569 recombinant vectors
To carry out T/A clone (pMD18-T plasmid, TaKaRa, D103A) such as pcr amplification product obtained above, and transform intestinal bacteria, the order-checking of picking positive colony proves accurately.
Wherein, T/A clone's condition of contact is as follows:
T/A linked system: 10 μ l
pMD18-T 1μl
2*solution I 5μl
Pcr amplification product (recovery Insert Fragment) 10ng～20ng, fixed according to its concentration
DdH
2O polishing to 10 μ l
(the new sesame in Ningbo SDC-6) the middle connection more than the 8h, obtains the pMD18-T+P569 recombinant vectors at the energy-conserving intelligent thermostatic bath in 16 ℃.To transform as follows intestinal bacteria through the product after the above-mentioned connection:
(Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides to take out the competent cell 100 μ l DH5 α that prepare according to Calcium Chloride Method shown in " molecular cloning experiment guide " (third edition, Science Press) from Ultralow Temperature Freezer; Perhaps can be from for example: Shanghai be given birth to the worker and is buied), after melting on ice, add the as above connection product of gained of 10 μ l, it is the pMD18-T+P569 recombinant vectors, stir evenly gently ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min, the SOC substratum (concrete prescription sees " molecular cloning experiment guide ", the third edition, Science Press for details) that adds 4 ℃ of precoolings of 600 μ l, 37 ℃ of 220rpm recovery 45min, the centrifugal 30s of 8000rpm removes supernatant, leaves and takes 150 μ l, with the mixture after the remaining resuspended precipitation of 150 μ l supernatants, blow gently evenly, granulated glass sphere coating LB (kantlex) is dull and stereotyped, and (concrete prescription sees " molecular cloning experiment guide ", the third edition for details, Science Press), be inverted cultivation 16h～24h for 37 ℃.Acquisition contains the recombination bacillus coli of pMD18-T+P569 cloning vector, called after DH5 α-P569.Shenzhen Huada Genetic Technology Co., Ltd checks order to the P569 in the pMD18-T+P569 cloning vector.
Sequencing result shows that the P569 promoter sequence is correct in the pMD18-T+P569 cloning vector of acquisition.The sequence of P569 promotor is shown in Seq ID No:1 in the sequence table.
CGGTCCACCGTCGTCGTCGTCTAGGGTTTCCTCCTCCTTCCCAGCGGAGATCAAGAATCAGAAGCAACAGCTATGGC
GGCGGCGGCGGAGGGTGAAAAGAAGATGATAACGCTGAAGAGCTCGGATGGAGAGGAATTCGAGGTGGAGGCGGTGG
GCATGGAGTCTCAGACCATCCGGCACATGATCGAGGATAAATGCGCCGACAATGGGATCCCCCTCCCCAACGTGAAT
TCCAAGATCCTCTCCAAGGTTATCGAGTACTGCAACAAGCACGTTCACGCCTCCGCCGACGACTCAACCTCCTCCGC
TGACCTCAAGAACTGGACGCCGACTTCGTCAAGGTCGACCAGGCCACCCTCTTCGACCTCATCTTGGTAACCCATTC
CCTCTCCACTCCCCGCTCTCCTCTCCTCTCCTCTCCGATTATTTTTTTTATTTACATACAGCGCAGAGTTCGTCCAG
ATCTATCTAGGTTGCACTCTTCTCCCTACCCTAGGTCTTGGCTTTACCAATATACTCCAGTAGTAGTATATTTCTAT
ATTGGTACTACTCCACTACGTCTTAAATAAGTAACTACTCCCTCCGTCCCAAAATAAGTGCAGCCATGGTTTTCCGC
GCCGAACTTTGACTGTTCGTCTTATTTGATTTTTTTTTAAAAAAAATTAAAAACATAAGTCACGAGTAAAGTACTAT
TCATGTTTTATCATCTCATAGCAATAAAAATGCTAATTATAAAAAAAATTTAAATAAAACGGACGACCAAAGTTGGG
CGTGGAAACTCATGACTGTGCTTATTTTGGGACGGAGGTAGTAGATGATTTATTATGCCTATGTGAATCTGGTTGCG
TGTTGTTAGCACAGCTTATCTGATGATTATTGCGTGTCCTTGTTTTATCTCCCAAATCAAACCCATTGTGTACAACT
CTAGGGGCTGCCATGCTTTTTATTTCCATTTATTTCAACTAGTGCTCTTCTTTTCTTGTGCTTGGGGACAATGTTGA
TGGGTGGTGGGTTTATTACTCTTCTACCAGTAACGCTGTCAGTTTGTGTCAATTGATACTGTCTTCACTTTTAACAT
CCATAAATGCATTGGCTTGCTAAGCCTTAGGTTGTGTTTAGTTCCTTCCAAAGTTGGAAGTTTAGGTTAAAATTGGT
ACGATGTGACTGAAAAGTTGTGTGTATGACAGGTTGATGTGATGAAAAAAGTTGGAAGTTCGGATCTACTGTCTTTG
TGGCTCAAATCTATTGTATGCTTCCTTGTCTCCCCCCCTCCCAAAATGGACCCTTCTAGGTTTTCCTAATGCATTAT
ATGTTTTTGTTACTGTTGCAACATACTTGGCAGTACAATTGATGCTCGGACTTATATTTATTGTGCTAGCCTTTAAA
TTTATAATCATGGTACCCTTTTTAAACATGTGGATATATTGATGTTCAATTCATTTAGGCAATGTGGTTAAGTGATC
CTTCTGTCATTAATTGTCTACTTGTCTGTTGTGACAGCTTAGTGCTTTTTTAGAAACCAACAATTAACTGTGACTAG
TGGGCTAACGTTACCTAATAATTGGTTCCATACTTGTTACTTTCCTCTTACCTCCTAATTACCTGTATTTTCTCTAG
GGATAGTGCACATGTATCCATGTTTAATTGGAGGATTTGCTGCTCTTTAAAAGGACAATAGATGTTTGATAGTATTT
AACTACCAAGTCCCTTGACATGTTAGTGGCTTCCTGTATTAGTCTGTCTCAATGGATTTTCCACATATATACATAAT
AAATAGTGGAAAAATATGTTGCCCTTGAAGAAGCAAAGAGCTGTTTGGTATGTAATTGTGAAGCATGTGTTGATAAA
ATGTTTAGTTTTATTGTTGTTAACCTGAGATATATAGATCTGACTTGTGAAGTACTTGCCTAACACACGGATGAATT
GGTCCACCTGATTTGCTCTTTGGAAACATAATGTATGCCTGCTTACCTGCCTTTGTTATTCTGTTCCAGTTTTAACT
CAAGTGTGCCTAGATGTGTTGATTATTTTCTGTATGTAGAAAGGAAGAAAGAAATTGATTGTCCACCTCTTGCAGGC
TGCAAACTATCTCAACATCAAGGGATGGGATTGCTGGATCTGAGTTGCGCAGACCGTTGCAGACATGATCAAGGGCA
AGACTCCGGAGGAAATCCGCAAGACCTTCAACATCAAGAAGGACTTGGCCCCTGAGGAGGAAGAGGAGATCCGCAGG
GAGAACCAGTGGGCGTTTGAGTAGAGATGCAGCAGCTGCTACATGTGGCCGGTCGGTTGCAATGGTTGTAATTATTT
TGGAGTGAGAATGAATGGTGGGGTGGGGGGGGGGGGTGTGGTTAGTGAAGGAAGGATGAAATGAAATGGGGGTTAGG
TTAACTAGCTGGTTTATGAAGTATGGGTATGGAAGGGAAAACAAAAACTGAAGATTGTTACTATAAGGATGTTATGT
GCGGCTGCCTAGACTGCAGTTGATATCGTCTGGTGGATGGATGATTTATTACTGGGATTATAAAGTCATCTGATTGT
CGTCCATTGTCTCAGTGTCTGTCTGTCTATCTATCTAATCTGTGCCGCAGTAGTGTTGGAGGAAGTGCCAGGTGGTG
AGGCAGCAGCGAGTCCAGGCCAAGCCTTGGCCTGGAGGAAAGAAAGAAAGAAAGATGATAAGGCGGCTGGGTGTGTC
TGGTCTCTCCTGGTGTTGGTTGCCACACGTATATTTGGGCCCCTTATCCATCCATGATTTTGTTTTGTTTTGCGAAT
AATTTTGGCGCCTCAAGTTAGCCGATAAAGTTGGGAGTAGTACACTAGTAGTATACTAGTAGTAGAGTGAGCTCAAG
ACAAGAAGCAGTAGCGAGTCCAAGGCAAGGCAAGGCAAGGCAGGCGAAAG(SEQ ID NO：1)
Embodiment 2: the structure of carrier-p8+P569 recombinant vectors
(catalog number (Cat.No.): operational manual DP103-03), the conversion that makes up from embodiment 1 have the cloning vector pMD18-T+P569 that extracts bacillus coli DH 5 alpha-P569 of promotor P569 with P569 promoter sequence of the present invention according to the little extraction reagent kit of the common plasmid of TIANGEN; Carry out enzyme with corresponding restriction enzyme KpnI and SbfI behind the purifying and cut, reclaim corresponding promotor Insert Fragment, and connect with the carrier large fragment that the p8 plasmid reclaims after with identical digestion with restriction enzyme respectively.
Gained is connected product p8+P569 recombinant vectors to be transformed according to " molecular cloning the experiment guide " (third edition, the competent cell DH5 α of the preparation of Calcium Chloride Method Science Press), be inverted for 37 ℃ and cultivate 16～24h, after son to be transformed grew bacterium colony, the picking mono-clonal carried out the PCR detection and enzyme is cut evaluation.
The p8 plasmid construction
Employed p8 plasmid is that (Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides by the pCAMBIA-1301 plasmid among the present invention; Perhaps can buy from for example auspicious Gene Tech. Company Limited of Shanghai state, the primary source of the pCAMBIA-1301 plasmid of the said firm is The CAMBIA Bios (biological open source) Licensee, Australia) transform in the following manner and make up, be described as follows:
With Kpn I/Nco I (NEB) double digestion plasmid pCAMBIA-1301 (referring to Fig. 1), reclaim large fragment.According to synthetic following sequence: the GGTACCAAGCTTACTAGTCCTGCAGGTCTAGAGGATCCGTCGACCATGG (SEQ ID NO:6) (restriction enzyme site that comprises is Kpn I/HindIII/Spe I/Sbf I/Pst I/Xba I/BamH I/Sal I/Nco I) of the restriction endonuclease sites that adopts, with reclaiming behind the Kpn I/Nco I double digestion, (Dong Yang of Kunming Institute of Zoology, Chinese Academy of Sciences provides to be connected the rear top10 of conversion cell with the above-mentioned large fragment that reclaims; Perhaps can be from for example: Suo Laibao Science and Technology Ltd. in Beijing buys).Screen transformant with primer GCTTCCGGCTCGTATGTTGT (SEQ ID NO:7)/GAGTCGTCGGTTCTGTAAC (SEQ ID NO:8), by the PCR detection method, be the transformant that the transformant of 350bp is the p8 plasmid that contains multiple clone site that needs make up and GUS sequence with amplified fragments.The P8 plasmid map is seen Fig. 2
Length 2353 bases of the multiple clone site in the described p8 plasmid and GUS sequence, shown in SEQ ID NO:9:
GTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGC
ACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGC
ACCCCAGGCTTTACACTTTAT
GTGGAATTGTGAGCGGATAA CAATTTCACACA
GGAAACAGCTATGACCATGATTAC
GAGCTC 
AAGCTT 
C 
G 
GGAT
CC
C
As above constructed p8 plasmid among the present invention shown in the sequence, EcoR I/Sac I/Kpn I/HindIII/Spe I/Sbf I/Pst I/Xba I/BamH I/SalI/Nco I restriction enzyme site in its multiple clone site is respectively with adding frame and underscore represents, the used primer GCTTCCGGCTCGTATGTTGT/GAGTCGTCGGTTCTGTAAC (being SEQ ID NO:7 and 8) of screening transformant represents with double underline, the GUS sequence represents that with italic its intron sequences adds shading with italic respectively and illustrates.
The structure of recombinant vectors p8+P569
According to restriction enzyme KpnI and SbfI operation instructions, according to resulting cloning vector pMD18-T+P569 in the following condition Processing Example 1, and the p8 plasmid that makes up as mentioned above.
Wherein, the enzyme tangent condition of cloning vector pMD18-T+P569 and p8 plasmid is as follows:
Enzyme is cut system: 50 μ l
Sterilized water 34.8 μ l
10*buffer H 5μl
KpnI 0.1μl(10U)
SbfI 0.1μl(10U)
Cloning vector pMD18-T+P569 or p8 plasmid 10 μ l (＜1000ng)
Use TIANGEN sepharose DNA to reclaim test kit (catalog number (Cat.No.): DP209-03) reclaim respectively the p8 plasmid of cutting through enzyme, and promotor P569 Insert Fragment, according to T4 ligase enzyme (TaKaRa, D2011A) operation instructions, connect according to following condition:
Linked system: 10 μ l
10*T4buffer 1μl
The promotor P569 Insert Fragment 10～20ng that reclaims determines according to its concentration
Sterilized water polishing to 9.5 μ l
T4 ligase(TaKaRa，D2011A) 0.5μl
T4buffer melts on ice, the about 20ng of p8 plasmid vector add-on after enzyme is cut, and the P569 fragment among the present invention adds 10ng.(the new sesame in Ningbo is SDC-6) more than the middle connection 8h at the energy-conserving intelligent thermostatic bath in 16 ℃.
The competent cell DH5 α that the 100l Calcium Chloride Method is made takes out from Ultralow Temperature Freezer, after melting, adds the connection product above the 10 μ l on ice, stir evenly gently ice bath 30min, 42 ℃ of heat shock 60s, ice bath 5min adds the SOC of 4 ℃ of precoolings of 600 μ l, 37 degree 220rpm recovery 45min, the centrifugal 30s of 8000rpm, remove supernatant, leave and take 150 μ l, blow gently even, granulated glass sphere coating LB (kan) is inverted for 37 ℃ and cultivates 16～24h.Obtain recombinant vectors p8+P569.
Detect as primer carries out PCR to gained recombinant vectors p8+P569 take F1 (being SEQ ID NO:4) and R1 (being SEQ ID NO:5) respectively, to contain required promotor P569 among the conclusive evidence gained recombinant vectors p8+P569.Cut screening by KpnI and SbfI enzyme and contain recombinant vectors p8+P569 transformant.
The preparation of embodiment 3 restructuring agrobacterium tumefaciens EHA105-P569 cells
With p8+P569 recombinant vectors and the p8 plasmid in contrast of method structure transform respectively according to " molecular cloning the experiment guide " (third edition as described in Example 2, the agrobacterium tumefaciens EHA105 of the method for calcium chloride Science Press) preparation (be 200910238992.0 at application number, denomination of invention is preservation in the patent application of " a kind of promotor BgIosP587, Preparation Method And The Use ", and open on September 22nd, 2010, deposit number is CCTCC NO:M 209315) competent cell, concrete grammar is as follows:
Agrobacterium tumefaciens competent cell EHA105 is taken out in Ultralow Temperature Freezer, as for thawing on ice.After the thawing, the p8+P569 recombinant vectors and p8 plasmid and the p8 empty carrier in contrast that add respectively 5 μ l, mixing gently, ice bath 10min, put into the freezing 5min of liquid nitrogen, 37 ℃ of 5min that thaw, the LB liquid nutrient medium that adds 800 μ l normal temperature, 28 ℃ of 160rpm recovery 3h, the centrifugal 30s of 8000rpm sucks supernatant, staying 200 μ l blows even, coat and be added with (50mg/lKan, 10mg/l Rif, the concrete explanation that vide infra of filling a prescription) on the two anti-YM culture medium flat plates of kan-rif (kantlex-Rifampin).Be inverted for 28 ℃ and cultivated 2-3 days.
Carry out PCR detects and cuts the screening transformant by the HindIII/SbfI enzyme take F1 (being SEQ ID NO:4) and R1 (being SEQ ID NO:5) as primer.
What pcr amplification went out that about 2900bp left and right sides band and enzyme cut out about 2900bp left and right sides band is the restructuring agrobacterium tumefaciens of recombinant vectors p8+P569.
Among the present invention, according to the restructuring Agrobacterium with recombinant vectors p8+P569 that obtains such as above-mentioned method, called after restructuring agrobacterium tumefaciens EHA105-P569.
According to the method for the invention, the contrast restructuring Agrobacterium with the p8 plasmid that obtains, called after restructuring agrobacterium tumefaciens EHA105-p8.
Embodiment 4: the inducing and transforming of Rice Callus
Inducing paddy rice callus in accordance with the following steps, and transform described callus with restructuring agrobacterium tumefaciens EHA105-P569 and restructuring agrobacterium tumefaciens EHA105-p8 respectively.
1) the fine seed of paddy rice Japan is shelled, 70% ethanol surface sterilization 30s, then with the clorox sterilization 30min of available chlorine 1.5%, during acutely shake, clean 5 times with aqua sterilisa after the sterilization; Seed after the sterilization is placed on the N6D substratum (the concrete explanation that vide infra of filling a prescription), seal with sealed membrane; 29.5 3～4 weeks of ℃ illumination cultivation;
2) choose active growth callus (yellow-white, drying, diameter 1～3mm), 29.5 ℃ of illumination cultivation are 3 days on new N6D substratum;
3) the constructed single bacterium colony of restructuring agrobacterium tumefaciens (restructuring agrobacterium tumefaciens EHA105-P569 or restructuring agrobacterium tumefaciens EHA105-p8) of picking such as embodiment 3 respectively, in adding microbiotic (50mg/l Kan, upper streak culture 3 days of YM substratum 10mg/lRif) (the concrete explanation that vide infra of filling a prescription), 28 ℃ of culture temperature; The above-mentioned restructuring agrobacterium tumefaciens of scraping places the AS (Acetosyringone that has added 30 μ l 100mM respectively, Syringylethanone) in the 30ml AAM substratum (the concrete explanation that vide infra of filling a prescription), gentle resuspended described restructuring agrobacterium tumefaciens cell (restructuring agrobacterium tumefaciens EHA105-P569 or restructuring agrobacterium tumefaciens EHA105-p8);
4) callus with succeeding transfer culture places the sterilization culture dish; To pour in the culture dish such as the restructuring agrobacterium tumefaciens suspension of step 3 preparation, callus will be immersed wherein 15min;
5) outwell restructuring agrobacterium tumefaciens suspension, callus is sopped up unnecessary liquid with sterilization thieving paper; On N6-AS substratum (prescription vide infra explanation), put a sterilization filter paper, add the AAM substratum of 1ml such as the above-mentioned AS of containing, callus is transferred on the filter paper; The sealing culture dish, 28 ℃ of dark 48～60h that cultivate;
6) infected callus is placed the 50ml sterile tube, shake cleaning with aqua sterilisa, until supernatant liquor becomes clarification; Callus is soaked in the sterilized water that contains 500mg/l Pyocianil (Carb) to kill the restructuring agrobacterium tumefaciens; Remove moisture unnecessary on the callus with sterilization thieving paper, then transfer them on the N6-AS substratum that contains 1mg/l hygromycin B (HmB) and 50mg/l Carb; Seal culture dish with sealed membrane, 29.5 ℃ of 3～4 weeks of illumination cultivation.
Embodiment 5: the expression of the GUS in the Rice Callus
For detecting the expression through goal gene GUS in the Rice Callus of embodiment 4 described conversions, according to Chen S Y etc. at Journal of Integrative Plant Biology, 2008,50 (6): the described method of 742-751, dye to the Rice Callus that transforms with restructuring agrobacterium tumefaciens EHA105-P569 or restructuring Agrobacterium EHA105-p8 respectively.
The prescription of GUS staining fluid (1ml): 610 μ l 0.2M Na
2HPO
4Solution (pH=7.0); 390 μ l 0.2M NaH
2PO
4Solution and 10 μ l 0.1M X-gluc.
The Rice Callus that transforms with restructuring agrobacterium tumefaciens EHA105-P569 or restructuring agrobacterium tumefaciens EHA105-p8 respectively is immersed in the GUS staining fluid, 37 ℃ of insulations are blue to occurring, take pictures, the result as shown in Figure 3, present blueness after the Rice Callus of the restructuring Agrobacterium-Mediated Transformation of the p8+P569 recombinant vectors through containing promotor (Fig. 3 is right) is dyed, Rice Callus (in contrast, Fig. 3 is left) color after GUS dyeing of the p8 plasmid restructuring Agrobacterium-Mediated Transformation through not containing promotor does not change.The result shows that P569 promotor of the present invention is expressed gus gene has regulating and controlling effect.
Embodiment 6: the expression of GUS in the transgenic paddy rice seedling
The callus that obtains among the embodiment 4 is transferred to MS-R division culture medium (concrete prescription sees Table 2) the differentiation seedling that contains 50mg/l hygromycin B (HmB); Seal culture dish with sealed membrane, 29.5 ℃ of illumination cultivation 3-4 weeks; Treat to transfer to when seedling grows to 3-4cm 1/2 MS root media (specifically filling a prescription referring to the table 3) screening of taking root that contains 50mg/l hygromycin B (HmB).
The GUS dyeing course of transgenic paddy rice seedling is with the dyeing course of callus among the embodiment 5.The result shows, present blueness after the root of the rice seedlings of the restructuring Agrobacterium-Mediated Transformation of the p8+P569 recombinant vectors through containing promotor and leaf are dyed, the root of the rice seedlings of the p8 plasmid restructuring Agrobacterium-Mediated Transformation through not containing promotor and leaf color after GUS dyeing do not change.The result shows that P569 promotor of the present invention is expressed gus gene has regulating and controlling effect.
Embodiment 7: GUS expresses in the transgene tobacco seedling
1. the tobacco aseptic seedling obtains:
● tobacco seed soaks: tobacco NC89 seed (was preserved in Luojiashan, Wuchang, Wuhan City, Hubei Province Wuhan University preservation center on November 12nd, 2010, it is Chinese Typical Representative culture collection center (CCTCC), deposit number is CCTCC No:P201017) in the centrifuge tube of the 1.5ml that packs into (＜50/pipe), add the 1ml sterilized water, beat several times with the pipettor suction, after changing sterilized water, soaked at normal temperatures 24 hours;
● tobacco seed sterilization: with the water of pipettor sucking-off immersion seed, add alcohol-pickled 30 seconds of 1ml 75%, with pipettor sucking-off alcohol; Add 1ml 10%H
2O
2Soak after 10 minutes, with pipettor sucking-off H
2O
2
● washing: use sterile water wash five times, add the 1ml sterilized water at every turn and shake 1min;
● inoculation: aseptic filter paper blots the moisture of seed-coat, be inoculated in upper sprouting of MS solid medium (prescription is referring to table 4) with suction nozzle or aseptic toothpick again, about 10 of every ware, place 28 ℃ of illumination cultivation chambers (16h light/8h is dark) to cultivate a week, intensity of illumination is 2000lx (this is tested all illumination cultivation materials and all cultivates under this intensity of illumination);
● switching: after growing seedling, change fresh MS solid medium over to, every bottle of (Φ 6cm, H 9cm, 30ml substratum/bottle) 3 strain tobacco seedlings, about 5 weeks are cultivated in 28 ℃ of illumination cultivation chambers (16h light/8h is dark), obtain the tobacco aseptic seedling.
2. the subculture of tobacco aseptic seedling and expansion are numerous
● cut off blade and the root of tobacco aseptic seedling, cane is cut into stem section (2cm-3cm) with axillalry bud, then its morphology lower end vertically is inserted into fresh MS solid medium (axillalry bud can not insert in the substratum);
● stem explants with axillalry bud of every bottle graft kind places 28 ℃ of illumination cultivation chambers to cultivate about 5 weeks, as materials'use to be transformed.
3. infect the preparation of front bacterium liquid:
● picking contains the single bacterium colony of agrobacterium strains EHA105 (the restructuring agrobacterium tumefaciens EHA105-P569 of embodiment 3 gained or restructuring agrobacterium tumefaciens EHA105-p8) of hygromycin resistance purpose plasmid, be inoculated into 10ml YM and (contain Kan 50mg/L, Rif 30mg/L) liquid nutrient medium, 28 ℃, the 250rpm shaken overnight, treat that bacterium liquid is muddy, when also precipitation not occurring, this bacterium liquid is put 4 ℃ of preservations;
● the bacterium liquid 20 μ l that go bail for and be stored in 4 ℃, be inoculated in 10ml YM (containing Kan 50mg/L, Rif 30mg/L) liquid culture based in the 50ml centrifuge tube 28 ℃, the 250rpm shaken overnight treats that bacterium liquid is muddy, when precipitation not occurring, stops to cultivate;
● get above-mentioned bacterium liquid 3ml and join 50mlYM (not containing microbiotic) liquid culture in triangular flask 28 ℃, about 2h, OD are cultivated in the concussion of 250rpm shaking table
600During=0.5 left and right sides, use as infecting bacterium liquid.
4. infect:
● the larger blade of clip on the tobacco aseptic seedling of cultivating for 5 weeks is kept in the culture dish that YM (not containing microbiotic) liquid nutrient medium is housed;
● the tapping and plugging machine with diameter 6mm breaks into leaf disc with tobacco leaf, is kept in another culture dish that YM (not containing microbiotic) liquid nutrient medium is housed;
● the tobacco leaf disk transferred to be equipped with in the culture dish that infects bacterium liquid;
● wave and culture ware gently, guarantee that Agrobacterium touches the leaf plate edge, soak 10min;
● the tobacco leaf disc that will infect is transferred to from agrobacterium suspension on the dry aseptic filter paper, blots bacterium liquid until tobacco leaf disc does not drip till the bacterium liquid;
● tobacco leaf disc is inoculated on the RMOP solid medium (prescription sees Table 5), the blade face up, about 10 of every ware;
● be inverted culture dish, 28 ℃ of dark cultivations 3 days.
5. screening:
● the leaf disc of step 4 is transferred on RMOP-TCH (10mg/L Hyg) substratum (prescription referring to table 6), 10 in every ware, the blade face up, 28 ℃ of 2 weeks of illumination cultivation;
● per 2 all subcultures once, Multiple Buds appears in about 4 weeks.
6. take root:
● when regeneration bud grows to about 1-2cm, downcut bud and be inoculated into MST-TCH (10mg/L Hyg) substratum (prescription is referring to table 7), every bottle of 1 strain tobacco seedling;
● 2 weeks were cultivated in 28 ℃ of illumination cultivation chambers;
Remove the little leaf of seedling base portion, transfer to fresh MST-TCH substratum, every bottle of 1 strain tobacco seedling cultivated for 2 weeks.Get respectively afterwards blade and root and carry out the GUS Coloration experiment, the same paddy rice of the prescription of GUS staining fluid and method.
The prescription of GUS staining fluid (1ml): 610 μ l 0.2M Na2HPO4 solution (pH=7.0); 390 μ l 0.2MNaH2PO4 solution and 10 μ l 0.1M X-gluc.
Transgenosis and contrast (not changing the empty carrier of goal gene over to) are immersed in respectively in the GUS staining fluid, and 37 ℃ of insulations are blue to occurring, Taking Pictures recording, and the result is shown in Fig. 4 A, 4B and 5.Present blueness after the root of the tobacco seedling of the restructuring Agrobacterium-Mediated Transformation of the p8+P569 recombinant vectors through containing promotor (Fig. 5 is right) and leaf (Fig. 4 B) are dyed, the root (in contrast, Fig. 5 is left) of the tobacco seedling of the p8 plasmid restructuring Agrobacterium-Mediated Transformation through not containing promotor and leaf (Fig. 4 A) color after GUS dyeing do not change.
Employed relevant culture medium prescription is described as follows in the embodiment of the invention:
Below in the relevant substratum alleged " conventional sterilization " refer to the sterilization of following condition: 121 ℃ of lower vapor sterilizations 20 minutes.
N6D substratum, YM liquid nutrient medium, YM solid medium, AAM substratum and N6-AS altogether substratum referring to table 2 in Chinese patent application " a kind of promotor BgIosP587, Preparation Method And The Use " (application number 200910238992.0, the publication No. CN101838647A) specification sheets to table 6.
Table 2 MS-R division culture medium:
Transfer pH value to 5.8, the usual manner sterilization.
Annotate: MS macro (20X): ammonium nitrate 33.0g, saltpetre 38.0g, potassium primary phosphate 3.4g, sal epsom 7.4g, calcium chloride 8.8g pursue-dissolving, then are settled to 1L with distilled water under the room temperature, 4 ℃ of preservations.
M8micro (1000X): manganous sulfate 16.90g, zinc sulfate 8.60g, boric acid 6.20g, potassiumiodide 0.83g, Sodium orthomolybdate 0.25g, copper sulfate 0.025g, cobalt chloride 0.025g, mentioned reagent is at room temperature dissolved and is settled to 1L with distilled water, 4 ℃ of preservations.
MS VITAMIN stock solution (1000X): vitamins B
10.010g, vitamins B
60.050g, nicotinic acid 0.050g, glycine 0.200g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations were no more than for 1 week.
Molysite (Fe
2EDTA) stock solution (100X): see table 2 in the Chinese patent application CN101838647A specification sheets.
Table 3 1/2MS root media
Transfer pH value to 5.8.
Annotate: MS macro (20X) sees Table 2.
MS micro (1000X) MS VITAMIN stock solution (1000X) sees Table 2.
Molysite (Fe
2EDTA) stock solution (100X): see table 2 in the Chinese patent application CN101838647A specification sheets.
Table 4 MS solid medium:
5.8 121 ℃ of lower sterilizations of pH 20 minutes
Annotate: MS macro (20X) sees Table 2.
MS micro (1000X) MS VITAMIN stock solution (1000X) sees Table 2.
Molysite (Fe2EDTA) stock solution (100X): see table 2 in the Chinese patent application CN101838647A specification sheets.
MS organic (1000x): VITMAIN B1,0.01g, vitamin B6,0.05g, nicotinic acid B1,0.05g, glycine, 0.2g, adding distil water is settled to 100ml, filtration sterilization, 4 ℃ of preservations were no more than for 1 week.
Myo-inositol (500x): after the 5g inositol is dissolved in H2O, be settled to 100ml, 4 ℃ of preservations.
Table 5 RMOP solid medium:
5.8 121 ℃ of lower sterilizations of pH 20 minutes
Annotate: MS macro (20X) sees Table 2.
MS micro (1000X) MS VITAMIN stock solution (1000X) sees Table 2.
Molysite (Fe
2EDTA) stock solution (100X): see table 2 in the Chinese patent application CN101838647A specification sheets.
Table 6RMOP-TCH substratum
5.8 121 ℃ of lower sterilizations of pH 20 minutes
Annotate: MS macro (20X) sees Table 2.
MS micro (1000X) MS VITAMIN stock solution (1000X) sees Table 2.
Molysite (Fe
2EDTA) stock solution (100X): see table 2 in the Chinese patent application CN101838647A specification sheets.
Myo-inositol (500x): see Table 5.
Table 7MST-TCH substratum:
Annotate: MS macro (20X) sees Table 2.
MS micro (1000X) MS VITAMIN stock solution (1000X) sees Table 2.
Molysite (Fe
2EDTA) stock solution (100X): see table 2 in the Chinese patent application CN101838647A specification sheets.
Above content is the further description of the present invention being done in conjunction with concrete embodiment, can not assert that implementation of the present invention is confined to these explanations.For the general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, can also make some simple deduction or replace, all should be considered as belonging to protection scope of the present invention.
Claims (22)
1. promotor, its nucleotide sequence perhaps is the nucleotide sequence with Seq ID No.1 complementation shown in Seq ID No.1.
2. a nucleic acid construct comprises promotor claimed in claim 1, and with the gene order that promotor is operatively connected, wherein said promotor is identical or different from described gene order source.
3. carrier, it is characterized in that: described carrier contains promotor claimed in claim 1 or nucleic acid construct claimed in claim 2.
4. the carrier of claim 3 is characterized in that: described carrier is the recombinant vectors that promotor claimed in claim 1 or nucleic acid construct claimed in claim 2 and pMD18-T or p8 plasmid obtain through restructuring.
5. reconstitution cell, it is characterized in that: described cell contains promotor claimed in claim 1 or nucleic acid construct claimed in claim 2 or claim 3 or 4 described carriers, and described reconstitution cell is recombinant Bacillus coli cells or restructuring agrobatcerium cell.
6. one group of primer pair, described primer obtains promotor claimed in claim 1 to being used for amplification, and it is characterized in that: two right primers of described primer are the sequence shown in Seq ID No:2 and the Seq ID No:3.
7. one group of primer pair; described primer obtains promotor claimed in claim 1 to being used for amplification; it is characterized in that two right primers of described primer also are connected with respectively restriction enzyme site and/or protection base at 5 ' end of sequence shown in Seq ID No:2 and the Seq ID No:3.
8. the primer of claim 7 pair is characterized in that two right primers of described primer are respectively the sequence shown in Seq ID No:4 and the Seq ID No:5.
9. the method for the promotor shown in the preparation SEQ ID NO:1 comprises
Take the fine genomic dna of paddy rice Japan as template, use the pair for amplification primer to increase, described amplimer designs for head and the tail respectively according to the sequence of SEQ ID NO:1 in the fine genomic dna of paddy rice Japan.
10. the method for claim 9 is characterized in that, described amplimer is the arbitrary described primer of claim 6-8 pair.
11. the method for genetic expression in the regulating plant, described method comprise, the nucleic acid construct of promotor claimed in claim 1 or claim 2 or the carrier of claim 3 or 4 or the restructuring agrobatcerium cell of claim 5 are imported plant.
12. the method for claim 11 is characterized in that, described importing plant is for importing plant callus.
13. the method for claim 11 is characterized in that, described plant is monocotyledons or dicotyledons.
14. the method for claim 13 is characterized in that, described plant is Oryza or Nicotiana.
15. the method for claim 14 is characterized in that, described plant is paddy rice or tobacco.
16. the method for claim 15 is characterized in that, described plant is the fine or tobacco NC89 of paddy rice Japan.
17. a method for preparing transgenic plant is included in and cultivates the restructuring agrobatcerium cell of claim 5 under the condition of effective generation plant or contain the promotor of claim 1 or plant callus or plant explants or the plant of the restructuring agrobatcerium cell of the carrier of the nucleic acid construct of claim 2 or claim 3 or 4 or claim 5.
18. the restructuring agrobatcerium cell of the carrier of the nucleic acid construct of promotor claimed in claim 1 or claim 2 or claim 3 or 4 or claim 5 or contain the promotor of claim 1 or the plant callus of the restructuring agrobatcerium cell of the carrier of the nucleic acid construct of claim 2 or claim 3 or 4 or claim 5 or plant explants or the plant purposes in destination gene expression or the plant breeding in regulating plant.
19. the purposes of claim 18 is characterized in that, described plant is monocotyledons or dicotyledons.
20. the purposes of claim 19 is characterized in that, described plant is Oryza or Nicotiana.
21. the purposes of claim 20 is characterized in that, described plant is paddy rice or tobacco.
22. the purposes of claim 21 is characterized in that, described plant is the fine or tobacco NC89 of paddy rice Japan.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010614893 CN102146388B (en) | 2010-12-30 | 2010-12-30 | BgIosP569 promoter, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010614893 CN102146388B (en) | 2010-12-30 | 2010-12-30 | BgIosP569 promoter, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102146388A CN102146388A (en) | 2011-08-10 |
| CN102146388B true CN102146388B (en) | 2013-02-27 |
Family
ID=44420859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010614893 Active CN102146388B (en) | 2010-12-30 | 2010-12-30 | BgIosP569 promoter, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102146388B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1063506A (en) * | 1990-05-18 | 1992-08-12 | 卢布里绍尔遗传学股份有限公司 | Be used for recombinant promoter in monocotyledons genetic expression |
| WO2007075925A2 (en) * | 2005-12-23 | 2007-07-05 | Arcadia Biosciences, Inc. | Promoter sequence obtained from rice and methods of use |
-
2010
- 2010-12-30 CN CN 201010614893 patent/CN102146388B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1063506A (en) * | 1990-05-18 | 1992-08-12 | 卢布里绍尔遗传学股份有限公司 | Be used for recombinant promoter in monocotyledons genetic expression |
| WO2007075925A2 (en) * | 2005-12-23 | 2007-07-05 | Arcadia Biosciences, Inc. | Promoter sequence obtained from rice and methods of use |
Non-Patent Citations (1)
| Title |
|---|
| 柏亚男等.水稻基因启动子OsBTF3p的克隆和启动活性分析.《中国农业科学》.2009,第42卷(第3期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102146388A (en) | 2011-08-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102146402B (en) | Promoter BgIosP594 , preparation method and application | |
| CN102146384B (en) | Promoter BgIosP573, preparation method and application | |
| CN102146389B (en) | BgIosP580 promoter, preparation method and application | |
| CN102146387B (en) | Promoter BgIosP 565, and preparation method and application thereof | |
| CN102146399B (en) | Promoter BgIosP581 as well as preparation method and application thereof | |
| CN102146397B (en) | BgIosP549 promoter, preparation method and application | |
| CN102146385B (en) | Promoter BgIosP576, and preparation method and use thereof | |
| CN102146391B (en) | Promoter BgIosP 520, preparation method and application thereof | |
| CN102146393B (en) | BGIosP515 promoter and application of BGIosP515 promoter | |
| CN102146407B (en) | Promoter BgIosP 534, and preparation method and application thereof | |
| CN102146388B (en) | BgIosP569 promoter, preparation method and application | |
| CN102146401B (en) | Promoter BgIosP 592, and preparation method and application thereof | |
| CN102146400B (en) | BgIosP585 promoter, preparation method and application | |
| CN102146403B (en) | Promoter BgIosP 596, and preparation method and application thereof | |
| CN102146396B (en) | Promoter BgIosP 552, and preparation method and application thereof | |
| CN102146395B (en) | Promoter BgIosP545 as well as preparation method and application thereof | |
| CN102146410A (en) | BgIosP526 promoter, preparation method and application of BgIosP526 promoter | |
| CN102146386B (en) | Promoter BgIosP557, preparation method and application | |
| CN102146398B (en) | Promoter BgIosP537, and preparation method and use thereof | |
| CN102146390B (en) | BgIosP517 promoter, preparation method and application of BgIosP517 promoter | |
| CN102146392B (en) | BgIosP516 promoter, preparation method and application of BgIosP516 promoter | |
| CN102146408B (en) | Promoter BgIosP 524, and preparation method and application thereof | |
| CN102146405B (en) | Promoter BgIosP529, and preparation method and use thereof | |
| CN102146394B (en) | Promoter BGIosP514 and use thereof | |
| CN102146409B (en) | Promoter BgIosP522 as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180131 Address after: 518124 Guangdong province Shenzhen City Dapeng Dapeng District Office Pengfei Road No. 7 Patentee after: Shenzhen Huada Sansheng Garden Technology Co., Ltd. Address before: North Road No. 146, building 11F-3 Industrial Zone in Yantian District of Shenzhen city of Guangdong Province in 518083 Patentee before: BGI-Shenzhen Co., Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191217 Address after: 518120 A205, Peng Fei Road, Dapeng street, Dapeng New District, Shenzhen, Guangdong, China, 7 Patentee after: Shenzhen Huada gene agriculture Holding Co., Ltd. Address before: 518124 Guangdong province Shenzhen City Dapeng Dapeng District Office Pengfei Road No. 7 Patentee before: Shenzhen Huada Sansheng Garden Technology Co., Ltd. |
|
| TR01 | Transfer of patent right |