CN101985052B - Skin substitute for automatically capturing endothelial progenitor cells and promoting vascularization and construction method thereof - Google Patents
Skin substitute for automatically capturing endothelial progenitor cells and promoting vascularization and construction method thereof Download PDFInfo
- Publication number
- CN101985052B CN101985052B CN 201010271002 CN201010271002A CN101985052B CN 101985052 B CN101985052 B CN 101985052B CN 201010271002 CN201010271002 CN 201010271002 CN 201010271002 A CN201010271002 A CN 201010271002A CN 101985052 B CN101985052 B CN 101985052B
- Authority
- CN
- China
- Prior art keywords
- skin substitute
- vascularization
- sdf
- graftskin
- survival rate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of tissue engineering and medical wound healing. The conventional skin substitute has low vascularization speed and low survival rate, and cannot be clinically popularized and applied after being grafted at present. The invention constructs a novel skin substitute capable of automatically capturing endothelial progenitor cells in peripheral blood and accelerating vascularization. A stroma cell derived factor 9HRE-CMV gene regulated by a hypoxic response element is used to transfect fibroblasts; epidermal cells and transgenic fibroblasts are implanted on both sides of a dermal scaffold respectively to form the sandwich skin substitute; and the skin substitute duly and moderately expresses and secretees SDF-1 alpha after being grafted, and endothelial progenitor cells (EPC) in the mediated peripheral blood are mediated to a skin substitute grafting place so as to promote the vascularization of the skin substitute and improve the survival rate after grafting. The skin substitute can obviously improve the chemotactic induction to the EPC and accelerates the vascularization of the skin substitute. The average survival rate of the skin substitute is 95 percent, while the average survival rate of the conventional skin substitute not containing the transgenic fibroblasts is 72 percent.
Description
Technical field
The present invention relates to organizational project and medical science wound repair technical field, be specifically related to a kind ofly can automatically catch endothelial progenitor cells of peripheral blood, promote the novel skin surrogate of vascularization, can obviously improve the transplanting success of Graftskin.
Background technology
Skin tissue engineering is through the development of more than 20 years, and the development of simple epidermic cell cultivation and transplanting, dermis scaffold and utilisation technology be maturation comparatively all, and successfully is applied to clinical.On this basis, the investigator has planted the epidermic cell of vitro culture in the dermis scaffold surface construction sandwich Graftskin that contains cuticular cellulose, attempts epidermal area and the skin corium of disposable repair deficiency.Yet, the sandwich Graftskin to be transplanted in deep burn cut the scab surface of a wound, anti-infection ability is poor, survival rate is low, and fluctuation is difficult to apply clinically between 0%～50%.One of key reason is that after Graftskin is transplanted, vascularization speed is slow.transplanting in early days, Graftskin blood is for poor, the cuticular cellulose nutrition supply is not enough, cause propagation slowly, death (the Caruso DM that comes off even, Schuh WH, Al-Kasspooles MF, et al.Culturedcomposite autografts as coverage for an extensive body surface area burn:casereport and review of the technology.Burns, 1999, 25 (8): 771-779.Scuderi N, OnestiMG, Bistoni G, et al.The clinical application of autologous bioengineered skinbased on a hyaluronic acid scaffold.Biomaterials, 2008, 29 (11): 1620-9.).Therefore, building the Graftskin that a kind of vascularization speed is fast, the transplanting survival rate is high is to need a urgent difficult problem that solves in skin tissue engineering research.
The endothelial progenitor cells (endothelial progenitor cells, EPC) that is present in peripheral circulation blood is the crucial participant that new vessel forms.at (after as tissue ischemia, operation on vessels of heart etc.) under certain pathological state, hypoxic-ischemic tissue local secretion CXCL12 α (stromal cell-derivedfactor-1 α, SDF-1 α), SDF-1 α is powerful chemoattractant (the Avci-Adali M of EPC, ZiemerG, Wendel HP.Induction of EPC homing on biofunctionalized vascular grafts forrapid in vivo self-endothelization-a review of current strategies.BiotechnolAdv.2010, 28 (1): 119-29), it by with specific receptors CXCR4 (the chemokineCXC receptor type 4 on EPC surface, CXCR4) combination, can prompting mobilization at short notice, EPC enters peripheral blood in marrow, and the migration of the EPC in the mediation peripheral blood, the hypoxic-ischemic tissue local of going back to the nest, thereby participated in (the Madeddu P of endothelialization again of angiogenesis and injured blood vessel, Kraenkel N, Barcelos LS, et al.Phosphoinositide 3-kinase gamma gene knockout impairs postischemicneovascularization and endothelial progenitor cell functions.Arterioscler ThrombVasc Biol, 2008, 28 (1): 68-76.).the investigator arrives the SDF-1a gene transfection of plasmid DNA coding in the mouse ischemic limb, observe that in the peripheral blood of transfection mouse, EPC increases, the ishemic part capillary density increases, the blood perfusion amount is obviously recovered (Hiasa K, Ishibashi M, Ohtani K, et al.Gene transfer ofstromal cell-derived factor-1alpha enhances ischemic vasculogenesis andangiogenesis via vascular endothelial growth factor/endothelial nitric oxidesynthase-related pathway:next-generation chemokine therapy for therapeuticneovascularization.Circulation, 2004, 25, 109 (20): 2454-61.).and directly the EPC kind of separating in peripheral blood is planted the dermis scaffold surface, transplant after vitro culture, visible vesselsization is obviously accelerated, and confirm that the EPC that transplants has participated in local new vessel formation simultaneously and this two kinds of revascularization process (Kung EF occur the stem cell blood vessel, Wang F, Schechner JS.In vivo perfusion of human skinsubstitutes with microvessels formed by adult circulating endothelial progenitorcells.Dermatol Surg, 2008, 34 (2): 137-46.Shepherd BR, Enis DR, Wang F, et al.Vascularization and engraftment of a human skin substitute using circulatingprogenitor cell-derived endothelial cells.FASEB J, 2006, 20 (10): 1739-41.).Therefore, the discovery and application of EPC provides new thinking for the revascularization of organizational project organ.
Yet, because the method for separating, cultivating from body EPC is not yet ripe, make the application of EPC be subject to great restriction.Both enabled the EPC of capacity that cultivates, increases, be inoculated into dermis scaffold surface cultivation, the EPC poor adhesion, survival rate is low, and easily cause differentiation of stem cells after long-time the cultivation, lose vasculogenesis ability (Hofmann NA, Reinisch A, Strunk D.Isolation and large scale expansion of adulthuman endothelial colony forming progenitor cells.J VisExp.2009; 28 (32): 1524-29).Therefore, adopt the method for traditional separation, cultivation and transplanting EPC to promote the vascularization of Graftskin to have various technical bottlenecks.
Summary of the invention
The object of the invention is to build the Graftskin that a kind of vascularization speed is fast, the transplanting survival rate is high.
The present invention's imagination: if make Graftskin high expression level SDF-1a, can mediate rapidly EPC migration, the Graftskin transplantation site of going back to the nest in peripheral blood by the SDF-1/CXCR4 axle so, accelerate vascularization, improve the transplanting survival rate.Thereby the multiple deficiency of avoiding EPC in-vitro separation, cultivation, transplanting to bring.
technical scheme of the present invention is to pass through Gene transfer techniques, built a kind of high expression level CXCL12 α (stromal cell-derived factor-1 α, SDF-1 α) Graftskin, can discharge SDF-1 α after transplanting, with (the endothelial progenitor cells of endothelial progenitor cells in peripheral blood, EPC) surface specific receptor CXCR 4 (chemokine CXC receptor type 4, CXCR4) combination, thereby the rapid migration of mediation EPC, the Graftskin transplantation site of going back to the nest, accelerate vascularization, improve the transplanting survival rate.Specifically inoblast is arrived in CXCL12 α (SDF-1 α) gene transfection of hypoxemia response element regulation and control, then epidermic cell and genetically modified inoblast are planted respectively dermis scaffold two sides formation sandwich Graftskin, after transplanting in good time, moderately express, secrete SDF-1 α, promote the vascularization of Graftskin, improve the transplanting survival rate.
The invention provides the construction process that the automatic capturing endothelial ancestral cell of a kind of energy promotes the Graftskin of vascularization, the method comprises the steps:
1. separation, cultivator epithelial cells, inoblast (reference: Liu Dewu, Li Guohui, Zou Ping, Liu Deming. epidermic cell, the compound acellular dermal matrix of inoblast build organization engineering skin. the Chinese Clinical rehabilitation, 2004,8 (8): 1439-1441.);
2. build the carrier that contains SDF-1 α genetic expression, expression vector is pcDNA3.1-SDF-1 α;
3. build the SDF-1 α expression vector that the hypoxemia response element is controlled, and the transfection inoblast;
4. build and contain the fibroblastic Graftskin of epidermic cell-transgenosis.
Construction process concrete steps of the present invention are as follows:
1. separation, cultivator epithelial cells, inoblast:
The utilization discarded prepuce tissues of postoperative of peritomizing adopts enzyme digestion to separate, cultivate epithelial cells, inoblast.
2. build the expression vector that contains SDF-1 α gene
Clone SDF-1 α gene and order-checking from people's endotheliocyte, SDF-1 α gene is inserted the pcDNA3.1 carrier, obtain pcDNA3.1-SDF-1 alpha expression carrier.
3. build the SDF-1 α expression vector that the hypoxemia response element is controlled
Adopt Protocols in Molecular Biology, obtain multiple copied hypoxemia response element promotor (9HRE-CMV), and be connected with SDF-1 α gene segment, insert the pcDNA3.1 carrier, build the SDF-1 α expression vector that the hypoxemia response element is controlled: pcDNA3.1-9HRE-CMV-SDF-1 α carrier.
4.pcDNA3.1-9HRE-CMV-SDF-1 α expression vector transfection inoblast
Utilize the inoblast of Lipofectamine 2000 mediation pcDNA3.1-9HRE-CMV-SDF-1 α carrier transfection vitro culture.
5. build and contain the fibroblastic Graftskin of epidermic cell-transgenosis
Take dermis scaffold as carrier, plant respectively the inoblast of epidermic cell and the transfection 9HRE-CMV-SDF-1 α gene of vitro culture in its two sides, form the sandwich Graftskin after vitro culture.
Dermis scaffold commonly used has acellular dermal, collagen sponge membrane, hyaluronic acid membrane and poly(lactic acid)/polyglycolic acid film etc. clinically.
The present invention also provides the Graftskin that builds according to aforesaid method.
The present invention also provides the application as the wound repair graft materials of the Graftskin that builds according to aforesaid method.
The present invention has carried out obvious improvement to the method for currently used acceleration Graftskin vascularization.Traditional method is to separate cultured and amplified in vitro after EPC from peripheral blood, then plantation is to the surface of Graftskin, thus accelerate Graftskin transplant after vascularization.The present invention has built the Graftskin of expressing SDF-1 α gene product, after transplanting, this Graftskin mediates rapidly EPC migration, the Graftskin transplantation site of going back to the nest in peripheral blood by the SDF-1/CXCR4 axle, accelerate vascularization, avoided the various deficiencies of conventional separation, cultivation, plantation EPC.In addition, this Graftskin with hypoxemia response element (HRE) as oxygen condition genetic expression trip switch, the expression of regulation and control SDF-1 α gene and closing, namely Graftskin is not before vascularization, under anaerobic environment, be subjected to the regulation and control of HRE, SDF-1 α effective expression, and after vascularization, Graftskin is under normal oxygen condition, the expression of goal gene is ended at once, has improved the security of gene therapy.
Prove through animal implant tests textured, novel skin surrogate of the present invention is compared with not containing genetically modified Graftskin, can obviously improve the chemotactic of human peripheral blood EPC cell and induce, and accelerates the vascularization of Graftskin, and the transplanting survival rate brings up to 95% by 72%.
Description of drawings
Fig. 1 is pcDNA3.1-9HRE-CMV-SDF-1 α vector construction schematic diagram.
Embodiment
Now in conjunction with the embodiments and accompanying drawing, the invention will be further described, but enforcement of the present invention is not limited in this.
Embodiment 1. preparations are the novel skin surrogate of capturing endothelial ancestral cell promotion vascularization automatically
1. separation, cultivator epithelial cells, inoblast:
The utilization discarded prepuce tissues of postoperative of peritomizing adopts enzyme digestion to separate, cultivate epithelial cells, inoblast.Be prepared into respectively single cell suspension, press 2-3 * 10
5Individual/ml cell density is inoculated in culturing bottle, be placed in 37 ℃ of incubators, epithelial cells is cultivated (DK-SFM with serum free medium, Gibco, the U.S.), inoblast is cultivated with perfect form DMEM nutrient solution (Gibco, the U.S.), goes down to posterity, increases when 70%-80% merges when cell reaches.
2. build the carrier that contains SDF-1 α genetic expression
The sequence of SDF-1 α gene:
ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGTAA
Design primer: upstream primer 5 '-CGGGATCCATGAACGCCAAGGTCG-3 '
Downstream primer 5 '-GGAATTCGGACCTCTTTCGAAATTTGTTCATT-3 '
mRNA in extraction people's endotheliocyte, obtain cDNA by the RT-PCR reverse transcription, obtain SDF-1 α by specific primer PCR, test kit reclaims the PCR product, connect pMD-18T (TaKaRa), do conversion, after extracting plasmid, enzyme is cut evaluation, choose correct plasmid and send company order-checking (entrust Invitrogen company order-checking), after order-checking is correct, use BamH I, EcoR I comes digested plasmid pMD-18T-SDF-1 α, obtain having the SDF-1 α gene of sticky end, with the T4 ligase enzyme with SDF-1 α gene with used BamH I, pcDNA3.1 (+) the plasmid link that EcoR I enzyme cuts, transform intestinal bacteria, extract plasmid pcDNA3.1-SDF-1 α, send the order-checking of Invitrogen company to identify, obtain pcDNA3.1-SDF-1 alpha expression carrier.
3. build the SDF-1 α expression vector that the hypoxemia response element is controlled
Multiple copied hypoxemia response element promotor (9HRE-CMV) trust Invitrogen company builds, add the KpnI restriction enzyme site with round pcr at the gene 5 ' end, 3 ' end adds BamH I restriction enzyme site, be connected with pcDNA3.1 (+) carrier after enzyme is connected with SDF-1 α gene after enzyme is cut, build the SDF-1 α expression vector that the hypoxemia response element is controlled: pcDNA3.1-9HRE-CMV-SDF-1 α carrier (as shown in Figure 1).
4.pcDNA3.1-9HRE-CMV-SDF-1 α expression vector transfection inoblast
Transfection the day before yesterday, trypsin digestion cell and counting, the cell bed board, make its transfection day density be 90%.The cell bed board contains serum at 0.5ml, does not contain in the substratum of antibiotic normal growth.For every porocyte, use 50 μ l serum free medium dilution 0.8 μ g-1.0 μ g DNA.For every porocyte, use 50 μ l OPTI-MEM I substratum dilution 1 μ l-3 μ l LIPOFECTAMINE 2000 reagent.After Lipofectamine 2000 dilutions, (the pcDNA3.1-9HRE-CMV-SDF-1 α of same dilution mixed in 30 minutes, and soaking time is long can reduce activity in 5 minutes in insulation.) DNA (the 2nd step) of mixed diluting and the Lipofectamine 2000 (the 3rd step) of dilution.Room temperature insulation 20 minutes.Directly mixture is joined in every hole wave and culture plate, mixing gently.At 37 ℃, 5% CO
2Middle insulation 24-48 hour need not be removed mixture or replaced medium or change growth medium and also can not reduce transfection activity after 4-5 hour.Add mixture 24-72 hour in cell after, analysis of cells extract or carry out the original position cell dyeing, the examining report gene activity.This depends on cell type and promoter activity.To stably express, the beginning transfection after one day with passage to fresh culture, add two days later the screening microbiotic.Carry out stably express and need a couple of days or several weeks.
5. build and contain the fibroblastic Graftskin of epidermic cell-transgenosis
Collagen sponge membrane (PELNAC, the prefecture is company limited, Japan) is laid on culture plate, with the inoblast of transfection pcDNA3.1-9HRE-CMV-SDF-1 α with 1-3 * 10
5Individual/cm
2Density plant in collagem membrane surface, in vitro culture 1-2 days.With collagem membrane upset, the plantation inoblast faces down subsequently, to the side with 3-5 * 10
5Individual/cm
2Density inoculation epithelial cells, after cytogamy, carry out liquid-vapo(u)r interface and cultivated for 2 weeks, changed liquid once in every 2～3 days, form and contain the fibroblastic sandwich Graftskin of epidermic cell-transgenosis.
The zoografting test of embodiment 2. Graftskins of the present invention
Male Balb/c-nu mouse (nude mice, Shanghai west pul-Bi Kai laboratory animal company limited provide), body weight 18 ± 2 grams, 40, being divided into is four groups.Be respectively and contain the fibroblastic Graftskin of transfection SDF-1 α gene, contain the transfection end and add the fibroblastic Graftskin of pcDNA3.1-9HRE-CMV-SDF-1 α, contain the Graftskin of the normal fibroblast of fibroblastic Graftskin of transfection empty carrier and untransfected gene.
Nude mice is shaved except the skin of back hair after the ketamine intraperitoneal anesthesia, and excision backbone inclined to one side veutro section's holostrome skin and deep fascia reach muscle layer.The viable skin surrogate through vitro culture 2-3 week described in embodiment 1 is transplanted in the surface of a wound.All skin shrinks and epidermis is creeped in order to prevent from creating, and the observation of result is transplanted in impact, adopts cage ring that the surface of a wound and peripheral skin are isolated.Cover oil-sand on Graftskin, periodic replacement dressing is also observed the wound healing situation.Draw materials respectively after 1,3,6,9,12,14 day after transplanting and observe vascularization, survival rate and newborn skin histology.
Result shows, novel skin surrogate of the present invention can obviously improve induces the chemotactic of EPC cell, accelerates the vascularization of Graftskin, and average survival rate reaches 95%, and tradition not contain the average survival rate of the fibroblastic Graftskin of transgenosis be only 72%.
Sequence table
SEQUENCE LISTING
＜110〉Second Military Medical University, PLA
＜120〉automatic capturing endothelial ancestral cell promotes Graftskin and the construction process thereof of vascularization
＜130〉specification sheets, claims
<140>201010271002.6
<141>2010-08-31
<160>3
<170>PatentIn version 3.3
<210>1
<211>270
<212>DNA
＜213〉artificial sequence
<400>1
atgaacgcca aggtcgtggt cgtgctggtc ctcgtgctga ccgcgctctg cctcagcgac 60
gggaagcccg tcagcctgag ctacagatgc ccatgccgat tcttcgaaag ccatgttgcc 120
agagccaacg tcaagcatct caaaattctc aacactccaa actgtgccct tcagattgta 180
gcccggctga agaacaacaa cagacaagtg tgcattgacc cgaagctaaa gtggattcag 240
gagtacctgg agaaagcttt aaacaagtaa 270
<210>2
<211>24
<212>DNA
＜213〉artificial sequence
<400>2
cgggatccat gaacgccaag gtcg 24
<210>3
<211>32
<212>DNA
＜213〉artificial sequence
<400>3
ggaattcgga cctctttcga aatttgttca tt 32
Claims (3)
1. the automatic capturing endothelial ancestral cell of an energy promotes the construction process of the Graftskin of vascularization, and the method comprises the steps:
A) separation, cultivator epithelial cells, inoblast;
B) build the carrier that contains SDF-1 α genetic expression;
C) build the SDF-1 α expression vector that the hypoxemia response element is controlled, and the transfection inoblast;
D) structure contains the fibroblastic Graftskin of epidermic cell-transgenosis.
2. the Graftskin that builds of the method for claim 1.
3. the application of Graftskin as claimed in claim 2 in preparation wound repair graft materials.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010271002 CN101985052B (en) | 2010-08-31 | 2010-08-31 | Skin substitute for automatically capturing endothelial progenitor cells and promoting vascularization and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010271002 CN101985052B (en) | 2010-08-31 | 2010-08-31 | Skin substitute for automatically capturing endothelial progenitor cells and promoting vascularization and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101985052A CN101985052A (en) | 2011-03-16 |
| CN101985052B true CN101985052B (en) | 2013-11-06 |
Family
ID=43709482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010271002 Expired - Fee Related CN101985052B (en) | 2010-08-31 | 2010-08-31 | Skin substitute for automatically capturing endothelial progenitor cells and promoting vascularization and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101985052B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104173252B (en) * | 2014-07-29 | 2018-09-14 | 蔡贤芬 | A kind of biological beauty preparation of the cell containing autologous substrate |
| ES2864373T3 (en) | 2014-12-23 | 2021-10-13 | Ilya Pharma Ab | Methods for healing |
| CN106511384A (en) * | 2016-11-08 | 2017-03-22 | 广州医科大学附属第三医院 | Freeze-dried powder used for promoting healing of diabetic wound and preparing method thereof |
| CN107320781B (en) * | 2017-07-11 | 2020-03-10 | 广州润虹医药科技股份有限公司 | Tissue engineering skin containing living cells and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1343523A (en) * | 2000-09-19 | 2002-04-10 | 中国人民解放军第二军医大学 | Millipore non-cell xanoepidermis substitute |
| CN1822846A (en) * | 2003-03-28 | 2006-08-23 | 成血管细胞系统公司 | Perivascular mesenchymal precursor cell induced blood vessel formation |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005074836A1 (en) * | 2004-01-29 | 2005-08-18 | Brown University | Methods for progenitor cell recruitment and isolation |
-
2010
- 2010-08-31 CN CN 201010271002 patent/CN101985052B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1343523A (en) * | 2000-09-19 | 2002-04-10 | 中国人民解放军第二军医大学 | Millipore non-cell xanoepidermis substitute |
| CN1822846A (en) * | 2003-03-28 | 2006-08-23 | 成血管细胞系统公司 | Perivascular mesenchymal precursor cell induced blood vessel formation |
Non-Patent Citations (2)
| Title |
|---|
| Ex Vivo Priming of Endothelial Progenitor Cells With SDF-1 Before Transplantation Could Increase Their Proangiogenic Potential;Faouzia Zemani etal;《Arteriosclerosis Thrombosis and Vascular Biology》;20080131;第643-660页 * |
| Faouzia Zemani etal.Ex Vivo Priming of Endothelial Progenitor Cells With SDF-1 Before Transplantation Could Increase Their Proangiogenic Potential.《Arteriosclerosis Thrombosis and Vascular Biology》.2008, |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101985052A (en) | 2011-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Atala | Regenerative medicine strategies | |
| Atala | Engineering organs | |
| Masuda et al. | Cell sheet engineering for heart tissue repair | |
| US9220810B2 (en) | Mesenchymal stem cells (MSC) expansion methods and materials | |
| Siepe et al. | Construction of skeletal myoblast‐based polyurethane scaffolds for myocardial repair | |
| Voigt et al. | Cultured epidermal keratinocytes on a microspherical transport system are feasible to reconstitute the epidermis in full-thickness wounds | |
| CN105820998A (en) | Isolation extraction and culture method for human adipose-derived stem cells (ADSCs) for clinical back-transfusion grade cell therapy | |
| CN101985052B (en) | Skin substitute for automatically capturing endothelial progenitor cells and promoting vascularization and construction method thereof | |
| Tee et al. | Strategies in cardiac tissue engineering | |
| CN104087551A (en) | Novel method for in-vitro separated culture of human epidermal cells | |
| Li et al. | Stem cells cardiac patch from decellularized umbilical artery improved heart function after myocardium infarction | |
| CN101353644B (en) | Vascular endothelial cells, and preparation and use thereof | |
| CN107254431B (en) | Novel tissue engineering skin preparation method | |
| Saxena | Esophagus tissue engineering: designing and crafting the components for the “hybrid construct” approach | |
| CN105925609A (en) | Marker gene-containing Tet-on induced over-expression recombinant vector and construction method thereof | |
| US20210196861A1 (en) | Method for producing regenerated hair follicle primordium | |
| CN103893831A (en) | Organ-type artificial skin as well as preparation method and application thereof | |
| CN1772885B (en) | Method of inducing stem cell to differentiate into pancreatic island-like cell and application of pancreatic island-like cell | |
| Zhang et al. | Regenerative medicine of the bladder | |
| CN113416690B (en) | Tissue engineering skin capable of being vascularized rapidly and construction method thereof | |
| Wu et al. | Stem cells for tissue engineering of myocardial constructs | |
| Hakim et al. | Use of biodegradable mesh as a transport for a cultured uroepithelial graft an improved method using collagen gel | |
| KR101046158B1 (en) | Cell delivery system for the cell therapy comprising cells derived from embryonic stem cells | |
| CN101182547A (en) | Composite skin taking hair follicle stem cells as seed cell and construction method thereof | |
| CN106962274A (en) | A kind of organization engineering skin repairs the experiment research of nude mice full thickness dermal |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20131106 Termination date: 20160831 |