CN101654701B

CN101654701B - Primer for evaluating molecular target medicine for EGFR gene mutation

Info

Publication number: CN101654701B
Application number: CN2009100562027A
Authority: CN
Inventors: 毛丹丹; 傅咏南
Original assignee: SHANGHAI ZHONGYOU MEDICINE HIGH-TECH Co Ltd
Current assignee: SHANGHAI ZHONGYOU MEDICINE HIGH-TECH Co Ltd
Priority date: 2009-08-10
Filing date: 2009-08-10
Publication date: 2012-06-20
Anticipated expiration: 2029-08-10
Also published as: CN101654701A

Abstract

The invention relates to a test method of epidermal growth factor receptor (EGFR) gene mutation for screening and assessing therapeutic effects of molecular targeted agents, which is characterized by the following specific steps: acquiring serum or tumor tissue samples of testees, extracting genomic DNA, testing No.18-21 exons of the EGFR gene, designing corresponding site-specific primers and adopting experimental schemes, reagents and report generation systems for sequence determination and assessing the effectiveness of EGFR tyrosine kinase inhibitors used for treating cancer individuals by simultaneously testing and analyzing whether mutation exists on the No.18-21 exons of the individual EGFR gene. The method has the advantage of being used for the EGFR tyrosine kinase inhibitors used for treating cancer individuals.

Description

The primer that is used for the EGFR gene mutation for screening and assessing therapeutic effects of molecular targeted agents

Technical field

The present invention relates to the detection method of EGFR gene mutation for screening and assessing therapeutic effects of molecular targeted agents; The method of utilizing directly order-checking is to the detection that suddenlys change of EGFR gene 18-21 exon; For targeted therapy targetedly provides foundation; To avoid non-rational use of drug,, belong to the drug testing technical field better for the patient provides regimen.

Background technology

(epidermal growth factor receptor is a kind of multi-functional gp that is distributed widely on each cell membranes in tissue of human body EGFR) to EGF-R ELISA, is one of HER/ErbB family member.This family comprises EGFR, HER2, HER3 and HER4.EGFR combines the back to form dimer at cell surface with its part (EGF, TGF α, HB-EGF, amphiregulin, betacellulin).This dimer comprises and the homodimer of itself formation and the heterodimer that forms with other member of erbB family.After the receptor dimerization, the activation of intrinsic protein kinase, the TK phosphorylation makes under the signal and passes.Thereby, activate 3 main signal paths in its downstream: Ras2/Raf2/MAPK path, phosphatidyl InsP3 (PI3K) and silk Serineprotein kinase (AKT), JAK and STAT path.The final mediated cell of 3 barss transductions path breaks up, survive, move, attack, stick and a series of processes such as cell injury reparation.The medicine of targeting EGFR through the disabling signal conduction, reaches therapeutic purpose.

EGFR is a kind of transmembrane receptor, and it belongs to a family that comprises four kinds of GAP-associated protein GAPs.Optionally different with the 10 kinds part of each acceptor combines.After a part combined a strand EGFR, acceptor formed dimer, and it is through the activity of Tyrosylprotein kinase, and the activated receptor autophosphorylation sends signal in cell.Autophosphorylation triggers approach in a series of born of the same parents, can cause cancer cell multiplication, retardance apoptosis, activation (tumour) invasion and attack and transfer, and stimulates the new vessel of tumor inducing to form.The transgenation of EGFR is as making a whether effective important factor of medicament.Discovering up to date, the transgenation of EGFR still is present in exons 1 8～21, and the sudden change of different exons will cause conformational change, change and strengthen proteic activity, the same susceptibility that strengthens TKI.TKI stops the tyrosine residues phosphorylation, thereby stops the conduction of EGFR signal path through combining Tyrosylprotein kinase district in the EGFR born of the same parents with the ATP competition, finally reaches a series of tumour cell biological activities such as suppressing tumor proliferation, transfer, vasculogenesis.

Epidermal growth factor recipient tyrosine kinase inhibitor (EGFR-TKI) is like Avastin (AVASTIN); Te Luokai (Erlotinib); (gefitinib claims Iressa again, Iressa) to ZD1939; The signal that epidermal growth factor recipient tyrosine kinase blocking-up tumour cell necessary in the generation of inhibition tumour, the development can be passed through in west appropriate former times single (Erbitux) etc. conducts, thereby reaches hyperplasia, invasion and attack, transfer, the vasculogenesis of inhibition tumour cell and promote the accent of tumour cell to die.According to the action target spot and the character of medicine, can target EFGR medicine be divided into two types: one type is monoclonal antibody (Cetuximab, ABX-EGF; EMD 72000 etc.); Through the extracellular region of identification receptor, competition combines with part, disturbs the autophosphorylation of EGFR and block cell surface EGFR dimer to form; Suppress signal transducting system and activate, thereby suppress tumor cell proliferation; Another kind of is micromolecular compound (IRESSA; Erlotinib, EKB2569 etc.), can get in the cell; Directly act on the intracellular region of EGFR; Disturb ATP to combine, the activity that suppresses tyrosine is blocked the phosphorylation of kinase whose autophosphorylation and substrate, thoroughly blocks unusual tyrosine kinase signal conduction.Though the site of action of two types of medicines is different; But through stoping the ligand-mediated acceptor and the activation of downstream signal path; The similar effect of final generation promptly blocks cell and forms, suppresses to attack and transfer at G1 phase, promotion apoptosis, inhibition new vessel, thereby plays therapeutic action.

Lynch etc. and Paez etc. have reported that at first the sudden change that is positioned at EGFR Tyrosylprotein kinase coding region the 18th～21 exon and gefitinib's is efficient obviously relevant.Experiment confirm EGFR transgenation can cause cell function to change; Discoveries such as Lynch import the cell of de1747～753InsS and L858R and compare with the cell with Wild type EGFR; The proteic expression level of EGFR is suitable; The phosphorylation degree of EGFR two mutants is higher behind the adding EGF, and the time length is longer.The H325S cell that L858R is carried in discoveries such as Paez is higher 100 times than wild-type cell to the susceptibility of gefitinib; Gefitinib not only suppresses the EGFR self-phosphorylation, also suppresses EGFR downstream molecules ERK 1/2 and the kinase whose phosphorylation of AKT.The EGFR gene is totally 28 exons. and what wherein encode the Tyrosylprotein kinase district is the 18th～21 exon.Data analysis to the EGFR transgenation shows, although mutable site is dispersed in whole Tyrosylprotein kinase coding region, 89% sudden change concentrates on the disappearance of the 19th exon and the L858R point mutation of the 21st exon.

It is a kind of transmembrane receptor of gp that experiment confirm has the sudden change EGFR of function, is the member of Tyrosylprotein kinase growth factor receptors family.In case EGFR born of the same parents' outside part combines with part, will form receptor homolog dimer or heterodimer at cell surface.The modal heterodimer type of EGFR is Her-2.This Dimerized conformation that changes acceptor; The specific tyrosine residues autophosphorylation that causes acceptor born of the same parents inner structure; Activate its downstream signal approach, outer signals transduceed to cell, the gene of this sudden change by transfection behind cell; Improved the reactivity of cell, also obviously increased susceptibility gefitinib to EGF.

Lynch etc. think that this phenomenon possibly be because the EGFR sudden change makes some crucial group generation reconstruct of EGFR SRCA TP binding site, has strengthened the interaction with ATP or its competitive inhibitor gefitinib.Therefore, there is the patient of sudden change EGFR gene to show better therapeutic response to gefitinib.Paez etc. have taken the lead in analyzing 119 routine NSCLC patients' the sudden change and the relation of Clinical symptoms, find that the EGFR mutation rate is higher than other histological type in gland cancer, and the women is higher than the male sex.Primary pulmonary gland cancer patients are all selected in experiment this time, and male sex EGFR transgenation incidence is starkly lower than the women as a result, conform to people's such as Paez result.Only have an appointment among the patient of U.S.'s nonsmall-cell lung cancer 10% EGFR arranged transgenation, yet in the Aisa people, about 30% nonsmall-cell lung cancer patient has the transgenation of EGFR.Gland cancer EGFR mutation rate is 37.6% in this experiment, is higher than the average mutation rate of nonsmall-cell lung cancer, and this explains that also the mutation rate in Chinese's gland cancer is higher than the mutation rate of other histological type, and apparently higher than the occidentals.Discovery non-smoking NSCLC patients' such as Pao EGFR mutation rate is higher than the previously patient of smoking, and in this research, no smoking history case EGFR transgenation incidence is 47.1%, and is also apparently higher than smoking history person is arranged, consistent with some bibliographical information.With the EGFR receptor tyrosine kinase is a kind of new selection that the target spot antitumor drug has become the advanced lung cancer treatment.Because EGFR transgenation and TKIs treatment susceptibility significant correlation should be selected medication according to EGFR sudden change situation clinically among the NSCLC.

Summary of the invention

The purpose of this invention is to provide the detection method that a kind of epidermal growth factor recipient tyrosine kinase suppresses curative effect of medication, can be used for assessing the curative effect of Iressa class pharmacological agent tumour.

In order to realize above purpose, technical scheme of the present invention provides the detection method that a kind of epidermal growth factor recipient tyrosine kinase suppresses curative effect of medication, it is characterized in that concrete steps are:

Step 1. is gathered measured's serum or tumor tissues sample;

The method for extracting of step 2. genomic dna:

Adopt measured DNA in the silica gel adsorption extraction steps 1, the extracting time is 2-3 hour, adopts the running gel imaging method that DNA concentration and purity are detected, and the visible clear white ribbon of naked eyes can judge that the DNA of acquisition can get into next step detection;

Step 3. gene type:

Each measured's sample is put into 4 reacting holes respectively; 4 reacting holes detect EGFR gene 18-21 exons mutation situation respectively, and the employing round pcr increases, gel electrophoresis technology detects purity, sequencing technologies carries out genotype to these sites and confirms:

Step 3-1, the reaction system configuration:

In each reacting hole, add PCR standard reaction system; The primer concentration of standard reaction system is 10uM, and the reaction system TV is 20ul, wherein; PCR reagent (the biochemical KT202-12 of day root) 5ul; Each 0.4ul of forward primer and reverse primer, the EGFR dna profiling 3 μ l that the step 2 of 20ng/ μ l obtains, deionized water 11.2ul;

EGFR gene the 18th exon forward and reverse primer:

Positive primer: ttccaaatgagctggcaagt

Reverse primer: gtcaatggcccctttcataa

EGFR gene the 19th exon forward and reverse primer:

Positive primer: ccccagcaatatcagcctta

Reverse primer: agtgctgggtagatgccagt

EGFR gene the 20th exon forward and reverse primer:

Positive primer: gcacagcttttcctccatga

Reverse primer: gatgggacaggcactgattt

EGFR gene the 21st exon forward and reverse primer:

Positive primer: actaacgttcgccagccata

Reverse primer: tcattcactgtcccagcaag

Step 3-2, the PCR reaction conditions:

Reacting hole is reacted on ABI9700 type pcr amplification appearance, and reaction conditions is 95 ℃ of preheatings 15 minutes; Carry out 95 ℃ of 35 round-robin, 45 seconds again; 60 ℃, 45 seconds; 72 ℃, 60 seconds; Be cooled to 4 ℃ after 72 ℃, 7 minutes;

Step 3-3 carries out electrophoresis detection with reacting hole at the reacted product of pcr amplification appearance, has the visible clear white ribbon of naked eyes can get into next step:

A.1wt% sepharose is inserted small size hole comb;

B.2000bpDNA affinity tag 6ul

C. the PCR product 4ul of step 3-2 adds electrophoretic buffer 1ul

D. electrophoretic voltage: 120v

E. electrophoresis time: 20min takes an electrophorogram; 30min takes an electrophorogram;

Step 3-4, purifying:

Final concentration: PCR product purification reagent 0.2U SAP+PCR product purification reagent 2.5U EXON1/7ul;

In each reacting hole, add reaction system, the reaction system TV is 7ul, deionized water ddH ₂The PCR product 3ul of O 3.825ul, PCR product purification reagent SAP 0.05ul, PCR product purification reagent E XON1 0.125ul, step 3-3; Reaction conditions is: 37 ℃, 60min; 80 ℃, 15min; 4 ℃ of constant temperature are preserved;

Step 3-5 checks order each reacting hole behind the purifying, and primer concentration is 1uM, ABI 3730 sequenators;

Step 3-5-1 takes out PCR purified product, the sequencing reagent BigDye of step 3-4, four kinds of dNTP, 1uM sequencing primer from-20 degree refrigerators, 18-21 exon sequencing primer is respectively: ttccaaatgagctggcaagt; Ccccagcaatatcagcctta; Gcacagcttttcctccatga; Actaacgttcgccagccata;

Step 3-5-2, PCR purified product name, the primer, reaction system, sequencing reagent consumption, the PCR reaction conditions of record date, the reaction of doing;

Step 3-5-3 gets a deblocking reaction plate, puts on template name, sequencing primer name, date;

Step 3-5-4, each sample need do two PCR reactions, with a reacting hole;

Step 3-5-5 adds reaction system in each reacting hole, reaction system is the BigDye of 0.5ul, the dNTP of 1.4ul, the sequencing primer of 2ul, the PCR purified product of 3ul, the deionized water ddH2O of 0.1ul; After the system branch installed, last whizzer reached 900 rev/mins and promptly stops;

Step 3-5-6 is placed on Sptting plate on the ABI9700 type pcr amplification appearance and reacts, and reaction conditions is 96 ℃ of preheatings 10 seconds; Carry out 96 ℃ of 25 round-robin, 10 seconds again; 50 ℃, 5 seconds; 60 ℃, 4 minutes; Being cooled to 4 ℃ of constant temperature after 60 ℃, 4 minutes preserves;

Step 3-5-7 after amplification finishes, adds 1ul 125mM edta edta in every hole;

Step 3-5-8 adds absolute ethyl alcohol 15ul in every hole again and precipitates in room temperature, must not be above 24 hours;

Step 3-5-9 puts into refrigerated centrifuge with 96 orifice plates, and 3650 rev/mins, 4 ℃ centrifugal 30 minutes;

Step 3-5-10 removes supernatant gently, and 96 orifice plates are centrifugal, reaches 800 commentaries on classics and promptly stops; Add 30ul 70wt% ethanol again in every hole, 3650 rev/mins, 4 ℃ centrifugal 15 minutes, remove supernatant gently; 96 orifice plates are centrifugal, reach 800 commentaries on classics and promptly stop, residual alcohol is air-dry, and room temperature was placed 20 minutes;

Step 3-5-11, every hole adds 8ul 95wt% methane amide and ddH ₂The O mixture;

Step 3-5-12 carries out the result and reads on ABI 3730, consult all 2 types of results of each exon of order-checking detected result: 18-21 with software Chromas, promptly normal result and sudden change result;

Step 4, interpretation of result:

1, do not detect sudden change: do not find to exist on the EGFR gene 18-21 exon sudden change in your detected result;

2. detect sudden change: find in your detected result to have sudden change on the EGFR gene 18-21 exon.

The present invention is to detecting on the EGFR gene 18-21 exon; Whether the design of corresponding site Auele Specific Primer and the experimental program, reagent and the report preparing system that are used for sequencing be through existing sudden change to assess the validity that is used to treat the individual epidermal growth factor recipient tyrosine kinase inhibitor class medicine of cancer on the individual EGFR gene 18-21 exon of while check and analysis.

The type of gathering sample is a serum sample, and it is few to adopt silica gel adsorption extracting DNA to have required sample size, the extracting steady quality, and extract product purity is high, characteristics easy and simple to handle.

Utilize the present invention to surpassing the detected result demonstration of the above Chinese population samples of 100 examples, the genotype detection recall rate can reach more than 99% on the EGFR gene 18-21 exon that carries out according to aforesaid method, and reproducibility of results reaches 100%.

Advantage of the present invention is to can be used for detecting the individual epidermal growth factor recipient tyrosine kinase inhibitor class medicine of cancer.

Description of drawings

Fig. 1 is the electrophoresis result figure of 7 sample PCR after products;

Fig. 2 is that No. 18 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result;

Fig. 3 is that No. 19 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result;

Fig. 4 is that No. 20 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result;

Fig. 5 is that No. 21 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result;

Fig. 6 is No. 18 exon experiment of an EGFR gene sudden change synoptic diagram as a result;

Fig. 7 is No. 19 exon experiment of an EGFR gene sudden change synoptic diagram as a result;

Fig. 8 is No. 20 exon experiment of an EGFR gene sudden change synoptic diagram as a result;

Fig. 9 is No. 21 exon experiment of an EGFR gene sudden change synoptic diagram as a result.

Embodiment

Below in conjunction with accompanying drawing and embodiment the present invention is described further.

Embodiment

A kind of epidermal growth factor recipient tyrosine kinase suppresses the detection method of curative effect of medication, and concrete steps are:

Step 1. is gathered measured's serum or tumor tissues sample;

The method for extracting of step 2. genomic dna:

Step 3. gene type:

Step 3-1, the reaction system configuration:

EGFR gene the 18th exon forward and reverse primer:

Positive primer: ttccaaatgagctggcaagt

Reverse primer: gtcaatggcccctttcataa

EGFR gene the 19th exon forward and reverse primer:

Positive primer: ccccagcaatatcagcctta

Reverse primer: agtgctgggtagatgccagt

EGFR gene the 20th exon forward and reverse primer:

Positive primer: gcacagcttttcctccatga

Reverse primer: gatgggacaggcactgattt

EGFR gene the 21st exon forward and reverse primer:

Positive primer: actaacgttcgccagccata

Reverse primer: tcattcactgtcccagcaag

Step 3-2, the PCR reaction conditions:

A.1wt% sepharose is inserted small size hole comb;

B.2000bpDNA affinity tag 6ul

C. the PCR product 4ul of step 3-2 adds electrophoretic buffer 1ul

D. electrophoretic voltage: 120v

7 sample PCR after products, the electrophoresis result figure of 25ng/ul is about purpose band 800bp;

As shown in Figure 1, be the electrophoresis result figure of 7 sample PCR after products.

Step 3-4, purifying:

In each reacting hole, add reaction system, the reaction system TV is 7ul, deionized water ddH ₂The PCR product 3ul of O 3.825ul, PCR product purification reagent SAP (promega M8201) 0.05ul, PCR product purification reagent E XON1 (NEBM0293V) 0.125ul, step 3-3; Reaction conditions is: 37 ℃, 60min; 80 ℃, 15min; 4 ℃ of constant temperature are preserved;

Step 3-5-1; From-20 degree refrigerators, take out PCR purified product, the sequencing reagent BigDye (PEApplied Biosystems 4337574) of step 3-4, four kinds of dNTP, 1uM sequencing primer, 18-21 exon sequencing primer is respectively: ttccaaatgagctggcaagt; Ccccagcaatatcagcctta; Gcacagcttttcctccatga; Actaacgttcgccagccata;

Step 3-5-4, each sample need do two PCR reactions, with a reacting hole;

Step 3-5-11, every hole adds 8ul 95wt% methane amide and ddH ₂The O mixture;

Step 3-5-12 carries out the result and reads on ABI 3730, consult all 2 types of results of each exon of order-checking detected result: 18-21 with software Chromas, promptly normal result and sudden change result; As shown in Figure 2, for No. 18 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result; As shown in Figure 3, for No. 19 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result; As shown in Figure 4, for No. 20 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result; As shown in Figure 5, for No. 21 exon experiment of EGFR gene do not have sudden change synoptic diagram as a result.Fig. 6 is No. 18 exon experiment of an EGFR gene sudden change synoptic diagram as a result; Fig. 7 is No. 19 exon experiment of an EGFR gene sudden change synoptic diagram as a result; Fig. 8 is No. 20 exon experiment of an EGFR gene sudden change synoptic diagram as a result; Fig. 9 is No. 21 exon experiment of an EGFR gene sudden change synoptic diagram as a result.The picture of measured EGFR gene 18-21 exon and above-mentioned normally comes to the same thing, and does not all have sudden change.

Step 4. draws detected result at last, and it is following to provide interpretation of result: big quantity research shows that the sudden change of EGFR gene 18-21 exon and epidermal growth factor recipient tyrosine kinase inhibitor class pharmacological agent cancer curative effect have substantial connection.The EGFR sudden change makes some crucial group generation reconstruct of EGFR SRCA TP binding site; Strengthened and ATP or its competitive inhibitor ZD1939 (gefitinib; Claim Iressa again, interaction Iressa), the individual epidermal growth factor recipient tyrosine kinase inhibitor class pharmacological agent tumor effect that uses is good; If there is not sudden change in opposite EGFR18-21 exon, the so individual epidermal growth factor recipient tyrosine kinase inhibitor class pharmacological agent tumor effect that uses is not good.There is not EGFR gene 18-21 exons mutation in your detected result.

Sequence table:

< 110>Shanghai Zhongyou Medicine High-tech Co., Ltd.

< 120>detection method of EGFR gene mutation for screening and assessing therapeutic effects of molecular targeted agents

<160>12

<210>1

<211>600

<212>DNA

< 213>people (Homo sapiens)

<400>1

taccaacttc?tgtcaagctc?tgtagagaag?gcgtacattt?gtccttccaa?atgagctggc 60

aagtgccgtg?tcctggcacc?caagcccatg?ccgtggctgc?tggtccccct?gctgggccat?120

gtctggcact?gctttccagc?atggtgaggg?ctgaggtgac?ccttgtctct?gtgttcttgt?180

cccccccagc?ttgtggagcc?tcttacaccc?agtggagaag?ctcccaacca?agctctcttg?240

aggatcttga?aggaaactga?attcaaaaag?atcaaagtgc?tgggctccgg?tgcgttcggc?300

acggtgtata?aggtaaggtc?cctggcacag?gcctctgggc?tgggccgcag?ggcctctcat?360

ggtctggtgg?ggagcccaga?gtccttgcaa?gctgtatatt?tccatcatct?actttactct?420

ttgtttcact?gagtgtttgg?gaaactccag?tgtttttccc?aagttattga?gaggaaatct?480

tttataacca?cagtaatcag?tggtcctgtg?agaccaattc?acagaccaaa?ggcattttta?540

tgaaaggggc?cattgacctt?gccatggggt?gcagcacagg?gcgggaggag?ggccgcctct?600

<210>1

<211>600

<212>DNA

< 213>people (Homo sapiens)

<400>2

aggctttaca?agcttgagat?tcttttatct?aaataatcag?tgtgattcgt?ggagcccaac 60

agctgcaggg?ctgcgggggc?gtcacagccc?ccagcaatat?cagccttagg?tgcggctcca?120

cagccccagt?gtccctcacc?ttcggggtgc?atcgctggta?acatccaccc?agatcactgg?180

gcagcatgtg?gcaccatctc?acaattgcca?gttaacgtct?tccttctctc?tctgtcatag?240

ggactctgga?tcccagaagg?tgagaaagtt?aaaattcccg?tcgctatcaa?ggaattaaga?300

gaagcaacat?ctccgaaagc?caacaaggaa?atcctcgatg?tgagtttctg?ctttgctgtg?360

tgggggtcca?tggctctgaa?cctcaggccc?accttttctc?atgtctggca?gctgctctgc?420

tctagaccct?gctcatctcc?acatcctaaa?tgttcacttt?ctatgtcttt?ccctttctag?480

ctctagtggg?tataactccc?tccccttaga?gacagcactg?gcctctccca?tgctggtatc?540

caccccaaaa?ggctggaaac?aggcaattac?tggcatctac?ccagcactag?tttcttgaca?600

<210>1

<211>600

<212>DNA

< 213>people (Homo sapiens)

<400>3

cgtccctgtg?ctaggtcttt?tgcaggcaca?gcttttcctc?catgagtacg?tattttgaaa 60

ctcaagatcg?cattcatgcg?tcttcacctg?gaaggggtcc?atgtgcccct?ccttctggcc?120

accatgcgaa?gccacactga?cgtgcctctc?cctccctcca?ggaagcctac?gtgatggcca?160

gcgtggacaa?cccccacgtg?tgccgcctgc?tgggcatctg?cctcacctcc?accgtgcagc?240

tcatcacgca?gctcatgccc?ttcggctgcc?tcctggacta?tgtccgggaa?cacaaagaca?300

atattggctc?ccagtacctg?ctcaactggt?gtgtgcagat?cgcaaaggta?atcagggaag?360

ggagatacgg?ggaggggaga?taaggagcca?ggatcctcac?atgcggtctg?cgctcctggg?420

atagcaagag?tttgccatgg?ggatatgtgt?gtgcgtgcat?gcagcacaca?cacattcctt?480

tattttggat?tcaatcaagt?tgatcttctt?gtgcacaaat?cagtgcctgt?cccatctgca?540

tgtggaaact?ctcatcaatc?agctaccttt?gaagaatttt?ctctttattg?agtgctcagt?600

<210>1

<211>600

<212>DNA

< 213>people (Homo sapiens)

<400>4

cagcagcggg?ttacatcttc?tttcatgcgc?ctttccattc?tttggatcag?tagtcactaa 60

cgttcgccag?ccataagtcc?tcgacgtgga?gaggctcaga?gcctggcatg?aacatgaccc?120

tgaattcgga?tgcagagctt?cttcccatga?tgatctgtcc?ctcacagcag?ggtcttctct?180

gtttcagggc?atgaactact?tggaggaccg?tcgcttggtg?caccgcgacc?tggcagccag?240

gaacgtactg?gtgaaaacac?cgcagcatgt?caagatcaca?gattttgggc?tggccaaact?300

gctgggtgcg?gaagagaaag?aataccatgc?agaaggaggc?aaagtaagga?ggtggcttta?360

ggtcagccag?cattttcctg?acaccaggga?ccaggctgcc?ttcccactag?ctgtattgtt?420

taacacatgc?aggggaggat?gctctccaga?cattctgggt?gagctcgcag?cagctgctgc?480

tggcagctgg?gtccagccag?ggtctcctgg?tagtgtgagc?cagagctgct?ttgggaacag?540

tacttgctgg?gacagtgaat?gaggatgtta?tccccaggtg?atcattagca?aatgttaggt?600

<210>5

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the forward primer that EGFR gene the 18th extra shows the subsequence amplification.

<400>5

ttccaaatga?gctggcaagt 20

<210>6

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the reverse primer that EGFR gene the 18th extra shows the subsequence amplification.

<400>6

gtcaatggcc?cctttcataa 20

<210>7

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the forward primer that EGFR gene the 19th extra shows the subsequence amplification.

<400>7

ccccagcaat?atcagcctta 20

<210>8

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the reverse primer that EGFR gene the 19th extra shows the subsequence amplification.

<400>8

agtgctgggt?agatgccagt 20

<210>9

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the forward primer that EGFR gene the 20th extra shows the subsequence amplification.

<400>9

gcacagcttt?tcctccatga 20

<210>10

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the reverse primer that EGFR gene the 20th extra shows the subsequence amplification.

<400>10

gatgggacag?gcactgattt 20

<210>11

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the forward primer that EGFR gene the 21st extra shows the subsequence amplification.

<400>11

actaacgttc?gccagccata 20

<210>12

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>be used for the reverse primer that EGFR gene the 21st extra shows the subsequence amplification.

<400>12

tcattcactg?tcccagcaag 20

Claims

1. one group of EGFR gene mutation for screening PCR primer is characterized in that, comprising:

EGFR gene the 18th exon forward and reverse primer:

Forward primer: ttccaaatgagctggcaagt;

Reverse primer: gtcaatggcccctttcataa;

EGFR gene the 19th exon forward and reverse primer:

Forward primer: ccccagcaatatcagcctta;

Reverse primer: agtgctgggtagatgccagt;

EGFR gene the 20th exon forward and reverse primer:

Forward primer: gcacagcttttcctccatga;

Reverse primer: gatgggacaggcactgattt;

EGFR gene the 21st exon forward and reverse primer:

Forward primer: actaacgttcgccagccata;

Reverse primer: tcattcactgtcccagcaag.

2. one group of EGFR gene mutation for screening PCR primer as claimed in claim 1 is characterized in that also comprise: 18-21 exon sequencing primer is respectively: ttccaaatgagctggcaagt; Ccccagcaatatcagcctta; Gcacagcttttcctccatga; Actaacgttcgccagccata.