CN101748074A - Recombined monascus purpureus with characteristics of low citrinin expression and high haematochrome expression - Google Patents

Abstract

The invention relates to recombined monascus purpureus with the characteristics of low citrinin expression and high haematochrome expression. A bacterial strain is named purple monascus ZD19 and is preserved in CCTCC (China Center for Type Culture Collection), and the CCTCC NO. is M 208199. Citrinin on a genome synthesizes a relevant gene ctnR which is removed through knocking, monascus polyketone synthesizes a pksl gene sequence of an enzyme gene so as to replace a ctnR gene sequence, and the genome of the monascus purpureus does not contain an external source resistance gene. The invention further provides a preparation method for the monascus purpureus. The preparation method includes the following steps: the monascus polyketone synthesizes the pksl gene sequence of the enzyme gene, and the citrinin in the genome of the monascus purpureus is replaced by the homologous recombination method so as to synthesize the relevant gene ctnR, and then screening is carried out on a target recombinant by utilizing the restraining characteristic of the citrinin against bacillus subtilis as a genetic mark. The invention further provides a purpose of using the monascus purpureus to prepare monascus color.

Description

Recombined monascus purpureus with low citrinin expression and high haematochrome expression characterization

Technical field

The invention belongs to microorganism field and genetically engineered field, the monascus ruber that relates to a kind of new genetic modification, especially a kind of have low citrinin and express monascus ruber with the high haematochrome expression characterization, and relate to the preparation method of this monascus ruber, and the purposes of this monascus ruber.

Background technology

Monascus parpureus Went (Monascus purpureus) is the important production bacterium of food dye and blood lipid-lowering medicine, and its fermented product red colouring agent for food, also used as a Chinese medicine is also usually directly edible.This bacterium has been used for productions such as foodstuff additive monascorubin, anti-lipid medicine lovastatin.

From Blanc etc. (1995, Int.J.Food Microbiol.27 (2-3): 201-213) determine that by methods such as mass spectroscopy antibacterial substance monascidin A in the monascus pigment is Citrinin since, the edible safety of red colouring agent for food, also used as a Chinese medicine is under suspicion, and the sale of red colouring agent for food, also used as a Chinese medicine related products has been produced influence.Citrinin is a kind of fungal secondary metabolite of polyketone class, has chronic renal toxicity and hepatotoxic effect to comprising human vertebrates.Citrinin content is compared generally with international standard and is exceeded standard in China's monascorubin, and the international popularity and the export trade of China's traditional food additive haematochrome are made a big impact.

In order to reduce the Citrinin output of monascus product, some investigators have begun to carry out the strain improvement of monascus and the improvement research of production technique in recent years.Improvement by culture condition or technology may make citrinin content reduce, but this method is not the most safe and effective means, because the generation synchronously always of products such as Citrinin and haematochrome, they belong to polyketides, and similar route of synthesis is arranged.

Someone uses traditional breeding way monascus ruber is carried out genetic breeding, as obtaining some bacterial strain than low citrinin (Wang Yafen and Yuan Kangpei by physical method (uviolizing etc.) and chemical process (EMS etc.) mutagenesis, 2003, Food science, 24 (8): 93-96), but because traditional mutagenesis majority does not have completely destroy Citrinin synthetic gene, the possibility of its reverse mutation obviously exists.(Wang?et?al.2003，JInd?Microbiol?Biotechnol，30(11)：669-676；Wang?et?al.，2004，J.Agric?FoodChem.，52(23)：6977-6982)

The another kind of breeding method of monascus ruber is a genetic engineering breeding, i.e. molecular breeding.Shimizu etc. (2005, Appl.Environ.Microbiol.71 (7): 3453-3457), Zhou Lihong etc. (2005, Southern Yangtze University's Ph D dissertation) and Fu etc. (2007, Asia Pac.J.Clin.Nutr.suppl.1:137-142) all knock out and obtain to reduce the effect of Citrinin at Citrinin synthetic gene pksCT; Shimizu in 2007 etc. (2007, Appl.Environ.Micrbiol.73 (16): 5097-5103) knocking out aim target to pksCT gene transcription incitant ctnR gene, also the be reduced effect of Citrinin output of result.But the problem of these methods is: integrated drug resistance genes such as Totomycin in the genetic manipulation, will produce food safety and ecological safety secret worry if be used for producing; And/or knocking out of pksCT can influence the synthetic of haematochrome or lovastatin useful products such as (lovastatin), because the route of synthesis of Citrinin route of synthesis and haematochrome, lovastatin has substantial connection.

Summary of the invention

The purpose of this invention is to provide a kind of monascus ruber with low citrinin expression and high haematochrome expression characterization.

A kind of recombined monascus purpureus of the present invention with low citrinin expression and high haematochrome expression characterization, this bacterial strain called after monascus parpureus Went ZD19, be Monascus purpureus ZD19, be preserved in Chinese typical culture collection center, deposit number is CCTCC NO:M 208199, the Citrinin synthesis related gene ctnR gene that exists on its genome is knocked out, replace the ctnR gene order by monascus polyketide synthases gene pks1 gene order, and do not contain the external source resistant gene in the genome of this obtained strains.

The present invention also provides a kind of preparation method with monascus ruber of low citrinin expression and high haematochrome expression characterization.

The preparation method of recombined monascus purpureus of the present invention, may further comprise the steps: replace Citrinin synthesis related gene ctnR gene in the monascus ruber genome by the homologous recombination mode with monascus polyketide synthases gene pks1 gene order, utilize Citrinin the inhibition feature of Bacillus subtilus to be carried out the screening of target recon as genetic marker then, the monascus bacterium colony that selection does not have inhibition zone or inhibition zone to diminish to Bacillus subtilus, thus described monascus ruber obtained with low citrinin expression and high haematochrome expression characterization.

The present invention also provides a kind of purposes with recombined monascus purpureus of low citrinin expression and high haematochrome expression characterization, is about to the purposes that described monascus ruber is used to prepare monascorubin.

The present invention is under information biology instructs, use overlapping extension PCR (gene splicing byoverlap extension PCR, SOE PCR) technology prepares the amorphs fragment at the activating transcription factor ctn R two ends of Citrinin synthase gene pksCT, method by restriction enzyme mediation (REMI) transforms monascus sporoplasm body, realizes knocking out of this activating transcription factor by genome homologous recombination principle.Transformant screens by the resistance to subtilis of Citrinin self, and whole process does not relate to any antibiotic marker.High performance liquid chromatography and look valency analysis revealed, engineering strain has the haematochrome content of lower citrinin content and Geng Gao.

The monascus ruber of genetic modification of the present invention has following characteristics and advantage:

(1),, replaces or part has replaced the transcription activator gene ctnR of Citrinin synthetic gene pksCT by homologous recombination with self polyketone synthetic gene pks1 fragment as an alternative.

In the document of having reported, all be to adopt drug resistance genes such as drug resistance gene such as Totomycin to be used as replacing segment, though be convenient to detect the bacterial strain of sudden change like this, but integrated drug resistance genes such as Totomycin in the genetic manipulation, will produce food safety and ecological safety secret worry if be used for producing; And because the route of synthesis of Citrinin route of synthesis and haematochrome, lovastatin has substantial connection, the scheme of knocking out of this pksCT can influence the synthetic of useful products such as haematochrome or lovastatin, so the new bacterial strain using value of gained is little.And the present invention has adopted new mentality of designing, has replaced the transcription activator gene ctnR of Citrinin synthetic gene pksCT with the synthetic relevant polyketone synthetic gene pks1 sequence of the non-Citrinin of self, filters out the clone that bacteriostasis reduces then.New departure of this Citrinin gene knockout both can destroy transcribing of Citrinin synthase gene, did not influence again even may strengthen the synthetic of monascorubin.

(2) in the gene knockout operation, do not need to integrate the genetic marker of drug resistance gene as the screening recombinant chou, the antagonistic property that detects dependence Citrinin itself of target recombinant chou.The present invention has utilized Citrinin that the bacteriostatic action of Bacillus subtilus is realized that recombinant bacterial strain dwindles the subtilis inhibition zone or disappear and be the sign of Citrinin gene knockout to the eliminating of wild-type.That reports so far does not all use screening method of the present invention to the pksCT of this bacterium or the experiment that knocks out of ctnR gene, and uses drug resistance marker's screening more.

(3) the recombinant bacterial strain citrinin content of Huo Deing descends greatly than former bacterial strain, and monascorubin output is not affected, and raises to some extent on the contrary.In existing report, the bacterial strain of Citrinin gene knockout gained generally causes the decline of haematochrome output.And according to experiment of the present invention, the Citrinin generation of new recombinant bacterial strain descends 55% approximately than the Citrinin generation of wild strain, and not weakening the generation of monascorubin, the haematochrome generation increases on the contrary to some extent than wild strain, increases up to 33% or higher.

Description of drawings

Fig. 1 is ctnR gene knockout principle of the present invention and schematic flow sheet;

Fig. 2 is that the electrophoresis of the PCR product of each gene fragment of being used to recombinate is identified collection of illustrative plates; Among the figure, M1 is molecular weight marker DL2000; M2 is molecular weight marker DL15000; 1,3 is respectively the previous section (A) and the aft section (B) of ctnR gene; 2 for being used to replace the pks1 part (C) of ctnR gene; 4 is A+C; 5 is B+C; 6 is fusion gene (A+C+B);

Fig. 3 is the acquisition and the fermentation schema of reorganization monascus of the present invention;

Fig. 4 is the correlated series figure of recon Molecular Identification of the present invention.The 6th capable the 24th base from left to right begins to be primers F 2 (41bp) among the figure, and the end sequence of the sequence of its front and C fragment (pks1) is in full accord, and sequence thereafter and B fragment are in full accord, show that the ctnR sequence in B left side is replaced by the pks1 sequence.

Embodiment

Knocking out of embodiment one monascus ruber ctnR gene

1, monascus genomic dna preparation

Adopt the general monascus strain TY0701 of fermentation industry as setting out monascus strain, the preservation of going down to posterity through laboratory, contriver place.

The monascus genomic dna prepares by following step: 1) scrape mycelium from the PDA flat board of having cultivated 10d, filter paper blots, and is weighed as 200mg.2) mycelium after the tinfoil parcel is weighed places the freezing 10min of liquid nitrogen; 3) get 1ml CTAB (2 *) and add beta-mercaptoethanol 20 μ l (final concentration 2%) in ventilating kitchen, 65 ℃ of water-baths are stand-by; 4) get precooling and place on ice, dry, add a small amount of quartz sand, add 2 precooling mortars of liquid nitrogen then in-20 ℃ mortar; 5) the refrigerated mycelium is added in the mortar, grind to form powdery, about 10min; 6) powder transfer after will grinding adds the CTAB of 65 ℃ of preheatings to 1.5ml EP pipe, and the rifle head is inhaled gently and beaten mixing, puts upside down and is placed on 65 ℃ of water-bath 30min for 2-3 time.Water-bath finishes the back takes out, and naturally cools to room temperature, is divided into 2 pipe operations; 7) add equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting, the centrifugal 5min of 12000rpm.Get supernatant to a new 1.5ml EP pipe; 8) repeat once; 9) the RNase I that adds DNase Free is to final concentration 20 μ g/ml, and 37 ℃ of temperature are bathed 30min to eliminate the influence of RNA; 10) add the equal-volume chloroform: primary isoamyl alcohol (24: 1) extracting once; 11) (3M pH5.2) puts upside down mixing to upper water addition 1/10 volume NaAc, places 1h for-20 ℃; 12) the centrifugal 10min of 12000rpm, supernatant discarded; 13) precipitation is with 70% washing with alcohol 2 times, and dry 10min adds 50 μ l TE Buffer (pH8.0) and fully dissolves.14) get 3 μ l and carry out electrophoresis detection, all the other with the packing of 15 μ l/ pipe after in-20 ℃ of preservations.

2, be used to the preparation of each gene fragment of recombinating

With monascus ruber starting strain genomic dna is pcr template, prepares gene replacement fragment by the following primer of respectively organizing.

According to monascus polyketide synthases gene pks1 gene (GenBank accession number: AJ414729) with Citrinin synthesis related gene ctnR gene (GenBank accession number: AB243687) design pcr amplification the primer.

1) preparation ctnR left side (orf1) sequence fragment A (1957bp), the pcr amplification the primer is:

F1：5’ GGCCAAGCTT?CTTGCTCCTGACCAGATTGT?3’(SEQ?ID?NO.1)

R1：5’ ATTGACGAATGGCGGAATATCCCACTGACTTTGCGGACTTTAT?3’(SEQ?ID?NO.2)

PCR condition: 94 ℃ of pre-sex change, 4min; 94 ℃ of sex change, 30s; 55 ℃ of renaturation, 30s; Extend 72 ℃, 2min30s; 30 circulations.

2) preparation ctnR right side (orf3) fragment B (1530bp), the method condition is the same, but primer is:

F2：5’ TAAGAGCGTTTGGACCAGGCCGGCGTTCATAAGGTTGGTTA?3’(SEQ?ID?NO.3)

R2：5’ GGCCAAGCTT?GTGAGCGAAGCCCTGTCT?3’(SEQ?ID?NO.4)

3) fragment C is replaced in preparation, and the amplification target is pks1 (2125bp), primer:

F3：5’ ATAAAGTCCGCAAAGTCAGTGGGATATTCCGCCATTCGTCAAT?3’(SEQ?ID?NO.5)

R3：5’ TAACCAACCTTATGAACGCCGGCCTGGTCCAAACGCTCTTA?3’(SEQ?ID?NO.6)

Method and PCR condition are the same.

4) electrophoresis of PCR product is identified deposition condition: 0.8% sepharose, constant voltage 80v, electrophoresis 30min.Result such as Fig. 2.Electrophoretogram shows that gained PCR product size conforms to the design prediction.

3, the fusion of recombinant fragment

CtnR gene knockout principle of the present invention and schematic flow sheet are as shown in Figure 1.Because primer R1 and F3, R3 and F2 have designed mutual sticky end, can make the mutual intussusception of product, thereby above-mentioned PCR product A (1.9kb) fragment can be connected with C (2.1kb) fragment and obtain " A-C " fragment by primers F 1 and R3 amplification; C can be connected with right side B (1.5kb) fragment and obtain " C-B " fragment by primers F 3 and R2 amplification, product " A-C " and " C-B " are put together the mode of connection that sex change annealing will form " A-C-B ", obtain a large amount of " A-C-B " fragment products (Fig. 2) by primers F 1 and R2 amplification at last, this product by the monascus protoplast transformation then homologous recombination the ctnR gene is replaced, obtain the bacterial strain of low citrinin, whole flow process as shown in Figure 3.

The screening of the recombinant chou of embodiment two low citrinin content and detecting

1. monascus protoplastis preparation

1) with cell age on the glassine paper for the 40-50h mycelium elutes, place the DTT solution of 5mmol to soak 20-30min; Blot with sterilization filter paper sterilized water washing back, changes in the aseptic triangular flask;

2) in triangular flask, add a certain amount of (mycelium of per three wares adds 10ml) MgSO with 1M ₄Cellulase=0.6%: 0.4%: 0.8%) and a spot of sterilized quartz sand solution is the enzymolysis solution (helicase: N,O-Diacetylmuramidase: of solvent preparation; Following 30 ℃ of sterile state, 100rpm, enzymolysis;

3) filter, filtrate is in 3,200rpm, centrifugal 10min; Abandon supernatant, with the resuspended precipitation of 1M MgSO4 solution of precooling;

4) repeat 3), be divided into isopyknic two tubules.

5) two tubules of this equal-volume repeat 3 respectively) step, last two tubules are used the 1M MgSO of isopyknic precooling respectively ₄The resuspended precipitation of solution and sterilized water (contrast) makes it reach the requirement cell concn, is used for transforming.

2.REMI method protoplast transformation

1) protoplasma body fluid is adjusted to 120 μ l by isotonic solution and places 10min on ice;

2) get 20 μ l in contrast, the fusion gene fragment 10 μ l of all the other adding purifying are mixing gently;

3) add HindIII restriction endonuclease 11 μ l, about 100 units; Finger flicks mixing, places 30min on ice;

4) dilution 10 ^-4Doubly, be inoculated in the regeneration PDA flat board that is coated with the subtilis overnight culture in advance, be inverted for 30 ℃ and cultivate.

5) picking colony lift that the inhibition zone of genus bacillus is diminished purifying to the new PDA flat board is cultivated, and obtains doubtful recon.

3. purpose transformant screening and checking

1) the monascus bacterium colony that picking does not have inhibition zone or inhibition zone to diminish to Bacillus subtilus from above-mentioned flat board.Switching microbiotic flat board is got rid of subtilis;

2) repeat the Bacillus subtilus plate screening with checking inhibition zone feature, obtain the bacterial strain ZD19 that inhibition zone obviously dwindles, recons such as ZD4.

3) Molecular Identification of recon

According to the peculiar zone design PCR primer of pksCT of replacing sequence pks1 and ctnR right side, to check whether ctnR is replaced by pks1.With the recon genomic dna is template, the PCR product through electrophoresis showed the reasonableness of clip size, again through order-checking, shown correctly and merged the segmental integration of displacement position that the ctnR position replaces (Fig. 4) by the pks1 sequence.Among Fig. 4, the 6th row the 24th base from left to right begins to be primers F 2 (41bp), the sequence of its front and C fragment pks1) end sequence in full accord, and sequence thereafter and B fragment are in full accord, show that the ctnR sequence on the left of the B is replaced by the pks1 sequence.

The pigment of embodiment three monascus recon ZD19 fermentation myceliums and Citrinin detect

Monascus recon ZD19 slant strains inoculation liquid ground rice substratum (ground rice 6%, analysis for soybean powder 3%, NaNO ₃0.3%, KH ₂PO ₄0.3%, MgSO ₄7H ₂O 0.3%, and regulating the fermented liquid initial pH value is 3), 30 ℃, 150rpm cultivates 7d, extracts Citrinin and carries out the citrinin content analysis by high performance liquid chromatography.Analyze as can be known by HPLC, the appearance time of Citrinin mark post is 18.195min, and the citrinin content of starting strain fermented liquid is 0.56 μ g/ml, and the citrinin content of recon fermented liquid is 0.25 μ g/ml; Citrinin has descended 55%.Measurement result sees Table one.

Table one: starting strain and recombinant bacterial strain ZD19 are through the Citrinin of fermentation generation and the comparison of haematochrome

Bacterial strain	Citrinin (μ g/mL)	Mycelia body colour valency (u/g)
			Starting strain	??0.56	??6371.3
Recombinant bacterial strain ZD19	??0.25	??7642.5

The result: the Citrinin that recombinant bacterial strain ZD19 is produced has reduced by 55% than the Citrinin that starting strain produced, and the haematochrome that recombinant bacterial strain ZD19 is produced has increased by 19.6% than the haematochrome that starting strain produced.

The pigment and the Citrinin analysis of embodiment quatre aspergillus ZD19 bacterial strain mixed fermentation thing

The ground rice substratum

Ground rice: 7%

Protein powder: 3%

NaNO ₃：???????????????0.3％

KH ₂PO ₄：??????????????0.3％

MgSO ₄·7H ₂O：?????????0.3％

Regulate pH to 3.0-3.5,

Culture condition: 34 ℃, 180rpm cultivated 9 days

Fermented product monascorubin and Citrinin analysis:

1. monascorubin analysis: get 1 milliliter of fermented liquid (evenly grinding)+9 milliliter of 70% ethanol, 60 ℃ of water-bath 30min; Filter paper filtering; Get 300 microlitres+2.7 milliliter 70% ethanol, mixing is surveyed OD ₅₀₅(total extension rate is 100 times).

(look valency calculation formula: look valency=total extension rate * OD ₅₀₅Value)

Table two: the comparison of the haematochrome that starting strain and recombinant bacterial strain ZD19 fermentation are produced

The result: the haematochrome that starting strain is produced during the fermentation changes little, and recombinant bacterial strain ZD19 reaches the climax at the haematochrome that fermentation produced in the time of the 8th day, has increased by 33% on year-on-year basis.

2. the fermented product Citrinin is measured: sampling in the 8th day is extracted Citrinin and is detected

Get 5 milliliters of fermented liquids (evenly grinding)+10 milliliters of dehydrated alcohols, 60 ℃ of water-bath 2h (rocking frequently) midway; Get 1 ml soln, 12000rpm, centrifugal 10min; Get supernatant 500 microlitres 12000rpm once more, centrifugal 10min; Get supernatant 200 microlitres and carry out HPLC.

Table three: the comparison of the Citrinin that starting strain and recombinant bacterial strain ZD19 fermentation are produced

The result: in the time of the 8th day, the Citrinin that recombinant bacterial strain ZD19 is produced is compared than starting strain and has been reduced by 55% in fermentation.

SEQUENCE LISTING (sequence table)

＜110〉Dongguan City Tianyi Biological Engineering Co., Ltd.

Zhou Shining

＜120〉have low citrinin and express recombined monascus purpureus with the high haematochrome expression characterization

<130>

<141>2008-12-22

<160>6

<170>PatentIn?version?3.4

<210>1

<211>30

<212>DNA

＜213〉artificial sequence

<400>1

ggccaagctt?cttgctcctg?accagattgt????????????????30

<210>2

<211>43

<212>DNA

＜213〉artificial sequence

<400>2

attgacgaat?ggcggaatat?cccactgact?ttgcggactt?tat?43

<210>3

<211>41

<212>DNA

＜213〉artificial sequence

<400>3

taagagcgtt?tggaccaggc?cggcgttcat?aaggttggtt?a????41

<210>4

<211>28

<212>DNA

＜213〉artificial sequence

<400>4

ggccaagctt?gtgagcgaag?ccctgtct???????????????????28

<210>5

<211>43

<212>DNA

＜213〉artificial sequence

<400>5

ataaagtccg?caaagtcagt?gggatattcc?gccattcgtc?aat??43

<210>6

<211>41

<212>DNA

＜213〉artificial sequence

<400>6

taaccaacct?tatgaacgcc?ggcctggtcc?aaacgctctt?a????41

Claims (3)

1. one kind has low citrinin and expresses recombined monascus purpureus with the high haematochrome expression characterization, it is characterized in that: this bacterial strain called after monascus parpureus Went ZD19, be Monascus purpureus ZD19, be preserved in Chinese typical culture collection center, deposit number is CCTCC NO:M 208199, the Citrinin synthesis related gene ctnR gene that its genome exists is knocked out, replace the ctnR gene order by monascus polyketide synthases gene pks1 gene order, and do not contain the external source resistant gene in the genome of this bacterium.

2. the preparation method of recombined monascus purpureus as claimed in claim 1, it is characterized in that, may further comprise the steps: replace Citrinin synthesis related gene ctnR gene order in the monascus ruber genome by the homologous recombination mode with monascus polyketide synthases gene pks1 gene order, utilize Citrinin the inhibition feature of Bacillus subtilus to be carried out the screening of target recon as genetic marker then, the monascus bacterium colony that selection does not have inhibition zone or inhibition zone to diminish to Bacillus subtilus, thus described monascus ruber obtained with low citrinin expression and high haematochrome expression characterization.

3. recombined monascus purpureus as claimed in claim 1 is used to prepare the purposes of monascorubin.

Images